Q Research General #1611 What's in the Boooox?!? Edition Anonymous 05/03/18 (Thu) 13:27:25 aee2d4 No. 1285122
Welcome To Q Research General
Q's Tripcode: Q !xowAT4Z3VQ
Q's Latest Posts
Wednesday 5.02.2018
>>1280616 ------------------ (Shipping Pallets)
>>1280036 ------------------ (Apple HQ)
>>1280030 ------------------ (JetBlue taking off from San Jose?)
Monday 4.30.2018
>>1249365 ------------------ Knowing what you know now.
>>1248119 ------------------ Define the terms of the Iran nuclear deal.
>>1247406 ------------------ No name out.
>>1244154 ------------------ Emmy awards. Red carpet event?
>>1243783 rt >>1243759 Assets in place.
>>1243605 rt >>1243593 EagerLion18: Live fire exercise with Jordanian Marines.
>>1243597 rt >>1243510 Connect. No coincidences.
>>1243510 ------------------ Pompeo visits Jordan.
Sunday 4.29.2018
>>1242689 rt >>1242682 (Q verifies anonymous post)
>>1242682 rt >>1242608 rt >>1242545 R=18 (QAnon ID:038c68)
>>1242619 rt >>1241774 , >>1241803 Do you believe in Coincidences?
>>1233880 rt >>1233553 Operators have died. They lay down their lives so that others may live, FREE!
>>1233553 rt >>1233458 Personal thank you to (you).
>>1233458 ------------------ Be careful who you are following.
Saturday 4.28.2018
>>1229092 rt >>1228857 Stay strong. Stay united. BOOM week ahead.
>>1228613 rt >>1228588 Noted:IP-Ghost:
>>1228588 rt >>1228489 You know that we know. You know what we have. Your move.
>>1218893 rt >>1218465 We are in this together
Friday 4.27.2018
>>1218390 rt >>1218316 Autists need Red Bull?
>>1218299 ------------------ Peace in the Korean Peninsula.
>>1218147 ------------------ Focus only on the FBI [for now]
>>1215845 ------------------ Question everything
>>1215294 ------------------ Questions will reveal answers
>>1214085 ------------------ Reconcile
>>1211768 rt >>1211682 Re_read drops
>>1211682 rt >>1211560 EYES OPEN? COMMS GOOD?
>>1211560 rt >>1211493 What is the purpose of a laser pointer?
>>1211343 rt >>1211294 "Done in 30"
>>1211294 ------------------ Who knows where the bodies are buried?
Thursday 4.26.2018
>>1203338 rt >>1203096 GOOD people are acting on the information.
>>1203057 ------------------ Patience isn't always easy
>>1198932 rt >>1198778 Important note [texts only].
>>1197788 rt >>1197573 How many pics can you find of JL & HRC?
>>1197560 ------------------ Sessions playing 4D chess
Wednesday 4.25.2018
>>1189217 rt >>1189008 Try harder.
>>1187806 rt >>1187631 Welcome to the WH.
>>1187631 ------------------ What happens to...
>>1187021 rt >>1187000 Note 187.
>>1187000 rt >>1186910 Non-public release of Strzock texts
>>1184271 ------------------ Are you awake?
>>1183319 ------------------ Did you know?
>>1181425 rt >>1181379 WW = worldwide. Try harder.
>>1181379 rt >>1181185 They tried to delete the proof.
>>1181185 rt >>1180770 We knew this day would come.
>>1180770 rt >>1180605 The world is Connected. All or nothing.
>>1180770 rt >>1180604 The world is Connected. All or nothing.
>>1180605 rt >>1180433 Think logically\u2026Power shift. Rise of the people.
>>1180433 rt >>1180390 "Politics." Same for Merkel. Think movie.
>>1180364 ------------------ They Feel Threatened By Us
Find Previous Q Posts at: qanonmap.bitbucket.io/ qanon.pub
If it ever goes down, the mirrors are: qntmpkts.keybase.pub & qanonmap.bitbucket.io
Backup Q Posts
>>>/comms/226
Board Rules >>3138
NEWBIES >>1254488
* Spreadsheet: docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/
* Searchable, interactive archive with user-explanations: qanon.pub
* Q Raw Text Dump: pastebin.com/3YwyKxJE
Redpill for normies >>1087693 Proof POTUS was behind Q even before he appeared on the chans.
>>1071025 How to Quickly Spot a Shill
>>1113115, >>1113120 How to filter a Shill
READ: SOCIAL MEDIA PROTOCOLS
1. DO NOT CONFRONT accounts that are being tracked. WATCH. ARCHIVE. REPORT.
2. If you find an important account, ARCHIVE OFFLINE BEFORE POSTING''' link to 8ch.
We must avoid tipping off the black hats until archiving is complete.
>>1126202 , >>1207179 For Instagram mirroring
>>1127332 For Website mirroring
>>1272084 For Twitter mirroring
Anonymous 05/03/18 (Thu) 13:28:19 aee2d4 No. 1285134
Notables
are not endorsements
#1610
>>1284410 Hollywood Has Ignored Law Protecting Children From Predators
>>1284892 ADRENO + CHROME DAYDREAM Ready
>>1284645 Not a normal shipment zero identifying/normal shipping related labels/doc
>>1284656 Left/Right TV - possible left/right up/down explanation
>>1284841 "17" signatures nominating POTUS for Nobel
>>1285012 April Indictment Count Tops 28,000
>>1284982 ; >>1284860 ; >>1284887 → Q photos probably related to new about Pentagon banning Chinese phones
#1609
>>1283850 Q images DO NOT mean Q is allied to, or visiting Apple HQ
>>1283960 Cryptic Posts dropped after Q posted
>>1284055 Our great financial team is in China tweet analysis
>>1284059 Chinese hold the the keys to apples I cloud storage clue
>>1284076 Planefag spots a similarity
>>1284075 Lots of "flood" in the news lately.
>>1284121 Logistics-fag notes Refrigerated trailer.
>>1284145 Sauce on global shill machine
>>1284175 Refrigerated trailer comparison
>>1284185 Sir Jonathan Paul Ive,Chief design officer (CDO) of Apple Inc. DIGz
>>1284227 Apple factories in China, bad working conditions, suicides
>>1284053 MapFag finds a bone?
>>1284248 More Q post pic related map digs .
>>1284296 Anon putting it together
#1608 TAG TEAM NOTABLES
>>1283032 Distribution fag on the shipping containers
>>1282709 Marker Timestamps
>>1282975 5 services members died recently in c-130
>>1283143 Anon confirms Q's pic locations
>>1283382 How to hide msg inside a file or img
#1607 TAG TEAM NOTABLES
>>1282178 Enhanced photos of shipping container
>>1282491 namefag Apple Q+ responds to anon post mimicing Q's format
>>1282232 Q posts links to Hillary Clinton and Remote Tracking company
>>1282402 Q's image naming format vs MySQL relation (requires digging)
#1606 TAG TEAM NOTABLES
>>1282435 US moving tons of radioactive material to Russia
>>1281453 Pentagon orders military stores to stop selling Chinese phones
#1605 TAG TEAM NOTABLES
>>1281348 Soros funding tied to EU Council of Foreign Relations
>>1281422 Timemarkers 11:37 and 11:45 link to Nixon and Trump China relations
#1604 TAG TEAM NOTABLES
>>1279851 We need to find the key.
>>1279958 this post key to everything.
>>1280033 timestamps
>>1279871 who knows where the bodies are buried?
>>1279916 anon kisses our ass before gives up
>>1279927 Aaron Traywick, CEO/Founder Ascendance Biomedical –"no foul play" in Spa Room [RIP]
>>1279928 [CLAS-N-DI_9]
>>1279992 Embedded chips in Planes/Trains/etc
>>1280030 Q
>>1280036 Q
>>1280387 JetBlue conf_
>>1280419 TimCook..Apple happenings prior to Q
>>1280431 apple Hq conf_
>>1280295 Vegas body cam release
#1603 TAG TEAM NOTABLES
>>1279156
>>1279204 KIM K + Kushner
>>1279354 VOTE THEM OUT
>>1279408 Puzzle pieces after Rudy
>>1279432 Fishy Feinstein
>>1279450 Iran Turkish Gold Rush
>>1279552 NK possible detainee release
>>1279582 Argentinian Prez claims BHO asked to provide Nuke Fule to Iran
>>1279612 Iran Nuclear Details..2011
>>1279624 Ask Spielberg ?Heather ORourke
>>1279650 Standard Hotel, Acid
>>1279756 Obama/Iran Negotiations 2015
>>1279774 Tehran to pay $6B to 9/11 victims
>>1279778 CT house explosion—Officer down
#1602
>>1278327 Heather O'Rourke was murdered?
>>1278684 John Podesta on season premiere of "Ancient Aliens"
>>1278765 North Korea moves 3 detained Americans to hotel ahead of planned Trump summit, reports say
#1601
>>1277611 The Sum of All Fears Analysis
>>1277940 wikileaks just tweeted this and immediately removed it, >>1278484 Nope, just a correction
>>1277998 True Pundit - giuliani-calls-muellers-demands-to-sit-down-with-trump-a-bullshit-interview
>>1278033 TP gets it wrong again?
>>1278062 Trust Sessions.
#1600
All posts from ID 7f3c77 :
>>1276770 , >>1276785 , >>1276788 , >>1276798 , >>1276809 , >>1276820
>>1276850 , >>1276865 , >>1276892 , >>1276916 , >>1276934 , >>1276965
>>1276993 , >>1277004 , >>1277027 , >>1277044 , >>1277140 , >>1277201
>>1277290 , >>1277308
>>1276904 Security guards sue Johnny Depp for unpaid wages, dangerous conditions
>>1276969 Black Male Approval For Trump Doubles In One Week
>>1277016 GEOTUS tweet: 'This isn't some game...', >>1277152 ? btw tweets...
>>1277108 TEXAS WINS VOTER I.D. FOR 2018 MID-TERMS, >>1276975 Arkansas, too
#1599
>>1276273 The Stage Is Set.
>>1276333 MUELLER CONNECTED TO PATENT TEAM...
Best Of Bread >>311157
Archive of Notables >>>/comms/225 (Batch 740~ present)
Anonymous 05/03/18 (Thu) 13:29:04 aee2d4 No. 1285137
Your continued help collecting Notable posts from each bread is greatly appreciated.
Help collect the gems that fall here, they are too ephemeral and precious to disappear in the chaff
ThanQ for all your assistance in collecting Notable posts.
The fruits of our labors should not be lost in the chaff of shills, shitposters & clowns.
EVERYTHING of value should be saved offline on multiple formats.
Please keep in mind, not all of these things are verified. In case you're unaware,
you should be critical towards everything you read on the internet.
NOTABLE SUBMISSION
To highlight a notable post, please format your post using the following below.
Call for the bakers attention (Red text is acceptable), link the post number in question
and write a short description on the same line as the linked post. Here's an example:
—————————————————————————
HEADS UP BAKER
or
Baker Notable
>>####### <Brief description of notable> (Without any brackets, quotes, etc.)
—————————————————————————
War Room
Tweet Storm: THE WAVE: hit them with everything you got! THINK MOAB BABY!
[1] #QAnon ON EVERY twat/reply/quote/post: This is how newbies & normies can find our twats'
[2] Q's request: KEEP DEMANDING #ReleaseTheTexts until #Unredacted release
[3] Throw in ANY EXTRA hashtags you want! Trending: #FakeNews, #MOAB #InternetBillOfRights #MAGA, #Treason WHATEVER YOU WANT!
[4] Meme and Meme and Meme some MOAR! Your memes are what's waking up the normies.
Hit them hard, from all angles, with every meme you have, RT others tweets. KEEP GOING!
Be your own tweet storm army.
Useful twat hints on war room info graphs
CURRENT EXPOSURE #QAnon: 40 – 70 MILLION EXPOSURES/DAY!
Best Times to TWEET:
10-11 AM EASTERN /// AFTER 6 PM EASTERN
Wanna (re)tweet FASSSSSSST? Use TWEETDECK.com on laptop or PC
Threads & Research Section
>>945070 Welcome! You've been expected...
>>1254488 QBOARD QUESTIONS (testing/ questions about how to post/italic /bold /etc)
>>1121104 Q QUESTIONS THREAD (post your Questions to Q here!)
>>1119245 TTDDTOT - Things That Don't Deserve Their Own Thread
>>143179 META
>>494745 QUEST FOR SEARCHABILITY
>>16785 Prayer
>>1215912 Letters of Gratitude II
>>311157 Notable Post Discussion
>>198093 Q memed/Newsweak/GreatAwakening
>>566073 Q Cards Collection
>>870846 The Letter Q
>>694579 Hispanic Qresearch
>>674740 Qanon auf Deutsch
.
>>93735 Side-by-Side Graphics
>>1115338 Advanced Graphics, Proofs, Maps, Side-by-Sides, Good Memes
>>169315 Notable Resignations Thread 1/2
>>1147812 Notable Resignations Thread 2/2
>>4352 RESOURCES LIBRARY
>>4356 Tools and Information
>>4852 Free Research Resources
>>4362 Planefag Tools
>>4369 Research Threads
>>1245678 Germanarchiveanon
>>1233401 All Executive Orders
>>1241760 Shill posters
>>1243929 JFK Files released
.
>>32223 Qs chess game
>>256741 Alien, UFO, Advanced/Hidden Technology, Antigravity, DUMBs, etc.
>>410413 Q Communications re:deltas
>>489697 Biblefags vs Unleavened Bread
>>618758 Merkel research thread
>>622132 Antarctica
>>693544 HUMAN SEX TRAFFICKING
>>810563 NXIVM info collection
>>885933 P=C
>>904395 The Plan
>>911014 Occult music and pop culture
>>918092 Great and Little Saint James
>>945864 EMINEM THREAD
>>957083 No Name Research Thread
>>1009786 DARPA/FB/Lifelog/5g/2020
>>1013812 Crazy Days and Nights Dig?
>>1049327 666 Fifth Avenue Research Thread III
>>1143658 Abramovic.
>>1272206 43 Confirmed Connections workspace
Anonymous 05/03/18 (Thu) 13:30:17 aee2d4 No. 1285144
Quick Access Tools
Q Graphics all in GMT
>>1185216 Q Graphics all in GMT #01-#05 >>>/comms/486 , >>>/comms/487 , >>>/comms/488
>>1185220 Q Graphics all in GMT #06-#10 >>>/comms/488 , >>>/comms/489 , >>>/comms/490
>>1185224 Q Graphics all in GMT #11-#15 >>>/comms/491 , >>>/comms/545 , >>>/comms/950
>>1185089 Q Graphics all in GMT #16 >>>/comms/951
>>1185101 Q Graphics all in GMT #17 >>>/comms/952
>>1185120 Q Graphics all in GMT #18 >>>/comms/953
>>1248765 Q Graphics all in GMT #19 >>>/comms/975
Q Graphics all in EST
>>1148124 Qmap_graphic_2018-04-21_2018-04-22)_Earth Day_.jpg >>>/comms/968
>>1147122 Qmap_graphic_2018-04-17_2018-04-21_They think they are clever).jpg >>>/comms/967
>>1147113 Qmap_graphic_2018-04-10_2018-04-16_TheWHERE-TheWHY).jpg >>>/comms/966
>>1147103 Qmap_graphic_2018-04-07_2018-04-09_Read carefully).jpg >>>/comms/965
>>1147098 Qmap_graphic_2018-04-03_2018-04-07_Open the door.jpg >>>/comms/964
>>1147092 Qmap_graphic_2018-03-10_2018-04-03_Safe.jpg >>>/comms/963
>>1147087 Qmap_graphic_2018-03-06_2018-03-10_More coming.jpg >>>/comms/962
>>1147080 Qmap_graphic_2018-02-23_2018-03-06_Eyes in the SKY.jpg >>>/comms/961
>>1147072 Qmap_graphic_2018-02-15_2018-02-22_DISTRACTION.jpg >>>/comms/960
>>1147063 Qmap_graphic_2018-02-07_2018-02-14_PAY THE PRICE.jpg >>>/comms/959
>>1147057 Qmap_graphic_2018-01-31_2018-02-07_Think intel.jpg
>>1147051 Qmap_graphic_2018-01-26_2018-01-31_FREEDOM DAY_.jpg >>>/comms/958
>>1147032 Qmap_graphic_2018-01-13_2018-02-05]].jpg
>>1147018 Qmap_graphic_2017-10-28_2017-11-20]].jpg >>>/comms/957
>>1147010 Qmap_graphic_2017-10-29_2017-11-09]](lastconfirmed).png >>>/comms/956
Advanced Graphics
>>1115338 Advanced Graphics, Proofs, Maps, Side-by-Sides, Good Memes
Resources Library
* Spreadsheet: docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/
* Searchable, interactive archive with user-explanations: qanon.pub (Backup: qntmpkts.keybase.pub & qanonmap.bitbucket.io)
* QMap PDF (Version >8.14.0 [updated 4/24]) Thread: >>122807
* Q Raw Text Dump: pastebin.com/3YwyKxJE
* Expanded Q Text Drops: pastebin.com/dfWVpBbY
* Updated Q archives: qarchives.ml | masterarchivist.github.io/qarchives/
* QMap zip: enigma-q.com/qmap.zip
* Qcode guide to abbreviations: pastebin.com/UhK5tkgb
* Deleted Trump Tweets: https:// factba.se/topic/deleted-tweets
* POTUS-tweet archive: trumptwitterarchive.com
* Merge QT - Awesome archive of Q Posts and POTUS Tweets in Chronological order: https:// anonsw.github.io/qtmerge/
* All My Tweets: Archive/Scan any Twatter account in text form. https:// www.allmytweets.net/
* Memo & OIG Report Links: 8ch.net/qresearch/res/426641.html#427188
* Pavuk Systems Q Database: https:// www.pavuk.com;user:pass = qanon:qanon
* Independent Q archive resource: irc.qclearancearchive.net > browsable versions of /thegreatawakening/ from before the purge >>1176816 http:// irc.qclearancearchive.net/02.%20QMaps/Q%27s%20posts%20-%20CBTS%20-%208.14.0.pdf
* Full JSON Q archive: qanon.news/Archives (~135MB/~817MB Unzipped) [Updated: 4/20/2018]
* Stock Movement Scraper: http:// qest.us (for seeing LARGE movements of $)
* Redpill Flag / Printable Q Cards with QR Link >>851957
* https:// commandandcontrol.center/ aggregation of twitter feeds, Qanon.pub, meme making/archiving/research tools.
* archive.is / https:// web.archive.org
* LEGAL NEWS: www.justice.gov/usao/pressreleases
* WebAlert app can be used to create alerts for Qanon.pub (vetted by >>968129 )
Research Section Backup >>>/comms/220
Backup Q Map/Graphic Set >>>/comms/283
Q Research Graphics Library
Nearly 17,000 memes and infographs.
https:// mega.nz/#F!XtNhURSb!1Mdrvt-Y_onBw5VlFDRdCQ
Memes: Stockpiles
Memes20 >>1232995 , 19 >>1144040 , 18 >>1027465
Meme Templates >>113884
Meme Generator kek.gg/draw/
ARCHIVE
https:// docs.google.com/spreadsheets/d/1M2AzhZKh2PjL7L7GVPN42Em0hZXKWMdhGnj59ZQ3YcQ/
Learn to Bake! For God & Country!
New Bakers Please Go To Cooking Class >>>/comms/154
Bakers Manual: >>1010064 / or https:// pastebin.com/aY5LyDPY
Anonymous 05/03/18 (Thu) 13:31:27 aee2d4 No. 1285150
DOUGH FOR #1612
https:// pastebin.com/QskdeMZv
Anonymous 05/03/18 (Thu) 13:34:53 e707a8 No. 1285181
Driving is a privilege BUT Traveling is a RIGHT (freedom)(liberty). There is NO difference other than legaleze (lawyer speak). NEVER ADMIT TO DRIVING!!!! ALWAYS ADMIT TO TRAVELING.
We have been lied to!
Drivers licenses are NOT needed
Anonymous 05/03/18 (Thu) 13:36:12 2e6a01 No. 1285192
Sorry I was away while you baked this bread
BAKER NOTABLE REQUEST FOR #1610
>>1284553 (You) >>1284583 >>1284608 QAnon truck image pallet size calculations
BAKER NOTABLE REQUEST FOR #1610
Anonymous 05/03/18 (Thu) 13:38:35 6d92f7 No. 1285210
Why would apple send a load with only three pallets. That makes no sense when they could of loaded up the truck.
How much money can three pallets hold?
Anonymous 05/03/18 (Thu) 13:39:24 995176 No. 1285213
YouTube embed. Click thumbnail to play. Today's Google doodle 360. "back to the moon". Consider the original, and nasa just canceled moon expedition. Water event. Satan even makes an appearance.
Anonymous 05/03/18 (Thu) 13:39:32 37814b No. 1285214
>>1285204
Well, let's see if this is the baker!
Anonymous 05/03/18 (Thu) 13:39:43 7f72b6 No. 1285215
>>1285210
Stop assuming it's money
Anonymous 05/03/18 (Thu) 13:39:44 c1737d No. 1285216
>>1285210
Eipstein insland kiods?????
Can we fight 4 them?
Anonymous 05/03/18 (Thu) 13:39:54 aee2d4 No. 1285217
>>1285192
Already added. It'll be in next bread.
Anonymous 05/03/18 (Thu) 13:40:14 7f72b6 No. 1285218
>>1285212
T DOES NOT = TRUMP
Anonymous 05/03/18 (Thu) 13:40:26 6d92f7 No. 1285219
https:// greenwaypsllc.com/how-much-does-a-pallet-hold/
Anonymous 05/03/18 (Thu) 13:40:34 a5c89c No. 1285220
Don't be afraid to send your sons and daughters to die for your (((greatest ally))) America.
They would do the (((same))) for you…wouldn't they?
Anonymous 05/03/18 (Thu) 13:40:37 7c504d No. 1285221
>>1285210
100 million each
Anonymous 05/03/18 (Thu) 13:40:41 d77b07 No. 1285222
>>1285181
pic related
"operating a motor vehicle" You can walk anywhere you want. Try that in court and tell us how it goes ;)
Anonymous 05/03/18 (Thu) 13:40:42 deb21e No. 1285223
So my take on Guiliani last night is basically Trump's using the money to keep things focused on Cohen to drag him as far as possible thru the mud? Looks like it was Cohen that slept with Daniels and both Trump and Daniels have his balls in a vise, because (Just my theory) Cohen tried to extort Trump, so Trump played Cohen like a fool and trapped Daniels in their own lies to torture them both. Soon to be unraveled.
Anonymous 05/03/18 (Thu) 13:40:45 0824eb No. 1285224
>>1285210
How do you know the truck wasn't unloaded and the pic was taken with what was left for the next destination? I worked at UPS as a late teen/early 20's, you'd be surprised how many 53 foot semi's run through a hub with only a third of the trailer filled. Not as uncommon as some might think.
Anonymous 05/03/18 (Thu) 13:40:52 d23c39 No. 1285225
>>1285096 (last bread)
This is Def the reason for Q post.
Along with my prior post. Xiaomi!!!!!!
Anonymous 05/03/18 (Thu) 13:41:02 0a78ab No. 1285226
>>1285216
Ya kids packed and shrink wrapped for sure
Anonymous 05/03/18 (Thu) 13:41:02 c0d648 No. 1285227
You realize Trump literally tweeted the court case in a nutshell.
1. He paid that slag 130k in an NDA out of his pocket(absolving him of wrongdoing).
2. She also signed an agreement stating she did not have a realtionship with him.
3. She and her lawyer broke the NDA countless times
4. She and her lawyer also lied and broke the agreement stating she didn't have a relationship.
In other words that slag and her ambulance chaser lawyer are so stupid it's insulting to the term stupid. They are liable for massive damages……….
Anonymous 05/03/18 (Thu) 13:41:23 eb0bec No. 1285228
>>1285215
perhaps it's frozen penguin pineal glands
(like the shipment as referenced in WL cablegate drop)
Anonymous 05/03/18 (Thu) 13:42:00 64a72b No. 1285229
I was able to extract the following snip of data from this image. Interesting date, so not a recent image.
===
IHDR
aiCCPkCGColorSpaceDisplayP3
OGbC
iTXtXML:com.adobe.xmp
<x:xmpmeta xmlns:x="adobe:ns:meta/" x:xmptk="XMP Core 5.4.0">
<rdf:RDF xmlns:rdf="http:// www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about=""
xmlns:photoshop="http:// ns.adobe.com/photoshop/1.0/"
xmlns:exif="http:// ns.adobe.com/exif/1.0/">
<photoshop:DateCreated>2018-05-02T19:51:34</photoshop:DateCreated>
<exif:UserComment>Screenshot</exif:UserComment>
</rdf:Description>
</rdf:RDF>
</x:xmpmeta>
IDATx
==
Anonymous 05/03/18 (Thu) 13:42:16 7b42bc No. 1285230
Thanks, Baker! The heel is the best part.
Anonymous 05/03/18 (Thu) 13:42:20 be2352 No. 1285231
Anons, latest shill tactic - morality shills.
Sliding the bread about Trump/Stormy/Melania issues. Propose to engage shields and filter them back to the depths from which they issue.
Anonymous 05/03/18 (Thu) 13:42:23 33e74d No. 1285232
>>1285222
sheep.
>>1285181 is right.
Driving has a specific meaning in law.
Just cause the 'court' says something does not make it so. You're not really interested in fixing this nation when you take positions like this.
Anonymous 05/03/18 (Thu) 13:42:28 7f72b6 No. 1285233
>>1285228
BWAHAHAHA….Good one!
KEK
Anonymous 05/03/18 (Thu) 13:42:45 0824eb No. 1285235
>>1285229
SMH. Bogus date, everyone will look past it.
Anonymous 05/03/18 (Thu) 13:42:55 ca3cca No. 1285236
interesting that one of the pallets is crushed on top - so not full. also significant that the container itself is not full. apple cooking the books?
Anonymous 05/03/18 (Thu) 13:43:15 6d92f7 No. 1285237
>>1285224
That's ups.
You ship what is sent.
Where talking apple with probably millions ready to buy.
Those pallets would hold what a few thousand I phones.
But those pallets could hold many 100 dollar bills.
Anonymous 05/03/18 (Thu) 13:43:30 b06664 No. 1285238
Could this be the guy she is referring to?
Anonymous 05/03/18 (Thu) 13:43:41 91156b No. 1285239
>>1284975 (Last bread)
Steganography maybe.
Anonymous 05/03/18 (Thu) 13:43:55 652f05 No. 1285240
Q
Need me?
You know my skills.
Offering.
You know my comms.
No is ok too.
J
Anonymous 05/03/18 (Thu) 13:44:00 7f2232 No. 1285241
>>1284906
Jet Blue and Apple
https:// skift.com/2013/12/04/jetblue-takes-a-shortcut-to-add-apple-passbook-capabilities/
JetBlue is one of the first airlines to go live with Apple Passbook using the SITA API. Malaysia Airlines is also using it as are other airlines that SITA declined to identify.
(Interesting mention of Malaysia Airlines while declining mention of others)
Side note Don't remember hearing this
http:// abc11.com/travel/jetblue-flight-from-boston-makes-emergency-landing-at-rdu-/3266371/
https:// www.theatlantic.com/technology/archive/2014/03/todays-malaysia-airlines-370-news-what-it-means-that-the-plane-apparently-kept-flying/284414/
Posted for description of a/c comms.If speculation was correct that MH370 was compd then compd again, a backup hack to the qrs11 in a cellphone just in case...
Anonymous 05/03/18 (Thu) 13:44:04 3cc9e0 No. 1285242
https://
www.telesurtv.net/english/news/US-Troops-Enters-Argentina-for-Military-Exercises-Without-Congressional-Approval-20180502-0005.html
Anonymous 05/03/18 (Thu) 13:44:32 7b42bc No. 1285243
>>1285236
The magnetic force in this post is strong.
Anonymous 05/03/18 (Thu) 13:44:33 35a7b5 No. 1285244
>>1285236
Pallet is not crushed, it has a blanket over it. Further Enhance image, becomes clear. Beggs the question, was the blanket covering all? Pulled back for the Photo?
Anonymous 05/03/18 (Thu) 13:44:39 074f90 No. 1285245
>>1285223
>>1285200
No one here is saying TRUMP cheated on his wife. The payment Trump made to Cohen, could just have been for expenses … which is what has been said all along and of which Trump did not know the details of. Hey boss I have about 130,000 worth of expenses this month I am going to need you reimburse me for that I need to take care of this month… is all Cohen has to say.
Anonymous 05/03/18 (Thu) 13:44:39 521c54 No. 1285246
Anonymous 05/03/18 (Thu) 13:44:42 7f72b6 No. 1285248
>>1285231
add to the list:
c130 was decoy/not real/no lives/
c130 contained the 3 pallets from Q pic
Anonymous 05/03/18 (Thu) 13:44:55 b0a429 No. 1285249
>>1285237
Route truck making multiple stops from a distribution center. They start full, and end empty.
Anonymous 05/03/18 (Thu) 13:45:07 d772c5 No. 1285250
It would not be absurd that Drudge is playing a role.
Anonymous 05/03/18 (Thu) 13:45:13 64a72b No. 1285251
>>1285229
However, look what w3.org is 'About'
ABOUT W3C
The World Wide Web Consortium (W3C) is an international community where Member organizations, a full-time staff, and the public work together to develop Web standards.
Led by Web inventor and Director Tim Berners-Lee and CEO Jeffrey Jaffe, W3C's mission is to lead the Web to its full potential. Contact W3C for more information.
—-
Combine that with Apple + JetBlue = Net Neutrality and Clowns Wi-Fi via Satellites
https:// appleinsider.com/articles/17/01/11/jetblue-completes-fleet-wide-rollout-of-high-speed-fly-fi
Anonymous 05/03/18 (Thu) 13:45:39 d77b07 No. 1285253
>>1285232
yes, "driving" implies a commercial pursuit, which is why they call it "operating a motor vehicle"
Lawfag (me). This has been attempted about 1000 times and has worked 0 times. You can appeal and appeal, but even at the federal SC you LOSE. We need think anons here, not retard dufus anons. File you with flat-earthers
Anonymous 05/03/18 (Thu) 13:45:54 56a8a7 No. 1285254
Just woke up so not sure if it was posted overnight, but the picture of the Apple store had to be taken from this walkway because its obviously above ground level and from that position, makes perfect sense. That walkway runs into a building on one end, and on the other end runs only to a few piers.
Anonymous 05/03/18 (Thu) 13:45:57 d921a4 No. 1285255
>>1285141 (last)
>Thanks, not Think (but think too)
>>1284656 >“ambitious television news series” JV w/
<Red Arrow subsid. "Left/Right Tv" +
>NY Times Co. keynote interview :: CEO Mark Thompson (pictured)
>http:// realscreen.com/2017/12/01/wcsfp-17-nyts-mark-thompson-on-politics-platforms-and-proper-journalism/
During the keynote interview, the former chief executive of Channel 4 and director-general of the BBC tackled questions on Trump (who, for the record, has a “perfectly normal handshake”),
the impact of the growing FAANG empire on the global mainstream media (“The fate of all of us is likely to be determined by the major digital platforms,” he maintained),
attacks on the free press from both ends of the political spectrum,
Its digital product has seen subscriptions increase, and Thompson is looking at a move to TV for the brand .
Anonymous 05/03/18 (Thu) 13:46:23 3c93fe No. 1285256
Here's a CBS news report on the building of the new Apple HQ. It is strange they talk about pizza in it. Are they messaging to customers?
https:// www.cbsnews.com/video/apples-massive-glitzy-new-headquarters/
Anonymous 05/03/18 (Thu) 13:46:43 777edd No. 1285257
>>1285245
Totally agree. It was not stated for sure that POTUS did anything with Stormy. Look at his tweets this morning. Pretty clear, I think.
Anonymous 05/03/18 (Thu) 13:47:21 328187 No. 1285258
TIM COCK IS A FAGGOT WITH AIDS THAT MAKES SHITTY SOFTWARE
Anonymous 05/03/18 (Thu) 13:47:22 9668b6 No. 1285259
>>1285212
screaming + no markers = man down.
b/c MOS (= mobile operating system) SEC (security) is bunk.
f.h.p.p needs to learn how to OC it's own MOS_SEC.
tim, are you woke?
you get phones from foxconn.
you have more than you know.
do you need help making new chips?
we'll fix taxes a little to bring manufacturing in house.
Anonymous 05/03/18 (Thu) 13:47:25 d772c5 No. 1285260
>>1285229
That's not how the w3 header works , non-tech fag.
Anonymous 05/03/18 (Thu) 13:47:27 607f0b No. 1285261
Anonymous 05/03/18 (Thu) 13:47:43 ee7c64 No. 1285262
>>1285238
A related side note, John Kerry ended up marrying Theresa Heinz after the death of John Heinz…..
Anonymous 05/03/18 (Thu) 13:48:01 5d5fc3 No. 1285263
Anonymous 05/03/18 (Thu) 13:48:14 b0a429 No. 1285264
>>1285262
I aint sayin he's a gold digger…
Anonymous 05/03/18 (Thu) 13:48:17 7c504d No. 1285265
>>1285240
meet me at your mamas house in 2 hrs…wait there until further notified…do not pass go…do not collect $200
Anonymous 05/03/18 (Thu) 13:48:29 b50eb2 No. 1285266
>>1285236
Ok guys, look.
Its NOT a blaket and its NOT crushed.
You r seeing the refer unit.
And the pallets have to be shorter to fit under the refer unit.
Anonymous 05/03/18 (Thu) 13:48:33 33e74d No. 1285267
>>1285253
I never said it would work. It is exactly the same thing as trying to convict the queen of a crime in her court. it won't ever work. The court does not follow the written law. I agree it won't work. It's like trying to start a gasoline engine when the there isn't any piston in it. You have to shit can the entire thing and replace it with something that is not corrupt. The court is a huge part of the problem.
UCC
Commerce Clause corruption and meaning stretching.
It's all rotten.
Anonymous 05/03/18 (Thu) 13:48:39 4fdadb No. 1285269
Anonymous 05/03/18 (Thu) 13:48:50 4afc22 No. 1285270
Just an FYI if someone wants to dig further
ZTE can no longer use Qualcomm chips
Leads me to believe they were the ones who reverse engineered a backdoor into the phone chipsets for the Chinese Government. This would also explain the merger being halted between Qualcomm and Broadcom.
Anonymous 05/03/18 (Thu) 13:48:53 7b42bc No. 1285271
Anonymous 05/03/18 (Thu) 13:49:01 deb21e No. 1285273
>>1285245
>No one here is saying TRUMP cheated on his wife
Right. I'm not either.
>could just have been for expenses
Possibly, but why drag out something for simple expenditures?
Trump has a plan in place for Cohen and Daniels. Trump Curse, after all.
Anonymous 05/03/18 (Thu) 13:49:02 3aa876 No. 1285274
>>1285264
But he ain't messing with no broke?
Anonymous 05/03/18 (Thu) 13:49:15 70122c No. 1285275
>>1285223
Laser pointer for rabid kitties
>works every time
Anonymous 05/03/18 (Thu) 13:49:27 e707a8 No. 1285276
CASE #1: “The use of the highway for the purpose of travel and transportation is not a mere privilege, but a common fundamental right of which the public and individuals cannot rightfully be deprived.” Chicago Motor Coach v. Chicago, 169 NE 221.
Anonymous 05/03/18 (Thu) 13:49:37 d921a4 No. 1285278
>>1285134
Baker, please see from last bread. Thx.
>>1284492
BAKER ———– BREAD EDIT NEEDED
>>1284186 Sir Jonathan Paul Ive,Chief design officer (CDO) of Apple Inc. DIGz
The current link is incorrect to this post.
Anonymous 05/03/18 (Thu) 13:49:40 074f90 No. 1285280
What is Rosenstein and Mueller doing. Trying to bankrupt anyone who knows President Trump or worked for him. How many of these guys has Mueller and Rosenstein been doing this too over the past year and half?
http:// dailycaller.com/2018/05/02/michael-caputo-senate-intelligence/
‘God Damn You To Hell’: Ex-Trump Aide Blows Up During Senate Interview
“Today, I can’t possibly pay the attendant legal costs and live near my aging father, raising my kids where I grew up,” Caputo said during his three-hour interview. “Your investigation and others into the allegations of Trump campaign collusion with Russia are costing my family a great deal of money — more than $125,000 — and making a visceral impact on my children.”
“Forget about all the death threats against my family. I want to know who cost us so much money, who crushed our kids, who forced us out of our home, all because you lost an election,” he added. “I want to know because God damn you to hell.”
Anonymous 05/03/18 (Thu) 13:49:42 b06664 No. 1285281
Anonymous 05/03/18 (Thu) 13:49:50 e707a8 No. 1285282
CASE #2: “The right of the citizen to travel upon the public highways and to transport his property thereon, either by carriage or by automobile, is not a mere privilege which a city may prohibit or permit at will, but a common law right which he has under the right to life, liberty, and the pursuit of happiness.” Thompson v. Smith, 154 SE 579.
Anonymous 05/03/18 (Thu) 13:50:04 e707a8 No. 1285283
CASE #3: “The right to travel is a part of the liberty of which the citizen cannot be deprived without due process of law under the Fifth Amendment.” Kent v. Dulles, 357 US 116, 125.
Anonymous 05/03/18 (Thu) 13:50:16 e707a8 No. 1285284
CASE #4: “The right to travel is a well-established common right that does not owe its existence to the federal government. It is recognized by the courts as a natural right.” Schactman v. Dulles 96 App DC 287, 225 F2d 938, at 941.
Anonymous 05/03/18 (Thu) 13:50:21 e86504 No. 1285285
ANYTHING ABOUT STORMY CASE is a shill slide tactic
Do not engage
Anonymous 05/03/18 (Thu) 13:50:49 6d92f7 No. 1285287
Apple would ship to distribution center with a full tractor trailer and than ups would ship on ups truck.
This is a tractor trailer.
It would not only have three pallets.
Unless the picture was taken during unload stage. And if that's the case where's the spotter/pallet jack guy. He's always waiting for extended boom or fork lift to come back.
Anonymous 05/03/18 (Thu) 13:51:10 33e74d No. 1285289
>>1285282
which doesn't apply to US Citizens cause US Citizens are collateral to the US Corp for its debt.
The court knows this but wont tell you. Common law does not apply in a UCC corporate court.
Anonymous 05/03/18 (Thu) 13:51:12 e707a8 No. 1285290
That's called sauce! look shit up shill. fuck off
Anonymous 05/03/18 (Thu) 13:51:18 1fc88c No. 1285291
>>1284475
Posing as 'muslim'.
Just like the Mossad false flaggers alway do…
Anonymous 05/03/18 (Thu) 13:51:22 ee7c64 No. 1285292
>>1285241
Is this "the beginning of the (((chip))) . The phone that knows the user and is 100% accurate as far as identification purposes? Would eliminate the need for passports, then drivers license, everything.
The Mark of the Beast technology…..
Anonymous 05/03/18 (Thu) 13:51:33 2bb43d No. 1285293
Former highest German State Attorney (Generalbundesanwalt) Harald Range - who did not investigate the German Pedogate known as "Sachsensumpf", downsized the "investigation" into NSA spying in Germany and mislead the complete hoax of the official story regarding the "NSU" terrorist cell (who is basically a story told by the secret agencies to subsummize several murder and crime done by state or allied forces under the cover of shot do death neonazis) breaks down dead in a cafe.
https:// www.tagesschau.de/inland/range-nachruf-101.html
Anonymous 05/03/18 (Thu) 13:51:39 18ea88 No. 1285294
It is the insides of a smooth walled refrigerator truck. The packages on the top are arranged in order to not block the cooling fans. Its meat folks….human meat.
Anonymous 05/03/18 (Thu) 13:51:44 6f46e1 No. 1285295
>>1280616
>>1280036
Trump’s China ‘hawks’ Robert LIGHThizer, Peter Navarro, and Wilbur Ross on that flight?
Fags state Q was not on the plane but could someone on this trade team be on the Q team?
https:// www.macrumors.com/2012/07/04/apples-retail-push-into-china-still-limited-but-ramping-up/
http:// www.businessinsider.com/trump-trade-team-china-hawks-2017-1
Anonymous 05/03/18 (Thu) 13:52:01 4c71c2 No. 1285296
>>1285241
we need a meme showing passengers flying jet blue forced to watch apple tv with CNN playing on a loop.
Anonymous 05/03/18 (Thu) 13:52:05 b97d2d No. 1285297
Roll? Should be spelled ROLE in this instance
Why the typo?
Anonymous 05/03/18 (Thu) 13:52:30 b215f3 No. 1285298
>>1285210
maybe they were unloading
and this is a message that we intercepted
their vile cargo
Anonymous 05/03/18 (Thu) 13:52:44 27e345 No. 1285299
>>1285178
Its a mind virus.
Anonymous 05/03/18 (Thu) 13:52:48 e86504 No. 1285300
>>1285297
Use typos to indicate key
Key is 'L'
What is code?
Anonymous 05/03/18 (Thu) 13:52:53 4afc22 No. 1285301
Anons, why is the container or pallets so important?
Kinda seems like a useless venture or a shill tactic to keep the board distracted.
Anonymous 05/03/18 (Thu) 13:53:06 33e74d No. 1285303
>>1285298
LTL trucking.
Happens every day.
Anonymous 05/03/18 (Thu) 13:53:08 4fdadb No. 1285304
Anonymous 05/03/18 (Thu) 13:53:13 521c54 No. 1285305
>>1285229
HDR as in High Dynamic Range?
Anonymous 05/03/18 (Thu) 13:53:22 d77b07 No. 1285306
>>1285276
>>1285282
>>1285283
>>1285284
citing 1800's court cases proves nothing, at the same time a murder could be justified by saying "he needed killing!" Someone might get arrested and jailed over your retard comments anon, so stop and lurk moar
Anonymous 05/03/18 (Thu) 13:53:23 ff3c93 No. 1285307
Not sure if you Anons have seen this….I'm still eating breads to catch up.
This is floating around on Twitter…looks like a messsage between Stormy D & someone where she is denying she slept with Trump.
Like I said, it is floating on Twitter so it might be fake or it might not be.
Anonymous 05/03/18 (Thu) 13:53:37 074f90 No. 1285308
>>1285280
Meant to say Senate Select Committee. Not discuss RR and Mueller…But heck you can blame them too. We wouldn't have this committee if they had been doing their job correctly.
Anonymous 05/03/18 (Thu) 13:53:41 f52b40 No. 1285309
Quote of the day:
"Is Q an Ai? I heard that Cicada is an internet company…"
Anonymous 05/03/18 (Thu) 13:53:47 607f0b No. 1285310
Any chance that would be mossad docs taken from Iran? Just throwing it out there to consider…
$130,000 seems to be getting thrown around a lot lately also…
Anonymous 05/03/18 (Thu) 13:53:50 e86504 No. 1285311
>>1285301
Clowns downed C-130 to destroy something
Q posts picture of pallets
Clowns missed
Package secured
Anonymous 05/03/18 (Thu) 13:53:59 f039c1 No. 1285312
"Watch The Water" https ://www.militarytimes.com/news/your-military/2018/04/26/dod-126-bases-report-water-contaminants-harmful-to-infant-development-tied-to-cancers/
https ://www.military.com/daily-news/2017/04/25/nearly-400-military-bases-must-be-tested-water-contamination.html
Anonymous 05/03/18 (Thu) 13:54:11 6d92f7 No. 1285313
>>1285298
If their unloading where the driver with his pallet jack.
He wouldn't unload. He would wait with pallets for fork lift to return.
Anonymous 05/03/18 (Thu) 13:54:26 33e74d No. 1285314
>>1285306
Sheep.
Must live in the UK and think that fella that flipped of the traffic cam deserved the state pitching him in the clink for 8 months is a great thing.
Anonymous 05/03/18 (Thu) 13:54:33 c0f04a No. 1285315
>>1284666
>>1284708
New Zealanders are good, hard-working people with a generous heart, and willing to hep those in need.
But, here she comes again, and she wants more of your money.
Read The Clinton Foundation and Haiti.
HRC will put on a lot of makeup and a big smile to hide what is really in her heart, which many claims she does not have, and it's not for good for mankind.
Anonymous 05/03/18 (Thu) 13:54:38 b06664 No. 1285316
was this pointed out yet?
Anonymous 05/03/18 (Thu) 13:54:48 4afc22 No. 1285317
>>1285270
The flaws affect Qualcomm chip software drivers installed at the point of manufacture, meaning updates must be pushed from the hardware company to phone vendors before it can flow to users.
Anonymous 05/03/18 (Thu) 13:55:14 19f1ff No. 1285318
>>1284590 LB
HAHA always a shill if we just admit that it is really confusing ..I mean holy shit how is it NOT confusing? By definition they are cryptic messages that are only a small % of hints and some are literally disinfo that we don't know which ones are….come on fag play chess that makes it clear instantly
Anonymous 05/03/18 (Thu) 13:55:35 22c7c0 No. 1285319
Ooops!
Corsi gets it wrong again.
Anonymous 05/03/18 (Thu) 13:55:41 fc4ee7 No. 1285320
>>1285212
Super Sensory Perception
Anonymous 05/03/18 (Thu) 13:55:54 cfd191 No. 1285321
>>1285276
>cannot rightfully be deprived…
…without due process
Anonymous 05/03/18 (Thu) 13:56:04 35a7b5 No. 1285323
>>1285312
you are on to something here Brother. RE LOOK at past breads: https:// 8ch.net/qresearch/res/894238.html#894401
Anonymous 05/03/18 (Thu) 13:56:17 731c0b No. 1285324
>>1285215
stop əˈkyooziNG anons of assuming
(you) are assuming others of assuming
Anonymous 05/03/18 (Thu) 13:56:19 ee7c64 No. 1285325
>>1285266
Those pallets would not be able to lift that much cash…..Too Heavy. Also, other than a cool reference to cold hard cash, why would they ship cash in a refer? Let alone 3 pallets in a trailer that holds 18 pallets.
Anonymous 05/03/18 (Thu) 13:56:20 1091ad No. 1285326
>>1285297
3:46 AM - 3 May 2018
> 8 min delta
3:54 AM - 3 May 2018
> 6 min delta
4:00 AM - 3 May 2018
ROLL vs. Role mispelling…
Possible getting ready to roll (86) this mf
Anonymous 05/03/18 (Thu) 13:56:35 44d628 No. 1285328
>>1280772
Cambridge Analytical servers?
The company went belly up yesterday.
Anonymous 05/03/18 (Thu) 13:56:37 eb0bec No. 1285330
Anonymous 05/03/18 (Thu) 13:56:52 7c504d No. 1285331
>>1285258
technology is now truly our enemy…you cant escape it
Anonymous 05/03/18 (Thu) 13:56:52 45364b No. 1285332
>>1285266
It doesn't look like cash to me. Those are individual cases stacked and wrapped in plastic sheets…taped.
I think this may have to do with computer chips, maybe for planes but because it's going to china where the slave like phone factories are. Maybe they implemented a change.
Anonymous 05/03/18 (Thu) 13:57:11 1091ad No. 1285333
>>1285326
Meaning
According to Merriam-Webster's Dictionary, "86" is a slang term that is used in the American popular culture as a transitive verb to mean throw out or get rid of, particularly in the food service industry as a term to describe an item no longer available on the menu, or to refuse service to a customer.[1] The Merriam Webster dictionary suggests the term may be associated with the word "nix" ("no" or a more general prohibition).[1]
Anonymous 05/03/18 (Thu) 13:57:22 4afc22 No. 1285334
>>1285310
Dump the container and pallets and I think you are on to something.
$130,000 is an interesting number to come up multiple times.
Anonymous 05/03/18 (Thu) 13:57:36 78be58 No. 1285335
>>1285312
Veolia French water company
Anonymous 05/03/18 (Thu) 13:57:41 aee2d4 No. 1285336
Anonymous 05/03/18 (Thu) 13:57:47 89e6d8 No. 1285337
Those are cases of MAGA hats
Anonymous 05/03/18 (Thu) 13:57:47 756d30 No. 1285338
>>1285297
to roll someone is to rob or to scam them
Anonymous 05/03/18 (Thu) 13:57:50 1b8f68 No. 1285339
Capped this from last night for anybody who wants it.
Anonymous 05/03/18 (Thu) 13:57:55 777edd No. 1285340
>>1285319
What an asshole he is. Shows he really isn't trying to help Flynn, imho.
Anonymous 05/03/18 (Thu) 13:58:03 19f1ff No. 1285341
>>1285319
His son really wrote that? Haha shit Corsi , and Ive been kinda backing him up a little but lately I gotta be honest is living up to the criticism eek
Anonymous 05/03/18 (Thu) 13:58:10 1319f4 No. 1285342
Would poisoning the militaries water be classified as an act of war?
Anonymous 05/03/18 (Thu) 13:58:12 eeed56 No. 1285343
>>1285257
Trump hired Emmet Flood for a reason. Is he getting ready Dem's attempt to impeach Trump? It seems to circle around that whore.
Anonymous 05/03/18 (Thu) 13:58:46 f72da3 No. 1285344
>>1284612 (pb)
Not sure if related but here's some interesting information if anyone wants to dig about Sandia in Bay Area and New Mexico RE Nuclear, underground circular structure:
A Brief History of Sandia National Laboratories and the
Department of Energy’s Office of Science:
Interplay between Science, Technology,and Mission
http:// prod.sandia.gov/techlib/access-control.cgi/2011/115462.pdf
—————————————————
ALSO, found this:
Organizations »
Q-DO
Weapon Stockpile Modernization
Ensuring tomorrow’s U.S. nuclear deterrent through stockpile life extensions, while maintaining and advancing knowledge and capabilities
The Weapon Stockpile Modernization (Q) Division provides the system engineering, program management, component technology development, and system and sub-system testing necessary to field modernizations authorized to extend the life of Los Alamos National Laboratory-designed weapons in the active United States nuclear stockpile
http:// www.lanl.gov/org/padwp/adw/weapon-stockpile-modernization/index.php
Anonymous 05/03/18 (Thu) 13:58:48 78be58 No. 1285345
>>1285297
role
as a role in a movie.
Anonymous 05/03/18 (Thu) 13:58:53 33e74d No. 1285346
>>1285318
Play chess, play football, box, play baseball, doesn't matter.
The question is, do you intend to win or lose the match?
You're chess strategy looks like you're throwing the game. On purpose? Do you know? Do they know? Does anyone care? Does anyone wear underwear?
Heh, fuck it. At some point the law of diminishing returns kicks in. Cloak and dagger shit can only be taken so far before it all becomes the joke that it is.
Dr Corsi 05/03/18 (Thu) 13:59:08 340b79 No. 1285347
>>1285319
Disregard Flynn Jr.
Make sure you donate. Patriots stick together.
Also, pick up my book "Killing the Deepstate."
Anonymous 05/03/18 (Thu) 13:59:16 d630b6 No. 1285348
>>1285294
Pizza ingredients?
Anonymous 05/03/18 (Thu) 13:59:37 be2352 No. 1285350
>>1285245
I was responding to a morality fag. I don't know if Trump cheated or not. Wouldn't be surprised, because of past history. But frankly, don't care. Not my business, it's between Melania and him (and God, if you want to go there).
What I do care about is whether Trump knowingly broke any laws in what his lawyer did on his behalf, and my opinion is he didn't.
The takeaway from Rudy should be that. He didn't break any laws, and he didn't use campaign or government money to pay off anyone. UNLIKE almost all the diddling senators and representatives, I might add, who diverted campaign funds or used the government coffers for the payoffs.
Anonymous 05/03/18 (Thu) 13:59:41 22c7c0 No. 1285351
Anonymous 05/03/18 (Thu) 13:59:58 e8955a No. 1285353
>>1285312
military base drinking water has been shit for decades, Lejeune has had ongoing problems forever. Why not poison the military that are being used as puppets asked the CFR as directed by Bilderberg!
Is qanon.pub anon lurking?
-Printed Crumbs
-Cut them out->sorted by timestamps[HH:MM:SS]->taped together
I am looking at big picture strings and if your sites can sort the same way and printable, future Patriots can print these big strings together and make their own offline map to share. Save time and tape. The hours put them qposts into catagories, you can pick out a theme among the cats once you sort all q posts this way ignoring the dates during sort
Anonymous 05/03/18 (Thu) 14:00:05 4fdadb No. 1285354
>>1285338
So "perhaps" Q team rolled or captured the contents of what was on those pallets.
Anonymous 05/03/18 (Thu) 14:00:06 b97d2d No. 1285355
>>1285319
Shareblue was sneakily turned into Shareblues to funnel $$ into the crooked one's pockets-similar MO & by design?
Spamfag was right about Corsi but just too damn repetitive
Anonymous 05/03/18 (Thu) 14:00:08 e707a8 No. 1285356
LICENSING LIBERTY
“No state shall convert a liberty into a license and charge a fee therefore.”(Murdock v. Pennsylvania, 319 U.S. 105)
“If the state converts a right (liberty) into a privilege, the citizen can ignore the license and fee and engage in the right (liberty) with impunity.”(Shuttlesworth v. City of Birmingham, Alabama, 373 U.S. 262)
Anonymous 05/03/18 (Thu) 14:00:12 45364b No. 1285357
>>1285297
roll of film? Roll the tape?
Roll….ing on the floor with laughter at this ridiculous play that is making the media chase their tails endlessly?
Anonymous 05/03/18 (Thu) 14:01:08 556a87 No. 1285359
https:// twitter.com/WhiteHouse/status/992040078770950145
The White House
Verified account @WhiteHouse
President Donald J. Trump proclaims May 3 as a National Day of Prayer
6:56 AM - 3 May 2018
Anonymous 05/03/18 (Thu) 14:01:18 89e6d8 No. 1285360
The pallets contain rolls of film - Hillary's sex video.
Anonymous 05/03/18 (Thu) 14:01:31 eeed56 No. 1285361
>>1285350
>between Melania and him (and God
Anonymous 05/03/18 (Thu) 14:01:31 b0a429 No. 1285362
>>1285313
Sitting in his cab or in the truckers lounge and out of the fucking way of the loading dock personnel. That's where the driver is.
Anonymous 05/03/18 (Thu) 14:01:31 70122c No. 1285363
With the photos Q was drawing a link between Apple corporate, retail in China and pallets that were photographed
Cook has been brought to heel.
Discovery could be
A) fake US currency -another way to devalue the US dollar as POTUS repeatedly accused China of doing ( after inauguration they would have been able to check the amount of cash in circulation vs how much legally printed and available). Offshoring money (panama papers and tax avoidance) is one way but flooding the market with illegally printed money (see RM 39 in NK) is another.
B) Fentanyl (or other drugs)
C) Uncomped phones for Black Hats to use for comms
D) Unmentionables re: human cargo
Whatever it is, they have disrupted another RAT LINE and leveraged Apple/Cook
Anonymous 05/03/18 (Thu) 14:01:33 4afc22 No. 1285364
What the fuck was Comey up to? Was he working for the MB or China? Selling hacks into our technology through the FBI?
https:// en.wikipedia.org/wiki/FBI%E2%80%93Apple_encryption_dispute
https:// oig.justice.gov/reports/2018/o20180413.pdf
Anonymous 05/03/18 (Thu) 14:01:35 45364b No. 1285365
Anonymous 05/03/18 (Thu) 14:01:37 e86504 No. 1285366
"Rolling" on someone can mean you snitched.
Typical slang in drug world when someone gets arrested.
"Did he roll?"
Anonymous 05/03/18 (Thu) 14:01:49 be2352 No. 1285367
>>1285250
Do tell. A role in what, anon?
Anonymous 05/03/18 (Thu) 14:02:33 1b8f68 No. 1285368
>>1285310
I think it was a shipment of adrenochrome for the vampires. They are growing weak and dying off slowly since their supply lines have been cut off. This shipment was going to bring them much needed energy but Q and team intercepted it so now the vampires are screwed.
Anonymous 05/03/18 (Thu) 14:02:38 7e7011 No. 1285369
>>1285229
That's when the specifications for the file format was created, not when the file itself was created. It's like if every jpg had the date 9/18/1998 inside because the JPEG format was standardized on that date.
Anonymous 05/03/18 (Thu) 14:03:08 45364b No. 1285370
>>1285366
yeah…could be someone "rolled over" or submitted
Anonymous 05/03/18 (Thu) 14:03:32 b97d2d No. 1285373
>>1285338
Yes that was the first one that popped into my semi-fried tired brain this morning. Keep the guessing going Anons, we'll get this soon it should be an easy peasy one
Anonymous 05/03/18 (Thu) 14:03:47 6d92f7 No. 1285375
>>1285362
Yeah except that never happens. They help bring the items from the front of their trucks to where you can pick them up with a piece of equipment.
Let me guess you didn't unload as many trucks as I have in the past month.
Anonymous 05/03/18 (Thu) 14:03:47 df0479 No. 1285376
>>1285328
Who wants got bet they've been destroyed and gone. Backups sitting in underground storage somewhere.
Anonymous 05/03/18 (Thu) 14:04:27 034d67 No. 1285377
>>1285359
>twitter.com/WhiteHouse/status/992040078770950145
However, President Barack Obama has chosen not to personally participate nor host events for the National Day of Prayer at the White House, which seems to be the origin of this widely circulated email. Although he has not participated as his predecessors did, he has written a proclamation for the day of prayer every year of his presidency, which are available on our website, www.nationaldayofprayer.org . In fact, every President since 1952 has written proclamations calling for a National Day of Prayer.
Anonymous 05/03/18 (Thu) 14:04:38 19f1ff No. 1285378
>>1285346
"you play to WIN THE GAME ..They were who thought they were,"….
Anonymous 05/03/18 (Thu) 14:04:39 4fdadb No. 1285379
>>1285368
You do realize how crazy you sound.
And hey at this point I may agree with you…
Anonymous 05/03/18 (Thu) 14:05:00 89e6d8 No. 1285380
We were expecting arrests and sex videos.
What did we get? BOOM BOOMs and photos from a cheap phone.
Trump, please fire this Q.
Anonymous 05/03/18 (Thu) 14:05:10 b50eb2 No. 1285381
>>1285363
This is second time someone posted a summary without linking a thread. Are we being fed?
Anonymous 05/03/18 (Thu) 14:05:31 6054bc No. 1285382
To my knowledge, Q hasn't mentioned James Comey very often. Comey could be white hat (flipped black hat who took a deal)
Anonymous 05/03/18 (Thu) 14:05:38 45364b No. 1285383
>>1285359
mmmm I mean I know it's projection but I would expect something like that to be declared when serious stuff is about to rock the country.
Anonymous 05/03/18 (Thu) 14:05:57 ae410e No. 1285384
>>1285348
>>1285294
>Its meat folks….human meat.
>Pizza ingredients?
Ahah! Flown in for the Apple cafeteria. Makes sense to me now.
Anonymous 05/03/18 (Thu) 14:05:59 0b79ab No. 1285386
>>1285297
Higgins had stood by Trump during the Khizr Khan attacks. And he had written a memo warning that “the left is aligned with Islamist organizations at local, national, and international levels” and that “they operate in social media, television, the 24-hour news cycle in all media and are entrenched at the upper levels of the bureaucracies.”
Like Harvey and Ezra Watnick-Cohen, Higgins had warned of an enemy within. And paid the price.
McMaster’s cronies had allegedly used the NSC’s email system to track down the source of the memo. The left and its useful idiots were indeed entrenched at the upper level of the bureaucracy.
Higgins was fired.
Like Harvey and Watnick-Cohen, Higgins had also become too dangerous to the Obama holdovers. Harvey had assembled a list of names and a plan to dismantle the Iranian nuclear deal. Watnick-Cohen had dug into the Obama surveillance of Trump officials. And Higgins had sought to declassify Presidential Study Directive 11. PSD-11 was the secret blueprint of Obama’s support for the Muslim Brotherhood.
Pete Hoekstra, the former Chairman of the House Intelligence Committee, linked PSD-11 to the rise of ISIS and called for its declassification.
https:// counterjihadreport.com/tag/psd-11/
Obama rolls dice on foreign policy in secretive presidential directive
by Pete Hoekstra
| October 03, 2016 12:04 AM
https:// www.washingtonexaminer.com/obama-rolls-dice-on-foreign-policy-in-secretive-presidential-directive/article/2603354
The Investigative Project on Terrorism
_ _ _ _ _ _ _ _ _ _ _ _ _ _ _
STATEMENT OF
PETER HOEKSTRA
SHILLMAN SENIOR FELLOW
INVESTIGATIVE PROJECT ON TERRORISM
An official in the Obama White House indicated at the time, “It’s a roll of the dice…”
https:// t.co/Etf8NFmzYB
Anonymous 05/03/18 (Thu) 14:06:06 eeed56 No. 1285387
Anonymous 05/03/18 (Thu) 14:06:13 ff3c93 No. 1285389
>>1285266
I wonder if these are some electonic components that go into our military planes….that are made so that the Cabal can hack into with Apples help which is how they have been taking our planes down.
Thoughts?
Anonymous 05/03/18 (Thu) 14:06:24 b0a429 No. 1285391
>>1285375
Do probably 30 a day. Truckers dont go on the dock. They're a liability waiting to happen with forktruck traffic. They are confined to a lounge area with bathrooms and a TV while we load/unload with a window for paperwork. After loading, they pull forward to inspect the load before seal is applied and shipment is released.
Anonymous 05/03/18 (Thu) 14:06:30 aee2d4 No. 1285393
>>1285381
Wondered that myself, anon. Gonna add it to notables just in case.
Anonymous 05/03/18 (Thu) 14:06:35 328187 No. 1285394
Anonymous 05/03/18 (Thu) 14:06:46 45364b No. 1285395
>>1285382
no way Comey is that great an actor
He's a slimeball
Anonymous 05/03/18 (Thu) 14:06:47 d921a4 No. 1285396
>>1285255 NY Times CEO Mark Thompson, former Channel 4 & BBC
+ (prev.)
>>1284186 Sir Jony Ive,( CDO) Apple Inc. DIGz
< + Sir BONO at (RED) Benefit
+ >>1284774 >Aldous Huxley,
>Brit Royal Society intellectual in Holy Wood (L.A.) in early 60's
+ >>1284286 >Sultan India & wife of Brit adviser to Sultan arrive in L.A. 1934 during excavation into "Lizard People Catacomb City" downtown L.A.
( >>1283854 >>1284363 )
< = (pic related) ???
cc >>1284483
Anonymous 05/03/18 (Thu) 14:06:51 df0479 No. 1285397
>>1285382
Th e n why is he running around saying crazy shit?
Anonymous 05/03/18 (Thu) 14:07:05 8439f9 No. 1285398
>>1285236
good morning anons
lol, i see u cats are still playing with pics
future posts will make clear
future proves past
Anonymous 05/03/18 (Thu) 14:07:10 e8955a No. 1285399
Anonymous 05/03/18 (Thu) 14:07:13 89e6d8 No. 1285400
>>1285388
Yes my lovely Nasim, but I'm alive.
Anonymous 05/03/18 (Thu) 14:07:17 e0da34 No. 1285401
>>1285122
Whoever's managing the qanonposts.com site
There's a phishing virus popping up there (again) on my Android device (Kindle). Says it's from "2p2017shopgratis.site". A window appears with the usual BS about my device being infected, "continue with instructions to fix," yadda, yadda.
Whoever's managing the site, please sanitize. Thanks!
Anonymous 05/03/18 (Thu) 14:07:37 ee7c64 No. 1285402
>>1285319
I love it, but……………
There's no blue check mark. I don't twat so I don't know but is this legit JC Twatter?
Anonymous 05/03/18 (Thu) 14:07:44 be2352 No. 1285403
>>1285266
Whatever it is, it's being shipped clandestinely. I still believe these pallets were hidden behind pallets of brussel sprouts. Perfect cover.
Anonymous 05/03/18 (Thu) 14:07:50 024e28 No. 1285404
>>1285339
my head still hurts from that discussion, ive never stared at file names so much in my life
Anonymous 05/03/18 (Thu) 14:07:50 074f90 No. 1285405
>>1285316
No … don't believe so. Looks good
Anonymous 05/03/18 (Thu) 14:07:52 1b8f68 No. 1285406
>>1285379
yes, mainly sarcasm but you never know.
Anonymous 05/03/18 (Thu) 14:07:52 1fc88c No. 1285407
>>1285294
The packages on top are dented because people were laying on top of it. This trailer was filled with people. Trafficking.
Anonymous 05/03/18 (Thu) 14:07:52 7efbd9 No. 1285408
I found out yesterday that Charleston Heston also had Q clearance waaaay back in the day, he used to do narration for atomic bomb videos for the army before he went into movies
pretty cool
Anonymous 05/03/18 (Thu) 14:08:03 7c504d No. 1285410
its everywhere…doesnt matter….
Anonymous 05/03/18 (Thu) 14:08:16 e97ff9 No. 1285412
>>1284892
>just throwing this out there.
New phones -> something in the screen making young people make more adreno chrome? levels check able in iris scan? (23&me commercial launched?) if "great sample"show up - > location is known - > grab and serve 4 dinner?
Anonymous 05/03/18 (Thu) 14:08:34 eccda8 No. 1285413
>>1285359
it is needed irregardless
we know Obama was a phony.
Anonymous 05/03/18 (Thu) 14:08:36 903612 No. 1285414
>>1285271
'Tim Cook is a faggot' is notable?
Are you fucking high or stupid?
Anonymous 05/03/18 (Thu) 14:08:52 70e6f0 No. 1285415
>>1285229
That's just the date for the xml standard used. Look at the DateCreated:
DateCreated>2018-05-02T19:51:34
Anonymous 05/03/18 (Thu) 14:08:54 d921a4 No. 1285416
>>1285336
Thx much. Easy to miss due to handoff.
Thx very much for taking the oven duties, Baker. Godspeed.
Anonymous 05/03/18 (Thu) 14:09:03 b40f65 No. 1285417
>>1285316
First time I've seen it - thanks for bringing to my/our attention.
Anonymous 05/03/18 (Thu) 14:09:35 9e9591 No. 1285420
>>1285380
You fail, "muh instant gratification" SHILL!
kys
Anonymous 05/03/18 (Thu) 14:09:54 a59a63 No. 1285422
Anonymous 05/03/18 (Thu) 14:09:58 b50eb2 No. 1285423
>>1285389
I think electronic components. Use in planes, phones, autos? IDK
Anonymous 05/03/18 (Thu) 14:10:00 19f1ff No. 1285424
Hey could a caring anon post for me what they think are the best settings to read the boards as fast as possible…I'm not a newfag to Q boards but haven't been on the boards before that so I am always trying to mess with it and I think aI fked it up
Anonymous 05/03/18 (Thu) 14:10:01 e9a1fb No. 1285425
>>1285297
you could say that FLIP
is a synonym for ROLL
but not ROLE
Anonymous 05/03/18 (Thu) 14:10:07 e75123 No. 1285426
"Adidas doesn't need Kanye anymore"
German company founded by Adolf Dassler
https:// www.bloomberg.com/view/articles/2018-05-03/kanye-west-is-on-the-way-out-with-fashionistas
Anonymous 05/03/18 (Thu) 14:10:43 ee7c64 No. 1285427
>>1285391
Maybe,
but….. when delivering, even on a military base, the Drivers often unload themselves and stage in an open area in the warehouse or loading dock for easy in-check and recieving.
Anonymous 05/03/18 (Thu) 14:10:58 6d92f7 No. 1285429
There not people being shipped. You couldn't fit that many people in a pallett.
Maybe blood.
Maybe electronics (chips?)
Anonymous 05/03/18 (Thu) 14:11:20 af1df9 No. 1285430
en.wikipedia.org/wiki/Bill_McDermott
something's fishy about the guy..some would even say cunty..
when i saw it live that day i thought the same..but now in light of planes crashing regularly it gets even worse with smelling that cunty breath of cuntiness..
www.sap.com/industries/defense-security.html
en.wikipedia.org/wiki/SAP_SE
"Bill McDermott, CEO of SAP, compared the release of SAP S/4HANA to a "moonshot", describing it as the most important launch in the company's history."
So..if the guy is not a friendly friend, he probably is into soemthing very BAD. his thing could very well be blackmailing POTUS.
BAKER this could be NOTABLE
Anonymous 05/03/18 (Thu) 14:11:27 4afc22 No. 1285431
>>1285411
>>1285392
>>1285364
Extracting Qualcomm's KeyMaster Keys - Breaking Android Full Disk Encryption
After covering a TrustZone kernel vulnerability and exploit in the previous blog post, I thought this time it might be interesting to explore some of the implications of code-execution within the TrustZone kernel. In this blog post, I'll demonstrate how TrustZone kernel code-execution can be used to effectively break Android's Full Disk Encryption (FDE) scheme. We'll also see some of the inherent issues stemming from the design of Android's FDE scheme, even without any TrustZone vulnerability.
I've been in contact with Qualcomm regarding the issue prior to the release of this post, and have let them review the blog post. As always, they've been very helpful and fast to respond. Unfortunately, it seems as though fixing the issue is not simple, and might require hardware changes.
If you aren't interested in the technical details and just want to read the conclusions - feel free to jump right to the "Conclusions" section. In the same vein, if you're only interested in the code, jump directly to the "Code" section.
SETTING THE STAGE
https:// bits-please.blogspot.in/2016/06/extracting-qualcomms-keymaster-keys.html
Anonymous 05/03/18 (Thu) 14:11:40 eaf69d No. 1285432
>>1285210
What if those are boxes of the QRS-11 chip…..that would be a lot of them……ideas??
Anonymous 05/03/18 (Thu) 14:11:42 b50eb2 No. 1285433
>>1285393
Yes, so second time a short summary from someone has suggested the pics werent for us but a msg for the black hats.
Anonymous 05/03/18 (Thu) 14:11:43 7c504d No. 1285434
lol…these posts are all ridiculous….im out….recent q pics ridiculous too….the moab to irans nuke plant last week….was damn amazing though…
Anonymous 05/03/18 (Thu) 14:11:47 1b8f68 No. 1285435
>>1285357
roll out the red carpet
they see me 'rollin'
Anonymous 05/03/18 (Thu) 14:12:22 226ef4 No. 1285437
General message to the indictment-counter anons:
HUGE THANK YOU!
Anonymous 05/03/18 (Thu) 14:12:23 e9a1fb No. 1285438
>>1285307
not proof of anything… anyone can name any random contact stormy daniels
anons need to learn to not latch onto everything that they want to be true
Anonymous 05/03/18 (Thu) 14:12:25 e75123 No. 1285439
>>1285389
Oh, the thingy to take down plane is something different.
Something that would make you ultimately depressive, believe me.
Anonymous 05/03/18 (Thu) 14:12:28 6054bc No. 1285440
>>1285397
Well if he is part of the plan, he would be saying exactly what he is saying
Anonymous 05/03/18 (Thu) 14:12:29 7efbd9 No. 1285441
>>1285429
what if they're small people?
Anonymous 05/03/18 (Thu) 14:12:38 1319f4 No. 1285443
Fuck off with the trucky chit chat bullshit. If you cant add facts about the photo's…STFU
Anonymous 05/03/18 (Thu) 14:12:41 be2352 No. 1285444
>>1285293
Interdasting. See, it's habbening WW.
Anonymous 05/03/18 (Thu) 14:12:41 0824eb No. 1285445
Anonymous 05/03/18 (Thu) 14:12:47 731c0b No. 1285446
https:// www.zerohedge.com/news/2018-01-25/comey-rosenstein-mccabe-all-named-fisa-memo-according-first-leak
Comey, Rosenstein, McCabe All Named In FISA Memo, First Leak Reveals
A bombshell four-page "FISA memo" alleging egregious surveillance abuse by the FBI, DOJ and Obama administration, specifically names FBI Deputy Director Andrew McCabe, former FBI Director James Comey and Deputy Attorney General Rod Rosenstein, according to the Daily Beast.
The GOP-authored memo made waves last week after it was made available to the full House of Representatives for viewing. With over 60 GOP lawmakers calling for its release, Capitol Hill sources on both sides of the aisle tell The Daily Beast that it's only a matter of time before the general public is allowed to view the document - which is likely to stoke already-inflamed tensions between GOP lawmakers and the individuals named in the leak.
The facts contained in the Republican majority-authored report are said to be "jaw-dropping and demand full transparency," according to Rep. Matt Gaetz (R-FL), while the top ranking Democrat on the House Intel Committee, Adam Schiff (D-CA) dismissed the memo as "profoundly misleading" talking points drafted by Republican staffers.
Several other GOP Congressmembers have weighed in. "I have read the memo," tweeted Rep. Steve King (R-IA), adding "The sickening reality has set in. I no longer hold out hope there is an innocent explanation for the information the public has seen. I have long said it is worse than Watergate. It was #neverTrump & #alwaysHillary. #releasethememo."
Along with the four-page memo, Congressional investigators learned from a new batch of text messages between anti-Trump FBI investigators that several individuals within the Department of Justice and the FBI may have come together in the "immediate aftermath" of the 2016 election to undermine President Trump, according to Rep. John Ratcliffe (R-TX) who has reviewed the texts.
This is particularly interesting since the memo allegedly names Deputy Attorney General Rod Rosenstein - who created Robert Mueller's special counsel after former FBI Director James Comey was fired.
Anonymous 05/03/18 (Thu) 14:12:47 b0a429 No. 1285447
>>1285427
Your "never" turned to "often"…
Anonymous 05/03/18 (Thu) 14:12:47 074f90 No. 1285448
>>1285404
>>1285339
Flat past out next to my keyboard. Did we ever move forward from this post?
Anonymous 05/03/18 (Thu) 14:12:55 b50eb2 No. 1285450
Anonymous 05/03/18 (Thu) 14:13:16 1fc88c No. 1285451
>>1285379
>>1285368
>You do realize how crazy you sound.
>And hey at this point I may agree with you…
Q warned us earlier that it goes very deep.
Anonymous 05/03/18 (Thu) 14:13:17 e02a8a No. 1285452
>>1285229
Has anybody identified which flight that is?
Because the flight data websites will let you go back in time and see what other plane was in the air nearby where Q could have photographed the JetBlue plane. If we identify the Jetblue flight, then from that, we can identify the flight carrying Q and the destination of Q's flight.
Anonymous 05/03/18 (Thu) 14:13:27 58a52a No. 1285453
>>1285297
86 days ago Q said "find the roll"
>>1285297
Anonymous 05/03/18 (Thu) 14:13:33 aee2d4 No. 1285454
>>1285430
ADDED
I think we need eyes on this. I use the SAP system at work, but it's for inventory control.
Anonymous 05/03/18 (Thu) 14:13:34 607f0b No. 1285455
>>1285368
that would be a nice eye poke
Anonymous 05/03/18 (Thu) 14:13:35 be2352 No. 1285456
>>1285294
The boxes are filled with copies of the cookbook, "To Serve Man."
Anonymous 05/03/18 (Thu) 14:13:36 89e6d8 No. 1285457
The Rolls of Oleron were some of the first Rules of the Sea
Maybe the pallets came by sea.
Anonymous 05/03/18 (Thu) 14:13:43 903612 No. 1285458
>>1285297
>>1285338
'roll' is POTUS' shout out to this Bread! lmao
¯\_(ツ)_/¯
Anonymous 05/03/18 (Thu) 14:13:48 f039c1 No. 1285460
>>1285312
Watch the water was referring to North Korea being freed from CIA control and the pics of calm instead of stormy seas. However, this may have more to do with Big Pharma. Worth digging.
Anonymous 05/03/18 (Thu) 14:13:57 28a21e No. 1285461
>>1281335
That's just plastic shrink-wrap, anon…
Anonymous 05/03/18 (Thu) 14:14:07 6054bc No. 1285462
>>1285395
Kinda ironic that he was the catalyst for creating the Special counsel. If Trump hired Rosenstein, and Rosenstein hired Mueller, and Comey was the "reason" Rosenstein hired Mueller, then Comey has to be white hat. White hats needed the Special Counsel, clearly wanted Mueller to head it…
Anonymous 05/03/18 (Thu) 14:14:33 b50eb2 No. 1285464
>>1285412
Wow, thats a scarey hypothesis. What do we know about iris or face recognition?
Anonymous 05/03/18 (Thu) 14:14:37 70122c No. 1285465
>>1285381
Just an anon, anon. Putting a fine point in my thoughts for now so that I can move on.
Anonymous 05/03/18 (Thu) 14:14:41 b215f3 No. 1285466
Q's pics mean to me that Apple is using Hong Kong and their port front flagship store as a transshipment point for items that should not be shipped from China to the USA or elsewhere, and whitehats know all about it. either human trafficking or comped chips
Anonymous 05/03/18 (Thu) 14:14:50 eeed56 No. 1285468
>>1285427
Why is it that Q like to post pics without explanation? Q likes to leave you hanging like this and you guys talk back and forth with speculation what it might be. Is this intentional? I have not seen single confirmation of "THIS IT IT!" Nothing burger.
Anonymous 05/03/18 (Thu) 14:14:52 c68802 No. 1285469
>>1285122
Is that some sort of writing on the left side of the truck? sorry if this has been addressed, just getting going today.
Anonymous 05/03/18 (Thu) 14:14:56 87cb9d No. 1285470
>>1285311
I think the C-130s have a lot more to do with CONUS infiltration of whomever is grounding/downing flights in our ME operations in Syria, but I'm thinking this could be a potential theory.
Anonymous 05/03/18 (Thu) 14:15:11 df0479 No. 1285471
Anonymous 05/03/18 (Thu) 14:15:25 b0a429 No. 1285474
>>1285456
No, this is what is in the boxes.
Anonymous 05/03/18 (Thu) 14:15:33 1fc88c No. 1285475
>>1285450
You sound so sure.
Tell us what you know, then… or shut up.
Anonymous 05/03/18 (Thu) 14:15:41 be2352 No. 1285476
>>1285297
They are rolling out the plan to misdirect the MSM.
Anonymous 05/03/18 (Thu) 14:15:50 ca3cca No. 1285477
>>1285398
she reminds me of the sexy persian that got me through law school ;-P
Anonymous 05/03/18 (Thu) 14:15:50 89e6d8 No. 1285478
>>1285441
I knew it. Midgets rule the world!
Anonymous 05/03/18 (Thu) 14:15:55 4afc22 No. 1285479
>>1285431
In Apple's case you can't extract the hardware key no matter what software attack you carry out (w/ the OEMs or without). At most, you can bypass the software protections, but you'll still have to perform the bruteforce attempt strictly on the device.
Anonymous 05/03/18 (Thu) 14:16:13 38939e No. 1285481
How is Boom week coming along?
Anonymous 05/03/18 (Thu) 14:16:29 27e345 No. 1285482
>>1285356
The right to clean drinking water and correct information.
Anonymous 05/03/18 (Thu) 14:16:31 c7963e No. 1285483
>>1285478
until its time to ride the bumpercars
Anonymous 05/03/18 (Thu) 14:16:40 e97e19 No. 1285484
3 "Prisoners" from NK that Previous Admin "wanted"
3 Pallets
Apple in China
Apple Headquarters
Jet Blue
NK producing corrupt Apple Products, Shipped through China to be used in US
Anonymous 05/03/18 (Thu) 14:17:06 8439f9 No. 1285485
>>1285477
u should of fought for her, f her arranged marriage
Anonymous 05/03/18 (Thu) 14:17:12 e75123 No. 1285486
>>1285459
Books of advanced knowledge in physics.
Anonymous 05/03/18 (Thu) 14:17:39 0b79ab No. 1285487
>>1285436
Most definitely agree that the laser from the Chinese base was what was posted
Anonymous 05/03/18 (Thu) 14:17:42 af1df9 No. 1285488
last night guy on Tucker before time went out told us that they are also focussing on Guccifer, Wikileaks and DCleaks..
could be important to know.
at least he seemed to think it's good having it out there..when you see the complete interview you can see how they constructed the whole thing..in the beginning Caputo starts the sentence, gets interrupted by another of Tckers questions..they semm to dance around the thing a bit and in the end Caputo gets to drop his thing..
Anonymous 05/03/18 (Thu) 14:17:43 b50eb2 No. 1285489
>>1285210
You r assuming pic is of finished load. Could b midway thru loading or unloading….move on.
Anonymous 05/03/18 (Thu) 14:17:46 9668b6 No. 1285490
>>1285436
compromised mobile operating security
leads to
clandestine trusted app backdoor
leads to
tracking abilities
leads to
pin-point accuracy and perfect aim.
our pilots are not safe because we didn't know they were being tagged at the factory.
Anonymous 05/03/18 (Thu) 14:17:51 9128b5 No. 1285491
>>1285144
—————————————————
BAKER CORRECTION NEEDED
The dough for Memes18 is incorrect. The link should be →
>>1027465
I tested https:// 8ch.net/qresearch/res/1027465.html#1027642
and it works.
I don't understand why the link in the dough doesn't highlight since the numerals are correct.
Can you have a look and see if there's a space or a foreign character in there?
ThankQ!
———————————————————-
Anonymous 05/03/18 (Thu) 14:17:56 3cc9e0 No. 1285492
>>1285467
Many apologies for this mistake!!
Anonymous 05/03/18 (Thu) 14:18:10 607f0b No. 1285494
>>1285477
Interdasting, I had a super sexy persian help me through DiffEQ.
Anonymous 05/03/18 (Thu) 14:18:44 b215f3 No. 1285495
>>1285313
are you sure its on a truck?
could be a container on a dock or the ground no?
Anonymous 05/03/18 (Thu) 14:18:45 6ed370 No. 1285496
https:// www.msn.com/en-us/news/world/giuliani-says-3-americans-held-by-north-korea-to-be-released-thursday/ar-AAwFn0D?ocid=spartandhp
<Giuliani says 3 Americans held by North Korea to be released Thursday
Anonymous 05/03/18 (Thu) 14:18:50 6ac6c2 No. 1285497
>>1285430
He looks like a Vegas mob boss
Anonymous 05/03/18 (Thu) 14:19:11 d921a4 No. 1285498
HookTube embed. Click on thumbnail to play. >>1285327
Amazing story.
<gymnopedie no 1 erik satie man on wire (2008)
>warning: stream reverts to GOOGtube.
Anonymous 05/03/18 (Thu) 14:19:17 4afc22 No. 1285500
>>1285493
CONCLUSIONS
The key derivation is not hardware bound. Instead of using a real hardware key which cannot be extracted by software (for example, the SHK), the KeyMaster application uses a key derived from the SHK and directly available to TrustZone.
OEMs can comply with law enforcement to break Full Disk Encryption. Since the key is available to TrustZone, OEMs could simply create and sign a TrustZone image which extracts the KeyMaster keys and flash it to the target device. This would allow law enforcement to easily brute-force the FDE password off the device using the leaked keys.
Patching TrustZone vulnerabilities does not necessarily protect you from this issue. Even on patched devices, if an attacker can obtain the encrypted disk image (e.g. by using forensic tools), they can then "downgrade" the device to a vulnerable version, extract the key by exploiting TrustZone, and use them to brute-force the encryption. Since the key is derived directly from the SHK, and the SHK cannot be modified, this renders all down-gradable devices directly vulnerable.
Android FDE is only as strong as the TrustZone kernel or KeyMaster. Finding a TrustZone kernel vulnerability or a vulnerability in the KeyMaster trustlet, directly leads to the disclosure of the KeyMaster keys, thus enabling off-device attacks on Android FDE.
Anonymous 05/03/18 (Thu) 14:19:20 c68802 No. 1285501
Anonymous 05/03/18 (Thu) 14:19:33 401a68 No. 1285504
>>1285494
Hmmm…I don't remember any girls in that class. o_O
Anonymous 05/03/18 (Thu) 14:20:09 aee2d4 No. 1285505
>>1285491
Memes20 >>1232995 , 19 >>1144040 , 18 ; >>1027465
testing to see if they work now
Anonymous 05/03/18 (Thu) 14:20:15 2b2eb8 No. 1285506
>>1285430
SAP software is used extensively in key data operations of at least one of the biggest banks on the planet.
Not only does it suck, it's German, and + to the cuntiness of the CEO makes it a trifecta.
Anonymous 05/03/18 (Thu) 14:20:25 df0479 No. 1285507
>>1285468
I kind of agree. The only thing that we can really get from these pics is that something from or to Apple is being shipped. We would assume something nefarious. We cannot know what until it is revealed. So, unless we can SEE what is in the boxes, we know nothing.
Anonymous 05/03/18 (Thu) 14:20:56 4afc22 No. 1285508
>>1285501
HDC22@clintonemail.com
Anonymous 05/03/18 (Thu) 14:21:15 ca3cca No. 1285509
Per POTUS tweet, we can infer that Cohen had the roll of film from the SOTU which captured the threat to POTUS, and now Mueller has it logged as evidence.
Anonymous 05/03/18 (Thu) 14:21:23 aee2d4 No. 1285510
>>1285505
Memes20 >>1232995 , 19 >>1144040 , 18 >>1027465
Anonymous 05/03/18 (Thu) 14:21:24 06789c No. 1285511
>>1283960
The letters from second post led me to this link
Yhmtyk
http:// www.sanjoseca.gov/DocumentCenter/View/734
Anonymous 05/03/18 (Thu) 14:21:32 24b1fb No. 1285512
Totally off topic, but to my photoshop fags, anyone has any good advice on what useful plug-ins to get?
Anonymous 05/03/18 (Thu) 14:21:40 b50047 No. 1285513
>>1285363
>>1285363
>>1285363
Agree Anon
Meant as shot across bow to black hats
We'll find out later
Anonymous 05/03/18 (Thu) 14:21:45 9128b5 No. 1285514
>>1285491
>>1285505
Something weird going on. The bread still exists in the catalog because I can navigate to it from a browser bookmark that I saved when I created that bread.
https:// 8ch.net/qresearch/res/1027465.html#1027642
I don't know what to say. Weird.
Anonymous 05/03/18 (Thu) 14:22:05 6054bc No. 1285515
>>1285468
In this case, it would be because we arent supposed to know what Q is saying just yet, moreso file these pictures in the back of our heads and wait until they come to fruition
Anonymous 05/03/18 (Thu) 14:22:07 034d67 No. 1285516
>>1285501
Evergreen containers… interesting
Anonymous 05/03/18 (Thu) 14:22:09 aee2d4 No. 1285517
>>1285491
Not sure why the link is broken. Can you message BO or BV please?
Anonymous 05/03/18 (Thu) 14:22:11 c7963e No. 1285518
>>1285510
keep your head up anon…
It's getting there. idk why tf…
Anonymous 05/03/18 (Thu) 14:22:15 4afc22 No. 1285519
Anonymous 05/03/18 (Thu) 14:22:16 418063 No. 1285520
>>1285297
>>1285338
>to roll someone is to rob or to scam them
>>1285326
>Possible getting ready to roll (86) this mf
Giuliani knocked over all their toys, kicked them, smashed them, set them on fire & then pissed out the fire.
Anonymous 05/03/18 (Thu) 14:22:47 a6110e No. 1285521
>>1285210
I don't think it's money, I have seen pallets of copy paper that size and they didn't have special pallets, gold would be smaller size because of the weight, I am guessing it's silicon chips, but each of those boxes would be heavy as shit still a mystery.
Anonymous 05/03/18 (Thu) 14:22:48 6320b8 No. 1285522
Anonymous 05/03/18 (Thu) 14:22:54 56347f No. 1285523
>>1285325
Because it is not the mode of transportation the opponent was expecting.
Anonymous 05/03/18 (Thu) 14:23:02 b50eb2 No. 1285524
>>1285475
I know ur stupid.
Anonymous 05/03/18 (Thu) 14:23:05 6054bc No. 1285525
When is Iran Deal deadline? May 12?
Anonymous 05/03/18 (Thu) 14:23:14 e9a1fb No. 1285527
>>1285448
nobody mentioned it but
if you take any Q post that says "marker" and take the time… there is almost always another Q post at the exact same time on a different day that connects
we need to farm all of these
Anonymous 05/03/18 (Thu) 14:23:27 c547e2 No. 1285528
Another datapoint from the Wall Street Journal - (Sry - I use El-Autismo Dark themes)
Relative to the Aircraft Incidents and EW (Electronic Warfare)
Source:
https:// www.wsj.com/articles/laser-from-chinese-base-aimed-at-u-s-military-pilots-in-africas-skies-pentagon-charges-1525351775
From the article "
The new signs of military tension also come as U.S.-China economic relations have sunk to their lowest point in decades. President Donald Trump says he considers Chinese counterpart Xi Jinping a friend, but has imposed tariffs on some Chinese goods and is threatening tariffs on $150 billion more, while his administration has imposed new restrictions on U.S. technology exports to China.
There have been a number of laser-related incidents in the past several weeks, Pentagon officials said. In one of the most recent, two American service members piloting a C-130 turboprop experienced minor eye injuries after being exposed to the laser beam, according to a Pentagon official.
"
Anonymous 05/03/18 (Thu) 14:23:44 1091ad No. 1285530
The tweets were about Stormy.
The delta between the (3) tweets is 8 & 6 = 86. 86 means to get rid or.
The misspelling of roll combined with 86 is telling me that the Stormy thing is about to be 86ed, nothing to do with China. WTF?
Anonymous 05/03/18 (Thu) 14:23:46 1b8f68 No. 1285531
>>1285436
>>1285487
>>1285490
Rubber bullets are aka 'baton' rounds.
Batons can be used to direct much like a laser pointer can be used to direct.
BATON also happens to be a Type 1 block cyper used by the NSA.
Maybe Q is pointing out to us that BATON is how the NSA is accidentally leaking it all.
Anonymous 05/03/18 (Thu) 14:23:51 3cc9e0 No. 1285533
https
://uk.reuters.com/article/us-tesla-results-research/tesla-shares-bonds-drop-as-ceo-musk-snubs-wall-street-idUKKBN1I41IY
Anonymous 05/03/18 (Thu) 14:23:54 eeed56 No. 1285534
Anonymous 05/03/18 (Thu) 14:24:01 af1df9 No. 1285535
>>1285497
have never met one..thank god..
guy could also be some vampire like sun hating shitneck..he was the only one wearing sunglkasses and hat this fucked up smug look..spoke last..sat to the right of POTUS for all the time..most of the guys at roundtable seemed to have shit their pants in comparison to this guy..when he began talking it felt very uncomfortable..his smile..his whole appearance was annoying to say the least.
Anonymous 05/03/18 (Thu) 14:24:20 2b2eb8 No. 1285537
>>1285414
Homosexuals have divided loyalties and may be blackmailable.
Anonymous 05/03/18 (Thu) 14:24:21 b97d2d No. 1285538
>>1285439
The only real physics you'll ever need.
Einstein?-FRAUD
CERN? Money Pit to drain tax revenue into a cult of bumping particles trail that leads nowhere, but keeps a bunch of retards looking busy & employed for life on your dime
Read this, reread this reread this again till you GET IT
& you will reach the same conclusion
ALL ACADEMIA IS A CIRCLE JERK
MODERN PARTICLE PHYSICS IS A CULT
https:// archive.org/details/magnetism1small
Anonymous 05/03/18 (Thu) 14:24:28 cfd191 No. 1285539
>>1285430
If the HANA launch was like a 'moonshot' for the company they must have hired their engineers from Negro American Space Society of Astronauts, NASSA.
https:// www.youtube.com/watch?v=9XPCzckUcYY
Anonymous 05/03/18 (Thu) 14:24:36 5bb3f4 No. 1285540
>>1285212
rifshocaa + yhmtyk?
Anonymous 05/03/18 (Thu) 14:24:41 9128b5 No. 1285541
>>1285517
OK have done so. Thank you & sorry for the trouble.
Anonymous 05/03/18 (Thu) 14:24:36 607f0b No. 1285542
>>1285504
Yeah, I was like woob woob.
Went out of her way to help me out, absolutely stunning, but it was like patently obvious she was not interested in displeasing daddy. Tried anon, tried so hard. A girl like that with brains…
Anonymous 05/03/18 (Thu) 14:24:55 45364b No. 1285543
OK this weird anon post that was in notables said
"INTEL? C_hips? SUNG of SAM"
And then I found this article about Samsung to manufacture iPhone chips again.
https:// www.washingtonpost.com/news/innovations/wp/2017/07/18/samsung-to-manufacture-iphone-chips-for-apple-again-report-says/?utm_term=.42896df6ddf8
Maybe this post is more than it seems?
Anonymous 05/03/18 (Thu) 14:25:04 c33a3e No. 1285544
>>1284928 (prev.)
>it was always supposed to be that way
true, true
>anons were always supposed to contribute notables to the BAKER
>some anons got lazy
>some anons forgot
>some anons never knew
>I think it's a great idea
>just wasn't sure of what the TAG TEAM NOTABLES' label was supposed to mean
>after all it was the night shift crew, and we all know they are a little different
yeah, i guess we can loose the TAG eventually/soon, but felt like leaving it for a while would help spread knowledge of the method...
personally i loved every moment baking, but keeping an eye on the thread count while watching for heads up (and selecting and writing the titles because anons don't do it) gets intense - and if Q drops on top of that, even moar of a rush...
CoBaking settles that, then you can concentrate on the posts and Q, while anons concentrate on the thread/notables
Anonymous 05/03/18 (Thu) 14:25:12 ee7c64 No. 1285545
>>1285523
I'd agree based on that I believe they were expecting a C-30. IMO
Anonymous 05/03/18 (Thu) 14:25:27 b50047 No. 1285546
>>1285258
Read CDAN
Tim likes Asian hot dogs
Anonymous 05/03/18 (Thu) 14:25:35 eeed56 No. 1285547
>>1285538
>Einstein?-FRAUD
Anonymous 05/03/18 (Thu) 14:25:49 aee2d4 No. 1285549
>>1285541
No problem at all. Want to make sure the bread's not moldy!
Anonymous 05/03/18 (Thu) 14:25:50 c1f1d7 No. 1285550
>>1285266
are these 'special' apple phones for the cabal to communicate with? blackberry types?
Re-read 'apple' crumbs:
Wed 15 Nov 2017 00:38:48 No.149490950
_Conf_D-TT_^_v891_0600_yes
_green1_0600
Bunker Apple Yellow Sky [… + 1]
Yes
Godspeed.
Q
Tue 21 Nov 2017 18:43:15 No.150388962
Expand your thinking.
Captain Mike Green.
_Conf_D-TT_^_v891_0600_yes
_green1_0600
Bunker Apple Yellow Sky [… + 1]
Yes.
Who countered?
Do you believe in coincidences?
Learn how to read the map.
Q
Fri 22 Dec 2017 01:13:36 5902e7 No.146268
>>146142
Why is EM provided BIG WW subsidies?
No subsidies = ?
Clown contribution in exchange for access code?
Why relevant?
Amazon Echo?
Google Home?
Clown contributions?
Apple Face ID Tech?
FB Face ID Tech?
Catching on?
Bombs Away.
Q
Fri 22 Dec 2017 01:36:43 5902e7 No.146599
We are moving fast.
Remember, not all within the C-A, D-J, F-I are bad apples.
House cleaning (TOP).
Restructuring (1 to 2).
Operations 24/7.
Speed.
Q
Thu 15 Feb 2018 15:47:34 6d0fd8 No.388588
>>388528
Why is Big Pharma essential?
Expand your thinking past cures.
Think Google [new Pixel phone].
Think Apple [vs. Samsung].
Why was Blackberry destroyed?
We can guide but you must organically uncover the TRUTH.
THEY are watching.
ARCHIVE EVERYTHING OFFLINE.
Q
Anonymous 05/03/18 (Thu) 14:25:56 0b79ab No. 1285551
>>1285527
This is an excellent find.
Anonymous 05/03/18 (Thu) 14:26:23 56a8a7 No. 1285552
>>1285297
There was another one from last night, "Earnhardt" should be "Earhardt"
Extra n
>>1285457
See:
>>1285254
Anonymous 05/03/18 (Thu) 14:26:38 8439f9 No. 1285555
>>1285542
well hopefully you had some good times and got to run through it a few times
memories
Anonymous 05/03/18 (Thu) 14:26:59 56347f No. 1285556
>>1285327
Amazing feat and astounding story. Read the book some years back. The lack of security at the towers at that time. he was able to go in and out, bring in equipment, without detection. Really put 911 in perspective.
Anonymous 05/03/18 (Thu) 14:27:07 59b31b No. 1285557
Anonymous 05/03/18 (Thu) 14:27:31 fffb1c No. 1285558
Jordan = MOAB? Pompeo & marines turned up in Jordan right after Q said MOAB. maybe MOAB didn't refer to the 'mother of all bombs'
Anonymous 05/03/18 (Thu) 14:27:35 c1f1d7 No. 1285559
>>1285550
>Bunker Apple Yellow Sky [… + 1]
Bunker - trailer, new apple bldg
Apple - phones
yellow - asia, china
sky - plane
Anonymous 05/03/18 (Thu) 14:27:42 556a87 No. 1285560
>>1285511
Yhmtyk
You Have More Than You Know
Anon 05/03/18 (Thu) 14:27:51 e5ccf2 No. 1285561
Anonymous 05/03/18 (Thu) 14:27:57 b50eb2 No. 1285562
>>1285465
Well, anon, i like ur thought process. Thanks for sharing
Anonymous 05/03/18 (Thu) 14:28:16 eaf69d No. 1285563
>>1285430
>>1285430
Doing some digging on this guy…..interesting info here regarding a fall in 2015that cost him his LEFT EYE
Anonymous 05/03/18 (Thu) 14:28:40 56347f No. 1285565
>>1285340
doddering old fool who was once at the top of his game
Anonymous 05/03/18 (Thu) 14:28:55 3cc9e0 No. 1285567
https
://uk.reuters.com/article/uk-palestinians-gaza-salaries/anger-as-palestinian-authority-cuts-gaza-salaries-and-pays-late-idUKKBN1I41M6
Anonymous 05/03/18 (Thu) 14:28:56 b06664 No. 1285568
From yersterday's CDAN blind.
Some guy on this blog says it's J Depp. It's prly not. Says 3 floors, this is 2 floors.
Had property in this building in LA. Owned 5 penthouse suites,
The blind says 3 floors.
http ://www.condopedia.com/wiki/Eastern_Columbia_Lofts#Layout_and_Features
Back to believing its Dopey. 3 floors = Mandalay Bay. The blind specifically mentions sunglasses belonging to bodyguard. I think that was slipped in the blind because we are always seeing dopey in sunglasses.
Anonymous 05/03/18 (Thu) 14:29:17 1fc88c No. 1285569
>>1285514
In more previous breads pictures are taken down… (only significant ones?)
See: https:// 8ch.net/qresearch/res/655305.html#656105
Anonymous 05/03/18 (Thu) 14:29:26 be2352 No. 1285570
Anonymous 05/03/18 (Thu) 14:29:32 af1df9 No. 1285571
>>1285539
never thaught about that..:D
thanks for the heads up.
Anonymous 05/03/18 (Thu) 14:29:45 89ed54 No. 1285572
>>1284552
Q drop talking about killing existing platforms. Was Q being literal?
Anonymous 05/03/18 (Thu) 14:30:25 8439f9 No. 1285574
>>1285538
don't forget nasa
worlds biggest money laundering scheme
Anonymous 05/03/18 (Thu) 14:30:34 b06664 No. 1285575
BAKER NOTABLE
>>1285316 → POTUS tweet uses GOOD and GREAT (in that order), shout out to Q post
Anonymous 05/03/18 (Thu) 14:30:41 4afc22 No. 1285576
Anonymous 05/03/18 (Thu) 14:30:43 607f0b No. 1285577
>>1285555
nice quads. sadly no. one thing that sticks out in my mind was (the time was after 9/11) she was adamant almost upset that I assumed she was from Iran by her characteristics. I AM PERSIAN! kek
yes, memories, thanks anon
Anonymous 05/03/18 (Thu) 14:30:52 6054bc No. 1285578
When's Iran Deal deadline? May 12?
Anonymous 05/03/18 (Thu) 14:31:14 67f569 No. 1285579
>>1280852 (previous bread)
https:// twitter.com/realDonaldTrump/status/890361489126805504
https:// twitter.com/realDonaldTrump/status/893416615504748544
Anonymous 05/03/18 (Thu) 14:31:24 be2352 No. 1285580
>>1285439
Serious deja vu here. From months back. Even to the "Thauce" response. Weird.
Anonymous 05/03/18 (Thu) 14:31:29 3cc9e0 No. 1285581
Winning
https
://uk.reuters.com/article/uk-usa-economy/u-s-trade-deficit-narrows-sharply-labour-market-tightening-idUKKBN1I41MK
Anonymous 05/03/18 (Thu) 14:31:31 401a68 No. 1285582
Anonymous 05/03/18 (Thu) 14:31:44 839e8a No. 1285583
>>1285297
"e" is out, "l" is in?
Anonymous 05/03/18 (Thu) 14:31:49 2f6a0b No. 1285584
>>1285521
If they are cartons of something heavy they might be packed with a packing material. So say each carton has something dense in it, packing material would fill it and make each carton less dense.
Anonymous 05/03/18 (Thu) 14:32:08 78be58 No. 1285585
So file names are arranged the same.
Group of 8 numbers, then 4-4-4 then 12
Hex code maybe?
Anonymous 05/03/18 (Thu) 14:32:08 4fdadb No. 1285586
>>1285570
Died a while ago here it seems
Anonymous 05/03/18 (Thu) 14:32:12 2b2eb8 No. 1285587
>>1285556
As an achievement, it's tops in my book. Endlessly inspiring.
Anonymous 05/03/18 (Thu) 14:32:18 eeed56 No. 1285588
>>1285424
>the best settings to read the boards as fast as possible
I like reading from bottom. Filter as you go. You will eventually catch up.
Anonymous 05/03/18 (Thu) 14:32:24 aee2d4 No. 1285589
Anonymous 05/03/18 (Thu) 14:32:46 6ed370 No. 1285590
>>1285568
Is Dopey considered an A list celeb?
Anonymous 05/03/18 (Thu) 14:32:56 af1df9 No. 1285591
>>1285563
wtf..thx anon..guy seems more and more like a ding ding ding
Anonymous 05/03/18 (Thu) 14:33:00 aee2d4 No. 1285592
Anonymous 05/03/18 (Thu) 14:33:22 87cb9d No. 1285593
YouTube embed. Click thumbnail to play. >>1285476
>>1285297
This.
Remember, Story scandal is nothing more than a MSM distraction. They raided Cohen's office(s) for dirt, and got more than they bargained for:
>>1215845
Q very specifically stated that he will neither confirm/deny that the SC is on the team. The Stormy thing is nothing more than a laser pointer to distract the MSM. Again, "they fall for it every time".
>>1242619
Anonymous 05/03/18 (Thu) 14:33:34 b06664 No. 1285594
BAKER NOTABLE
>>1285527 → possible use of the word marker related to other Q posts at same time
Anonymous 05/03/18 (Thu) 14:33:42 074f90 No. 1285595
What is this moron up to.
Kellyanne Conway's husband trolls Trump with FEC rules
The husband of White House counselor Kellyanne Conway took a veiled shot at President Trump following revelations the president repaid his longtime attorney, Michael Cohen, for the $130,000 given to former adult film actress Stormy Daniels.
George Conway, a lawyer who removed his name from consideration for a top Justice Department post, tweeted Thursday a link to the Federal Election Commission’s web page for handling personal loans from a candidate for federal office.
Conway included in his tweet a screenshot from the page, which explained what is not considered the candidate’s personal funds.
“If any person, including a relative or friend of the candidate, gives or loans the candidate money ‘for the purpose of influencing any election for federal office,’ the funds are not considered personal funds of the candidate even if they are given to the candidate directly. Instead, the gift or loan is considered a contribution from the donor to the campaign, subject to the per-election limit and reportable by the campaign. This is true even if the candidate uses the funds for personal living expenses while campaigning," the passage highlighted by Conway states.
https:// www.washingtonexaminer.com/policy/courts/kellyanne-conways-husband-trolls-trump-with-fec-rules
Anonymous 05/03/18 (Thu) 14:33:48 6054bc No. 1285596
Anonymous 05/03/18 (Thu) 14:34:00 024e28 No. 1285599
>>1285368
I can't even pretend that there's any of this I find unbelievable at this point…
Anonymous 05/03/18 (Thu) 14:34:07 345feb No. 1285600
>>1285266
Looks to me like FIVE pallets. The one in the back looks like a double stack. One in the foreground, two behind that and then a single double stack in the back. Look at the wood pallets themselves, not what is on them. It looks like the one in the back has had the plastic wrap partially pulled down, probably to grab a box off the top or examine contents.
When you load a truck, you put the heavier stuff over the axles, you have to distribute the load correctly when you load the trailer.
Anonymous 05/03/18 (Thu) 14:34:13 2f6a0b No. 1285601
>>1285584
Or the picture could just be about showing a partially filled trailer that indicates business isn't so good. Yeah, yeah, I know the whole truck may have been full and several stops have emptied it out, Or it could just have been taken at the beginning of the loading of it. But we could just be looking at a metaphor for business isn't so good.
Anonymous 05/03/18 (Thu) 14:34:13 a87a8c No. 1285602
Today Trump tweets:
Mr. Cohen, an attorney, received a monthly retainer, not from the campaign and having nothing to do with the campaign, from which he entered into, through reimbursement, a private contract between two parties, known as a non-disclosure agreement, or NDA. These agreements are…..
..very common among celebrities and people of wealth. In this case it is in full force and effect and will be used in Arbitration for damages against Ms. Clifford (Daniels). The agreement was used to stop the false and extortionist accusations made by her about an affair,……..
despite already having signed a detailed letter admitting that there was no affair. Prior to its violation by Ms. Clifford and her attorney, this was a private agreement. Money from the campaign, or campaign contributions, played no roll in this transaction.
Lets review the Stormy Story shall we:
Stormy makes affair claim (privately) against Trump
Cohen paids her to keep quiet, $130,000
She signs statement denying affair and NDA (non-disclosure agreement)
In some way Trump reimburses Cohen the $130,000
MSM catches wind of this and claims campaign contribution violations.
Then Stormy violates the NDA and goes public
Cohen reveals the settlement
Trump says he did not know anything about the $130,000 payment.
Cohen’s office is raided
Rudy comes out with a statement that says Trump did reimburse Cohen for the $130,000
Trump confirms in his tweets, yeah I did reimburse the $130,000
Hello possible Stormy Trump affair, big yawn
Bye bye campaign contribution violations
Truth:
Trump NEVER had an affair with Stormy Daniels (she is a Trump woman and can work with Trump and any Story he wants)
Donald Trump Jr. HAD an affair with Aubrey O’Day in 2012 -2013 (O’Day is a loose cannon, NOT workable)
Now let’s re-read the above summary with this in mind.
Aubrey O’Day (NOT Stormy) makes affair claim (privately) against Trump Jr. (NOT Trump)
Cohen paids her to keep quiet, $130,000
She signs statement denying affair and NDA (non-disclosure agreement)
In some way Trump reimburses Cohen the $130,000
MSM catches wind of this and claims campaign contribution violations.
Now Trump has a problem, these pesky MSM allegations of campaign contribution violation.
Stormy to the rescue!
Stormy goes public, she PRETENDS to violate the NDA and that she is the one involved in all this (even though she isn’t, it is O’Day who got paid off), that she got the $130,000 pay off.
Cohen reveals the settlement
Trump says he did not know anything about the $130,000 payment.
Cohen’s office is raided (how convenient)
Rudy comes out with a statement that says Trump did reimburse Cohen for the $130,000
Trump confirms in his tweets, yeah I did reimburse the $130,000
Hello possible Stormy Trump affair, big yawn
Bye bye campaign contribution violations
Trump what a gentleman, protecting his eldest son Donald Trump Jr. and his affair with O’Day.
IMAO he’s not worth it
I guess Vanessa agrees with me.
Anonymous 05/03/18 (Thu) 14:34:15 56a8a7 No. 1285603
>>1282709 (previous bread - notables)
Would be nice to have something like this for every time Q says "Timestamp"
Example attached
Anonymous 05/03/18 (Thu) 14:34:18 1b8f68 No. 1285604
>>1285532
give me all your shekels
muah ha ha ha
Anonymous 05/03/18 (Thu) 14:34:38 a17901 No. 1285606
JetBlue doesn’t fly overseas.
Anonymous 05/03/18 (Thu) 14:34:43 d630b6 No. 1285607
>>1285484
Has the aspect ratio of these been covered already?
iPhone 8/X
Letterbox Significant?
Anonymous 05/03/18 (Thu) 14:35:24 2b2eb8 No. 1285608
>>1285498
In so many ways. An inspiration. All the things that could have and should have gone wrong…he beat them all.
God was with him, imho.
Anonymous 05/03/18 (Thu) 14:35:25 edbee9 No. 1285609
Pallets with boxes full of U$D.
Has nothing to do with phones.
No idea who is sending/receiving.
Pay-off of some sort most likely.
Anonymous 05/03/18 (Thu) 14:35:26 aee2d4 No. 1285610
>>1285594
BAKER SURE APPRECIATES THE HELP ANON
I've been raking some, too. We've got a pretty good list so far.
Anonymous 05/03/18 (Thu) 14:35:27 c1f1d7 No. 1285611
>>1285579
Foxconn - Wikipedia
https:// en.wikipedia.org/wiki/Foxconn
Hon Hai Precision Industry Co., Ltd., trading as Foxconn Technology Group, is a multinational electronics contract manufacturing company headquartered in Tucheng, New Taipei, Taiwan.Foxconn is the world's largest contract electronics manufacturer and the fourth-largest information technology company by revenue. The company is the largest private employer in China and one of the largest …
History ·
International operations ·
Major customers ·
FIH Mobile ·
Controversies
.
Foxconn suicides - Wikipedia
https:// en.wikipedia.org/wiki/Foxconn_suicides
The Foxconn Suicides were a spate of suicides linked to low pay at the so-called "Foxconn City" industrial park in Shenzhen, China, that occurred alongside several additional suicides at various other Foxconn-owned locations and facilities in Mainland China. Within 2010, there were 18 attempted suicides by Foxconn (Chinese: 富士康) employees resulting in 14 deaths in the
Foxconn Wisconsin assembly work to generate millions in …
https:// www.jsonline.com/story/money/business/2017/12/01/foxconn…
Foxconn's Wisconsin operations are expected to employ 2,000 people and generate $1 billion in sales by 2019 - well before its Racine County factory is built.
Anonymous 05/03/18 (Thu) 14:35:29 652f05 No. 1285612
Apple has given a series order for 10 episodes of "Are You Sleeping," a drama series that will star Octavia Spencer, who is known for her work in movies that include "Hidden Figures," "The Help," "Gifted," and "The Shape of Water."
News of Apple's work on "Are You Sleeping" first surfaced in January, but now Variety says the company has decided to move forward with production on the show.
"Are You Sleeping" is based on a novel by Kathleen Barber, which has been described as a psychological thriller. The book focuses on a podcast that reopens a murder case, similar to the popular "Serial" podcast that led to a new trial for Adnan Syed, in jail for allegedly murdering a former girlfriend. Sarah Koenig, who created and produced "Serial," will consult on "Are You Sleeping."
The novel the TV show is based on explores how the reopening of the murder case impacts the victim's daughter and disrupts her life, and it's likely the TV show will follow a similar plot.
"Are You Sleeping" was written by Nichelle Tramble Spellman, and the series will be produced by Reese Witherspoon's Hello Sunshine and Chernin Entertainment/Endeavor Content.
Apple is also working with Reese Witherspoon's production company on an as of yet untitled "morning show drama" that takes a look into the cutthroat would of morning TV.
Apple now has more than a dozen television shows in the works, with a full list of what's on the horizon available in the original content section of our Apple TV roundup.
It's not yet known when the first of Apple's TV shows will debut nor how they'll be distributed, but rumors have suggested we could see the first fruits of Apple's efforts in 2019.
Anonymous 05/03/18 (Thu) 14:35:35 e02a8a No. 1285613
>>1285568
You missed the fact that CDAN is about Hollywood and the blind says that it was an A-list celeb. Most likely an actor or singer. And from the sound of it, if the murder happened in the USA, he was a foreign celeb.
Anonymous 05/03/18 (Thu) 14:35:51 ea20c3 No. 1285614
>>1285341
>>1285358
>>1285319
>>1285340
Very happy to finally find people who never makes mistakes. Be blessed and good luck out there.
Anonymous 05/03/18 (Thu) 14:35:54 c547e2 No. 1285615
>>1285528
Other than driving cats insane…
What do you use a laser pointer for??
Anonymous 05/03/18 (Thu) 14:36:05 bf6443 No. 1285616
>>1285454
that dinner meeting with trump and the SAP clients was excellent to see/hear.
"i know you, i know all about you"
priceless
Anonymous 05/03/18 (Thu) 14:36:05 e030f9 No. 1285617
>>1285339
a couple of months ago someone on twatter said there were coded messages in q's pics. I've tried to find it but have been unsuccessful.
Anonymous 05/03/18 (Thu) 14:36:08 8439f9 No. 1285618
>>1285584
im telling you now, after quite a bit of digging
i have came to the conclusion that what is on the
boxes on the pallets are:
Big Toes
there seams to be a huge shortage in China.
machete' accidents from cutting rice stalks.
Anonymous 05/03/18 (Thu) 14:36:12 51f512 No. 1285619
Some reverse psychology here.
A few from the Voter ID memes collection
to celebrate Court decisions allowing the obvious, the identification of citizens as legitimate voters.
Anonymous 05/03/18 (Thu) 14:36:30 ce3589 No. 1285620
>>1285593
So the 'big' info that was siezed, can be admitted into evidence if they bring a suit against the Prez. That's why they won't do it. Discovery.
Anonymous 05/03/18 (Thu) 14:36:53 024e28 No. 1285622
>>1285398
Wouldnt that be a twist, that the Disclosure files are actually bundled with the Baker Girls instead of the Q images?
My baker girl folder just got more interdasting
Anonymous 05/03/18 (Thu) 14:36:59 777edd No. 1285623
>>1285565
Agreed. And that is just the most kind way to explain him, in my opinion. He might be much worse than that.
Anonymous 05/03/18 (Thu) 14:37:01 e75123 No. 1285624
HOLY FUCKING SHIT
EVERY ANON ON THIS BOARD
Read about fucking John Jay McCloy
Seriously, never ever have I heard of him before.
He's the freaking financier of WW2! He was the concierge for the cruel financing of Hitler! He was sent by the Rockefellers and gave millions to Germans Nazi regime and also the dictatorship in Italy (Mussolini)
wikipedia.org/wiki/John_Jay_McCloy
Also notice today's Nazi post of Bloomberg:
https:// www.bloomberg.com/news/articles/2018-05-03/world-s-youngest-billionaires-are-shadowed-by-ghosts-of-german-past
Anonymous 05/03/18 (Thu) 14:37:04 e9a1fb No. 1285625
>>1285605
RR out
johnny flew out of
Ronald reagan airport
Anonymous 05/03/18 (Thu) 14:37:09 4afc22 No. 1285626
Anonymous 05/03/18 (Thu) 14:37:14 56a8a7 No. 1285627
>>1285606
https:// www.jetblue.com/airline-partners/
Maybe this is useful
Anonymous 05/03/18 (Thu) 14:37:59 45364b No. 1285628
>>1285212
TFVOS=
Semi-Supervised Video Object Segmentation (VOS) with Tensorflow.
https:// github.com/philferriere/tfvos
Anonymous 05/03/18 (Thu) 14:38:12 fb2108 No. 1285629
I linked this a few days ago, but everyone was arguing and it was missed.
But with Q’s posts last night and Fox article yesterday, take a look please. This is worth a deeper dig. Pics related.
This links to Iran as well.
http:// www.foxnews.com/politics/2018/05/02/pentagon-orders-stores-to-ban-certain-chinese-phones-amid-spying-concerns.html
https:// wikileaks.org/hackingteam/emails/emailid/597644
https:// www.wired.com/2012/07/fbi-zte/
Anonymous 05/03/18 (Thu) 14:38:22 56a8a7 No. 1285631
>>1285603
The original picture is getting a 404 so its not showing correctly. Let me try it again
Anonymous 05/03/18 (Thu) 14:38:28 b5ca00 No. 1285632
>>1285527
Brilliant find anon.
Anonymous 05/03/18 (Thu) 14:38:28 66a798 No. 1285633
>>1285430
>So..if the guy is not a friendly friend, he probably is into soemthing very BAD. his thing could very well be blackmailing POTUS.
Definitely bad.
Definitely into blackmail
Definitely NOT blackmailing potus
we talked about this back in Jan
the guy is connected to NSA (meaning that that is most likely his MAIN job)
He was the only American there
Potus brought him to tell all the CEOS at the table that he HAS IT ALL via SAP/NSA spying over the decades.
McDermott mentions infant mortality to say "we know about your involvement in trafficking" blah blah blah
Anonymous 05/03/18 (Thu) 14:38:37 903612 No. 1285634
Record exports cut US trade deficit to $49 billion https:// apnews.com/ea766935a9224d6fa59ecabbd780b70f/Record-exports-cut-US-trade-deficit-to-$49-billion?utm_campaign=SocialFlow&utm_source=Twitter&utm_medium=APBusiness
Anonymous 05/03/18 (Thu) 14:39:03 256a57 No. 1285635
>>1285550
>Bunker Apple Yellow Sky
BAYS is the abbreviation for the county, where the attempted Roth extraction failed.
Nothing to do with apple company.
Anonymous 05/03/18 (Thu) 14:39:18 e0da34 No. 1285638
>>1285122
>>1285401
Oops! Did not intend to black out that first line.
Anonymous 05/03/18 (Thu) 14:39:21 95d451 No. 1285639
in case you missed this yesterday
Anonymous 05/03/18 (Thu) 14:39:46 1fc88c No. 1285641
Anonymous 05/03/18 (Thu) 14:40:15 70e6f0 No. 1285642
>>1285606
The JetBlue plane was just flying alongside Q's plane as Q took two location photos. The crumb was Q's location. Don't go nuts over JetBlue. Consider where Q was, and when, and why.
Anonymous 05/03/18 (Thu) 14:40:42 b06664 No. 1285644
>>1285610
Here to serve.
Please append
>>1285605
>>1285625
Whoever is posting the marker shit, keep the post numbers grouped. I'm over here picking up your toys.
Anonymous 05/03/18 (Thu) 14:40:49 aee2d4 No. 1285645
>>1285640
THANK GOD SOMEBODY CAUGHT IT!!
I was beginning to think I was the only one who got it!
Anonymous 05/03/18 (Thu) 14:40:53 ee7c64 No. 1285646
>>1285600
>When you load a truck, you put the heavier stuff over the axles, you have to distribute the load correctly when you load the trailer.
You are correct unless there are only three (or even 5) pallets. The loading above the goose neck is not only normal but necessary to install the load lockers to prevent movement back and forth..
Anonymous 05/03/18 (Thu) 14:40:56 024e28 No. 1285648
>>1285448
last I had was the number 4 discussion, pic related
Anonymous 05/03/18 (Thu) 14:41:15 d2eede No. 1285649
>>1285615
They are used to designate targets or direct fire in the military.
Anonymous 05/03/18 (Thu) 14:41:15 aee2d4 No. 1285650
Anonymous 05/03/18 (Thu) 14:41:19 78be58 No. 1285651
>>1285637
Have we figured out where this airport is yet?
Anonymous 05/03/18 (Thu) 14:41:20 5cda55 No. 1285652
>>1285368
This makes believing into aliens a piece of cake.
And I don't find this hard to believe either.
Anonymous 05/03/18 (Thu) 14:41:32 6054bc No. 1285653
>>1285642
If Jetblue isnt relevant, why did Q take 2 pictures of a plane flying? Unless it was relevant to Apple headquarters in china
Anonymous 05/03/18 (Thu) 14:42:04 e4034a No. 1285654
Have we reached a consensus on what "think google [new pixel phone]" and "think apple [vs. Samsung]" means yet?
Anonymous 05/03/18 (Thu) 14:42:04 56cf64 No. 1285655
A tweaked version of the pallet pic, it almost appears maybe the number 10 written on the left pallet. The pallet on the right also appears to maybe have a frame, if you look at the vertical line meeting with the horizontal lines - maybe a server enclosure?
Anonymous 05/03/18 (Thu) 14:42:06 1b8f68 No. 1285656
>>1285448
Rubber bullet Baton theory for your consideration, still playing catch up so not sure about your inquiry
>>1285531
Anonymous 05/03/18 (Thu) 14:42:17 652f05 No. 1285657
Anonymous 05/03/18 (Thu) 14:42:39 401a68 No. 1285658
>>1285568
>>1285590
Forbes list, MSNBC, etc…yes, a celebrity.
>>1285613
Not just about Hollywood, anon. (pic related)
http:// www.crazydaysandnights.net/search?q=beatrice&max-results=8
Anonymous 05/03/18 (Thu) 14:42:55 b97d2d No. 1285659
>>1285480
They be trying to catch him riding dirty but have come up bupkas on Russian collusion, Stormy etc…
Anonymous 05/03/18 (Thu) 14:42:58 ae410e No. 1285660
>>1285624
> John Jay McCloy
He's a bad one alright. He was deep state before deep state was cool.
Anonymous 05/03/18 (Thu) 14:43:09 aee2d4 No. 1285662
Anonymous 05/03/18 (Thu) 14:43:09 a87a8c No. 1285663
>>1285602
>campaign contributions, played no roll in this transaction.
see what he did here? roll not role
typo = rick roll
= bait and switch
coincidence?
NOT
potus is so funny!
Anonymous 05/03/18 (Thu) 14:44:04 681455 No. 1285664
>>1285437
Any new updates?
Anonymous 05/03/18 (Thu) 14:44:06 cfd191 No. 1285665
>>1285430
Jokes aside, SAP is in the same big date & AI business as amazon, google et el. I attending a SAP presentation a couple of years ago about a project in San Palo Brazil where HANA is connected to a live data feeds from 1000's of security cameras across the city. Based on facial and license place recognition and travel patters of everyone, they claimed the system could quickly identify suspects when crimes happened and could also predict who was GOING TO commit a crime. The predictions where supposedly filtered out to the cops on the street to look for and watch the pre-crime suspects.
Anonymous 05/03/18 (Thu) 14:44:22 45364b No. 1285667
F-35 P - F-35 plane
Lockheed Martin F-35
https:// en.wikipedia.org/wiki/Lockheed_Martin_F-35_Lightning_II_development
Anonymous 05/03/18 (Thu) 14:44:30 556a87 No. 1285668
>>1285585
I cant vouch for wether this is a common format .. but it is used in Microsoft Sharepoint's databases.
8-4-4-4-12
Anonymous 05/03/18 (Thu) 14:44:52 e4034a No. 1285669
>>1285655
Corner protection for boxes maybe?
Anonymous 05/03/18 (Thu) 14:45:09 a87a8c No. 1285671
>>1285602
see what else potus did here?
he denied the stormy settlement
msm now claims he lied
seems obvious
but the settlement was not stormy so he did not lie
stable genius
Anonymous 05/03/18 (Thu) 14:45:21 e030f9 No. 1285672
>>1285339
finally found the tweet
Anonymous 05/03/18 (Thu) 14:45:27 4fdadb No. 1285673
>>1285663
Mandatory if you say Rick Roll
Anonymous 05/03/18 (Thu) 14:45:29 70e6f0 No. 1285674
>>1285653
>>1285653
As stated, the photo shows Q was at a location. The location has been identified as the San Jose area, the home of Apple. Did Q visit Apple HQ? When and why?
Anonymous 05/03/18 (Thu) 14:45:39 49bf86 No. 1285675
>>1285668
Lord help them if they store the evidence on Sharepoint.
Anonymous 05/03/18 (Thu) 14:45:40 56cf64 No. 1285676
>>1285666
Evil Trips - Evil Toe!
Anonymous 05/03/18 (Thu) 14:45:46 1091ad No. 1285677
>>1285614
Yeah but to keep making the $ame mi$take over and over and over?
Anonymous 05/03/18 (Thu) 14:45:54 e75123 No. 1285678
>>1285624
>>1285660
He was 2nd President of World Bank after founder Eugene Meyer failed to establish the Bank at Wallstreet.
His work between 49 and 52 as high commisioner in Germany is also hard to believe.
Mind blown by this guy.
Anonymous 05/03/18 (Thu) 14:45:54 556b89 No. 1285679
>>1285652
Interdasting pics caught the other day here.
Anonymous 05/03/18 (Thu) 14:46:01 d921a4 No. 1285680
>>1284552
that's high autism anon. Q crumb above + new @realDonaldTrump banner related?
>>1284638
brilliant idea…from Pentagon to hex-a-decimal gon. love it.
>>1285572
>last pic related?
ICYMI, also related & educational: FEBRUARY 27, 2018
Fiscal Year 2019 Cyber Command Budget Request
Admiral Michael Rogers note missing 's' on c-span.org is director of the National Security Agency and the head of U.S. Cyber Command, which runs the military’s computer network defenses.
>https:// www.c-span.org/video/?441677-1/nsa-chief-testifies-fiscal-year-2019-budget
Anonymous 05/03/18 (Thu) 14:46:03 af1df9 No. 1285681
>>1285629
BAKER pls ADD
THINK THAT'S A DEVELOPING NOTEABLE
Anonymous 05/03/18 (Thu) 14:46:05 b5ca00 No. 1285682
>>1285527
Anons,
Found another connection
Marker and corresponding Q post.
Anonymous 05/03/18 (Thu) 14:46:24 868884 No. 1285685
Manafort Lawyers Claim Leaky Mueller Probe Has Provided No Evidence Of Contacts With Russian Officials
thefederalist.com/2018/05/03/manafort-lawyers-claim-leaky-mueller-probe-has-provided-no-evidence-of-contacts-with-russian-officials/
The alleged lack of evidence would be in sharp contrast to the repeated leaks from anonymous
but highly placed government officials that led to the appointment of a special counsel.
The special counsel’s office says it has no evidence in its possession responsive to Manafort’s
request for transcripts, notes, or tapes of any and all conversation or contacts between Russian
intelligence or government officials and Manafort, according to the filing.
Anonymous 05/03/18 (Thu) 14:46:31 2b2eb8 No. 1285686
Anonymous 05/03/18 (Thu) 14:46:39 a17901 No. 1285687
>>1285655
Is it a hand truck on top.
Anonymous 05/03/18 (Thu) 14:46:45 eeed56 No. 1285688
Anonymous 05/03/18 (Thu) 14:46:47 4afc22 No. 1285689
>>1285674
Hints:
POTUS tweet caps: SJC FBI BAD
Investigation report
https:// oig.justice.gov/reports/2018/o20180413.pdf
Anonymous 05/03/18 (Thu) 14:46:55 b06664 No. 1285690
>>1285658
>>1285613
THIS. Many other examples.
Anonymous 05/03/18 (Thu) 14:47:08 995176 No. 1285692
Anonymous 05/03/18 (Thu) 14:47:10 607f0b No. 1285693
>>1285312
There's a lot of talk of heavy water in Iran deal. It's required that they ship it out of Iran I believe to countries on the deal
Anonymous 05/03/18 (Thu) 14:47:11 01422e No. 1285694
Reading couple past breads. Regarding random info drops after first pics i.e. Qf35 or whatever. I remember Q saying something to the effect of his info drops are not only for us anons. And since then, Q has told us repeatedly that the whole world is watching. Perhaps someone is trying to setup comms with a close by F35 strike fighter? Just the vibe I got from Qf35 drop.
Anonymous 05/03/18 (Thu) 14:47:24 4c71c2 No. 1285695
Anonymous 05/03/18 (Thu) 14:47:41 8439f9 No. 1285696
>>1285683
lmao, thats great!
Anonymous 05/03/18 (Thu) 14:47:53 f5ed6b No. 1285697
>>1285210
it could be gold. other precious metals. anything of extreme value in the physical form.
Anonymous 05/03/18 (Thu) 14:48:00 e3c319 No. 1285699
>>1285666
that's a long ass BIG TOE anon
Anonymous 05/03/18 (Thu) 14:48:17 5479dd No. 1285700
Anonymous 05/03/18 (Thu) 14:48:22 e02a8a No. 1285702
>>1285368
This would fit with what we know about the reefer. But where did the stuff come from?
Anonymous 05/03/18 (Thu) 14:48:58 a87a8c No. 1285703
>>1285645
for those who didnt…
Anonymous 05/03/18 (Thu) 14:49:13 f31949 No. 1285704
>>1282527
I GOOGLED HOW TO WIND A CLOCK
"To wind the clock simply place the key, or crank, into the winding point and turn clockwise sixteen revolutions. When the clock is fully wound an internal mechanism will prevent you from winding any further"
Anonymous 05/03/18 (Thu) 14:49:14 607f0b No. 1285705
Anonymous 05/03/18 (Thu) 14:49:15 a04ceb No. 1285706
>>1285558
been trying to say this myself but after 3 times being called an idiot,shill,clown I gave up. Morningstar payments confirms this was what was meant
Anonymous 05/03/18 (Thu) 14:49:18 a9a4d7 No. 1285707
>>1284721 THE ANTI Christ MUST BE REVEALED FIRST!
>>1284682
AND DRINK STARBUCKS. WHAT IS IN THE COFFEE?
Anonymous 05/03/18 (Thu) 14:49:19 556a87 No. 1285708
>>1285675
Turns out that the 8-4-4-4-12 is a completely standard thing …. a UUID …
https:// en.wikipedia.org/wiki/Universally_unique_identifier
In its canonical textual representation, the sixteen octets of a UUID are represented as 32 hexadecimal (base 16) digits, displayed in five groups separated by hyphens, in the form 8-4-4-4-12 for a total of 36 characters (32 alphanumeric characters and four hyphens). For example:
123e4567-e89b-12d3-a456-426655440000
xxxxxxxx-xxxx-Mxxx-Nxxx-xxxxxxxxxxxx
The four bits of digit M indicate the UUID version, and the one to three most significant bits of digit N indicate the UUID variant. In the example, M is 1 and N is a (10xx), meaning that the UUID is a variant 1, version 1 UUID; that is, a time-based DCE/RFC 4122 UUID.
The canonical 8-4-4-4-12 format string is based on the "record layout" for the 16 bytes of the UUID
Anonymous 05/03/18 (Thu) 14:49:36 648f53 No. 1285709
>>1285398
When the cat herding gets out of hand, break out the laser pointer. Autists love the point of light if you move it fast enough. Keeps 'em occupied when they get restless.
Anonymous 05/03/18 (Thu) 14:49:49 f5ed6b No. 1285711
>>1285212
does this bother anyone else?
the word is awakened.
I notice no one uses it, even broadcasters, who are suppose to speak the english language.
Anonymous 05/03/18 (Thu) 14:49:54 e49e9d No. 1285712
I have a feeling that something big is about to happen. It wpuld be smart to drop the cohen payment bombshell rigjt before anothet huge bombshell that will take the attention off cohen.
Im expecting something to drop soon.
Anonymous 05/03/18 (Thu) 14:49:55 edc754 No. 1285713
>>1285655
It looks they used thin metal bands (I don't know the actual name for it) to hold the boxes together, then shrinkwarpped over it. That would be my explanation for the vertical lines.
I don't think it is a server frame, both pallets look like they're made up of multiple smaller boxes.
Whoever packaged them went out of their way to make sure they would be secure.
Anonymous 05/03/18 (Thu) 14:50:07 4afc22 No. 1285714
http:// www.keystone-engine.org/
Anonymous 05/03/18 (Thu) 14:50:13 27e345 No. 1285715
>>1285563
Same mind virus.
Anonymous 05/03/18 (Thu) 14:50:20 bac19f No. 1285716
Shot is the dark as to what is on those pallets.
Rigged Voter Booths or equipment
Anonymous 05/03/18 (Thu) 14:50:33 8439f9 No. 1285717
>>1285699
a longggggg (_v_) toe
Anonymous 05/03/18 (Thu) 14:50:57 ae410e No. 1285719
>>1285642
>Consider where Q was, and when, and why.
I wonder if EM's meltdown was related.
https:// www.zerohedge.com/news/2018-05-02/musk-meltdown-tesla-tumbles-after-elon-cuts-conference-call-question
Anonymous 05/03/18 (Thu) 14:51:03 b97d2d No. 1285720
>>1285574
Ok but please don.'t make the insane leap of faith required & devolve into FLATTARDERY the ridiculous psyop that (((they))) try to use to discredit all "conspiracy theories" with since around 2015.
Anonymous 05/03/18 (Thu) 14:51:10 51783e No. 1285721
>>1285712
I agree. RG threw out more bait to the media last night so something is going on behind the scenes.
Anonymous 05/03/18 (Thu) 14:51:13 edc754 No. 1285722
>>1285713
My bad, pic unrelated. It was still on my clipboard
Anonymous 05/03/18 (Thu) 14:51:19 f5ed6b No. 1285723
>>1285716
use it now, for God's sake!
Anonymous 05/03/18 (Thu) 14:51:17 d0fd8f No. 1285724
How Tim Cook Will 'Double Down' On Apple Secrecy: An Underground Bunker
Anonymous 05/03/18 (Thu) 14:51:29 4c71c2 No. 1285725
Anonymous 05/03/18 (Thu) 14:51:37 e97ff9 No. 1285726
>>1285412 (me)
>>1285422
>>1285464
FUCKING HELL ANONS
I think I found it.
Check out this source, got KICKED offline as soon as I found it (#coincidence)
IRIS SCANS are used to scan for AIDS, CANCER, HEREDETORY diseases and a whole bunch of other stuff.
Did you know that??? I sure as fuck don't!
So why don't they scan us huh?? no one has to "find out too late".
http:// smallbusiness.chron.com/dangers-retinal-scanners-70631.html
SO Adreno + chrome + iris scan + your location + your metadata => they can look for PERFECT healthy yummy specimens, and I have NO DOUBT (guessing here) that 5g or other nasty frequency shit makes (young) people produce moar adrenochrome.
That's why there all going ape shit and triggered into clubbing someone over the head for wearing "the wrong prom dress.
Anonymous 05/03/18 (Thu) 14:51:43 5479dd No. 1285727
>>1285648
Q POSTS PHOTO ID
B3D12FDF-7189-4836-AD41-F4
DB0379CC-9229-43B5-AD54-F4
EB072EBC-0DF3-4A2C-BE89-E3
8466691D-0F75-44F5-AA92-43
39E6E8ED-2D45-4AB9-A4EA-68
901FFF2C-CFFC-4586-8226-7
9E1AB60E-071C-4226-ADEC-B
9E1AB60E-071C-4226-ADEC-B
95DDEF59-7086-4535-985D-5
0568570F-2EA7-4162-A75F-4E
A3589E21-85D1-4056-9DC7-5
703C92E0-E064-4400-932F-2
83139841-57B9-47B5-8FA6-D
AA00D4A7-BF25-44EC-BB62-4
BC185452-3F1B-493B-98D9-92
EFABC59D-40D3-4570-81E3-5
C8F91EAD-51C7-47FA-96C5-C
72C68DD2-F512-4DC8-ADA8-E
CAFB8AB7-539E-4AFB-9EC0-E
CC1B1FD7-8B70-4CEB-A4F7-F5
89F919D3-5900-4DCA-BA1B-DB
25666BD0-F5F9-4A63-AE62-4A
C13A8327-8986-4D5E-AC6B-EC
EA29DD13-F16F-4580-9DC8-0D
8B01A899-533A-4231-8BAF-6
763B79E9-EA56-4EBD-A42A-2
EF3D1B1B-2E68-4FD4-814F-E
B42CA278-6C32-4618-A856-0
D6C46F7A-C7B1-4A32-9576-E28854C1C1DC
F0704A26-CA59-40E8-9285-5
ABD8260F-EBBB-4C18-A9AE-8
13372080-45DC-4E32-B340-3
31506F85-476A-4DD6-BDF4-56
C879615C-3616-402C-B3F6-81
FC8DF5A5-6BB2-4A87-90BF-B4
CBFE279C-FAD2-403C-A11C-E
683C2B19-0FF1-4C01-B33B-3C
32AD9484-F41A-4806-AD48-6C
18454392-100A-4B49-A774-67
784A60C6-B1C0-4DCE-ACE1-A9
BF865568-AABA-4354-A7C6-18
18A539B4-3085-4E11-8945-D
B1ADF2C9-65EF-42CB-A3D8-8B
7F0F82A1-151F-4868-96EE-054CE9876425
7803B61A-1F3E-47BD-88D4-F
DEA28E7A-5339-4D0B-A991-AB
482D19E4-6664-478F-8836-30
3155B65F-063D-445E-A3BD-5
2C880EB2-FFFC-4E95-B22C-B
5D00DA74-A956-474C-A7A1-5
8BF7AC13-C658-41A6-A0E3-8
54950FD4-115E-404E-B1DF-4
A783B991-11D9-40D0-BD69-1
710102CD-50EE-4035-93E4-6
E349DAAB-AEE3-45EF-B056-2
C2C6E563-AEEE-46D4-95F9-0
9AB57841-1F3F-4630-889B-4
77C6EF7B-C1F0-49A6-BD1E-C
29ABE882-37B0-472A-A79E-F
9B7BDECB-79FD-4D3C-BE97-A
BA1C5CD5-5C3B-4FE5-93B1-F
540296AD-9205-4253-B4CF-B
25346004-2104-4DBA-9B88-E9
B6C47FD8-1F66-4549-8A4B-2
0704911B-FBA8-4DE7-9C53-9
03821C90-07E4-4906-B30D-A
6AECCB3F-2186-4C21-9749-06
C7248201-F913-4F0C-A667-9
Exec_y.png
c7829.jpg
DUGtJVsU8AElqAt.jpg-large.jpg
Unknown.jpg
switzerland-davos-forumjpe….jpg
alkd839.jpg
6a0120a610bec4970c0162fc20
kT4H8Kfh.jpg
soros-and-rothschild.jpg
rothschilddavidwjcyfranc.jpg
QFF.jpg
RTM.png
learn-some-history-13th-am
Unknown.jpg
Unknown.jpg
WDSHN_ISIS_TRAITOR_NN.jpg
Clown_Comm_Narrative.png
FREEDOM_.png
NSA_Traf_CAM_LONDON2847.png
Just_Waiting.png
Anonymous 05/03/18 (Thu) 14:51:48 670731 No. 1285728
>>1285210
Dedicated shipments are common. The truck doesn’t have to be full. These guys are rich and don’t want to intermingle their load with another. Likely high value or sensitive.
Anonymous 05/03/18 (Thu) 14:51:51 7f2232 No. 1285729
>>1285718
He's right.
They did it right out in the open
Anonymous 05/03/18 (Thu) 14:51:57 a17901 No. 1285730
JetBlue has the Caribbean covered.
Anonymous 05/03/18 (Thu) 14:52:03 1363fc No. 1285731
>>1285229
file size not equal to res. photoshop datasnip. layers? orig image - black layer - low res crumb plane pic?
Anonymous 05/03/18 (Thu) 14:52:23 903612 No. 1285732
“Eric Bolling, one of the most influential and successful conservative media figures, is joining CRTV, announced CRTV president Gaston Mooney,” a press release from Conservative Review reads."
http:// dailycaller.com/2018/05/03/eric-bolling-new-show/
Anonymous 05/03/18 (Thu) 14:52:23 b50eb2 No. 1285733
>>1285666
Ugly-ass toes…..cover that up!
Anonymous 05/03/18 (Thu) 14:52:34 e97ff9 No. 1285735
>>1285726
QUOTE FROM WEBSITE
>Health Risks
Retinal scans are often used in health scanning procedures – to identify communicable diseases including AIDS, chicken pox and malaria – and to scan for hereditary diseases including various types of cancers. The scan itself poses no threat to the eye or to your overall health, though users of retinal scans complain of discomfort from the technology as they must lean in and keep their eye close to the machine for 30 seconds in order for a scan to be accurate.
Anonymous 05/03/18 (Thu) 14:52:37 10216b No. 1285736
>>1285311
C-130 looks like remotely controlled. Normal descent, then suddenly dives and corkscrews into the ground.
9/11 airplanes into WTC seemed remotely controlled. One 747 captain said he couldn't turn a 757 or 767, whatever it was, as tightly as one turned going into one of the towers.
This control can be accomplished thru the Flight Management System, locking out the cockpit and flying thru the FMS. I read some posts saying that tech. had indeed been developed. Heavy jets all have FMS and have for years. Smaller ones like 737 I am not sure.
C130 crash happened right after Trump blamed Iran for 9/11 by demanding repayment from them. Was the C130 crash Iran spitting at him because of this?
Anonymous 05/03/18 (Thu) 14:52:48 345feb No. 1285737
>>1285646
Yup. Also, the second pallet back on the right seems to be of a different height, suggesting that the boxes are of a different size possibly indicating a different product than the other pallets. No idea if that even matters though.
Anonymous 05/03/18 (Thu) 14:53:21 164379 No. 1285738
Can someone please tell Q that when taking photo shots to please go widescreen, so we can actually make out what he's posting?
Anonymous 05/03/18 (Thu) 14:53:24 705406 No. 1285740
>>1285534
It's not. This faggot has 20 other posts about random horseshit in this bread.
Anonymous 05/03/18 (Thu) 14:53:27 f5ed6b No. 1285742
>>1285719
Q wasn't there. a trusted person, watching the area was there. But the Q team, I doubt. that's what operatives are for.
Anonymous 05/03/18 (Thu) 14:53:36 fb2108 No. 1285743
>>1285629
Add this to it. 2012 seems significant here. Iran, China, Hong Kong all related.
Secret Pallets of cash flown? Or maybe spy equipment sent it’s refrigerated.
Anonymous 05/03/18 (Thu) 14:53:38 b97d2d No. 1285744
>>1285583
e for Eric Schmidt?
e for Edward Snowden?
Anonymous 05/03/18 (Thu) 14:53:45 8439f9 No. 1285745
Anonymous 05/03/18 (Thu) 14:54:07 b40f65 No. 1285746
>>1285631
Excellent! Any more like this that you have discovered?
Anonymous 05/03/18 (Thu) 14:54:09 3cc9e0 No. 1285747
Anonymous 05/03/18 (Thu) 14:54:16 edbee9 No. 1285748
>>1285325
All the other pallets were in front of those. They were the last one's to come off.
And who says that pallets with boxes full of money can't be lifted? I saw that comment previously on here from someone else.
Anyone whose ever operated a fork truck will tell you that merely taking some weight of the pallet off the floor allows you to slowly drag/slide the pallet out if need be.
Does anyone really think that whomever went to this amount of trouble didn't think through how they would unload or distribute boxes full of cash?
Assuming it is cash, of course.
Anonymous 05/03/18 (Thu) 14:54:17 777edd No. 1285749
>>1285701
Love our SHS - Warrior Princess of Press Secretaries !!!!
Anonymous 05/03/18 (Thu) 14:54:24 21c811 No. 1285750
GERMANARCHIVEANAON UPDATE
I added #1593 to #1610 to the folder, and updated the checksums.
mega.nz/#F!LPZxEIYJ!N5JwCNoxOxOtAoErKdUgvw
1593-1610.zip MD5: 19e1afbe9ed6f8df09f1fdd7329b8d82
The archive now contains 1616 breads.
The ZIPs contain .webarchive files as usual. So these files are still SAFARI ONLY.
GERMANARCHIVEANON OUT
Anonymous 05/03/18 (Thu) 14:54:32 5cda55 No. 1285751
>>1285212
BIG POST.
SSP = Secret Space Program.
My fav secret space programs is pleiadians <3
Anonymous 05/03/18 (Thu) 14:54:52 a87a8c No. 1285753
>>1285704
so any links to the number 16 in crumbs?
Anonymous 05/03/18 (Thu) 14:54:54 d921a4 No. 1285754
>>1285587 >1285608
>>1285556 <Agree.
Anonymous 05/03/18 (Thu) 14:55:26 e4dcc6 No. 1285756
That’s according to Apple Insider, which today posted a number of photos taken outside the 70,000 square-foot building, reportedly referred to by employees as “Athena.” Shipments of equipment, wrapped in anti-static foil and labeled “delicate instruments,” have become routine at the facility in the months since Apple acquired it.
This activity suggests that Apple plans to put the facility to work, but for what is far from certain. Apple designs the processors in its mobile devices, but it contracts the actual manufacturing out to Taiwan Semiconductor Manufacturing Company and Samsung.
https:// www.digitaltrends.com/apple/apple-fabrication-building-san-jose-california/
Exclusive: Apple's top secret 'Athena' chip fab gets new 'delicate equipment'
https:// iphone.appleinsider.com/articles/16/04/29/exclusive-apples-top-secret-athena-chip-fab-gets-new-delicate-equipment
Anonymous 05/03/18 (Thu) 14:55:52 db24bd No. 1285757
Could this be a possibility?
Just found this article regarding a large fentanyl shipment from China:
Mar 28, 2018 3:29 pm ET
Men Shipped Fentanyl, Carfentanil From China To Montco Homes: DA
Breaking: The pair shipped massive quantities of the lethal drugs from China directly to doorsteps of Montgomery County homes, the DA said.
https:// patch.com/pennsylvania/norristown/men-shipped-fentanyl-carfentanil-china-montco-homes-da
Anonymous 05/03/18 (Thu) 14:55:53 b97d2d No. 1285758
>>1285620
e for inadmissible "e"vidence?
Anonymous 05/03/18 (Thu) 14:56:00 a9a4d7 No. 1285759
>>1282527
Wind a clock 16 times is that the 16 year plan, is the key a number of a man, who is the anti Christ? 666 Is this Hillary's handler? Is he more evil than Soros? And is 17 Q the new plan?
Anonymous 05/03/18 (Thu) 14:56:01 ae410e No. 1285760
>>1285655
>The pallet on the right also appears to maybe have a frame
Why don't the pallets have holes for the forklift? Are they on roller pallets for an air drop?
t. teamster
Anonymous 05/03/18 (Thu) 14:56:08 56a8a7 No. 1285761
>>1285746
Unfortunately not, another anon made that a few weeks back and I happened to save it – thankfully because it was 404'd for some reason.
Definitely an area to dig on though
Anonymous 05/03/18 (Thu) 14:56:36 868884 No. 1285762
Rubio walks back criticism of GOP tax law
www.politico.com/story/2018/05/02/marco-rubio-tax-law-response-565586
Anonymous 05/03/18 (Thu) 14:57:11 c0a23d No. 1285763
>>1285728
The picks look like they may be server racks. Or, maybe, storage racks with tons of drives. Could be moving a lot of currency in the form of crypto contained within.
Maybe. Refrigerator truck would make sense, you would want to keep the equipment cool, even when powered off, to make damn sure no data is lost.
Anonymous 05/03/18 (Thu) 14:57:32 f5ed6b No. 1285765
>>1285380
filter this obvious shill
Anonymous 05/03/18 (Thu) 14:57:46 c33a3e No. 1285766
bakers
>>1285750 GERMANARCHIVEANAON UPDATE
to replace
>>1285137 Threads & Research Section
>>1245678 Germanarchiveanon
>>1285750 Germanarchiveanon
ohalso
>>945864 EMINEM THREAD
fell off the board
Anonymous 05/03/18 (Thu) 14:57:51 9668b6 No. 1285767
>>1285579
from the maybe-q post:
(LEARN O.C.)
Anonymous 05/03/18 (Thu) 14:57:57 4c71c2 No. 1285768
>>1285752
I would say who ever said san Jose was correct.
Anonymous 05/03/18 (Thu) 14:58:05 51783e No. 1285769
>>1285752
My initial thought when I first saw it last night was that it was somewhere in Asia. But at SFO you do fly over the Pacific right before landing.
Anonymous 05/03/18 (Thu) 14:58:05 4f5c64 No. 1285770
>>1285255
Just come back to the thread so not 100% sure what this is about. However, Mark Thompson covered up the Jimmy Savile affair at the BBC. He blocked a documentary that was going to out Savile as a Pedo. Then he escaped the country with a parachute job at the New York Times I think.
https:// www.telegraph.co.uk/news/uknews/crime/jimmy-savile/10512203/Former-BBC-boss-Mark-Thompson-lied-over-Savile-evidence-Nick-Pollard-claims.html
https:// www.theguardian.com/media/2012/oct/16/new-york-times-mark-thompson-jimmy-savile-bbc
Anonymous 05/03/18 (Thu) 14:58:11 f252d9 No. 1285771
>>1280036
>>1280616
Any link between Apple and plane Q circles over Hagerstown,"The Hub" shipping center?
Anonymous 05/03/18 (Thu) 14:58:34 edc754 No. 1285772
>>1285760
There are traditional slots for a forklift to pick them up. He changed the original image to try to catch anything that couldn't be seen in the original.
Anonymous 05/03/18 (Thu) 14:58:44 777edd No. 1285773
>>1285685
“Accordingly, if the representations of the Special Counsel are accurate, and there is not, in fact, any evidence of communications between Mr. Manafort and foreign officials, then the perpetrators of this elaborate hoax must be identified and punished and the substantial unfair prejudice to Mr. Manafort must be remedied,” the filing continued.
Interesting article, ty anon !!!!
Anonymous 05/03/18 (Thu) 14:59:03 4c53f3 No. 1285775
>>1285736
Keep in mind this C130 was VERY old, and was on its last flight to AMARG in New Mexico for mothballing. In fact it was probably one of the least-automated C130s flying today so any sort of hacking of the FMS is less than likely. Most likely reasons IMHO: Broken control linkage, shifted CG, loss of hydraulics, rudder actuator failure, flaps set incorrectly.
Anonymous 05/03/18 (Thu) 14:59:08 6610aa No. 1285776
>>1285134
>>1285012
As I have repeatedly pointed on on Boards & SM,…….
The Pacer dot gov records are Sealed, so IMPOSSIBLE to know which are actually INDICTMENTS.
But keep following. . . . the numbers here are staggering & obviously atypical.
This is real.
Here's an amended one to reflect the RECORD.
TY for the attorneys & Anons behind the scenes working to tabulate on their own time…. & paying Pacer for the counts. YOU are patriots.
Winning will be Glorious!
#WWG1WGA indeed.
https://
www.pacer.gov/
Anonymous 05/03/18 (Thu) 14:59:35 5cda55 No. 1285777
>>1285755
>muh aliens
Have they ever mentioned Pleiadians? Do you know what Pleiadians are? And how you can get in contact with them? All you can hear is
>muh distraction
>muh unexplained
>muh man made
>muh threat to national security
Secrets, fear mongering, PARTIAL disclosure.
We are in for a FULL DISCLOSURE.
Anonymous 05/03/18 (Thu) 14:59:40 f31949 No. 1285778
>>1285753
There are only two.
This one:
[The 16 Year Plan To Destroy America]
And this one:
How bad is the corruption?
FBI (past/present)
#1
#1
#2
+29 (16)
DOJ (past/present)
#1
#1
#2
+18
STATE (past/present)
#1
#1
+41
I think with the markers we make like a clock and use a key in the middle and turn it 16 times?
Anonymous 05/03/18 (Thu) 15:00:01 09b419 No. 1285779
Wonder who the major individual owners are of JetBlue?
http:// investors.morningstar.com/ownership/shareholders-major.html?t=JBLU
Anonymous 05/03/18 (Thu) 15:00:01 e02a8a No. 1285780
>>1285769
No you don't. You've obviously never been to SFO
Anonymous 05/03/18 (Thu) 15:00:05 4d145e No. 1285782
>>120030 Embedded in pic data - looks to be programming
http:// www.w3.org/TR/rdf-plain-literal/
Anonymous 05/03/18 (Thu) 15:00:15 074f90 No. 1285783
>>1285567
Haven't they heard, "crime don't pay"?
Anonymous 05/03/18 (Thu) 15:00:20 d8fe21 No. 1285784
>>1285655
You guys are overthinking this.
Anonymous 05/03/18 (Thu) 15:00:20 3cc9e0 No. 1285785
Salisbury-gate smoking gun found? Initial reports said Skripals poisoned with Fentanyl
Nick Griffin
Sott.net
Tue, 01 May 2018 20:00 U
Anonymous 05/03/18 (Thu) 15:00:26 cfd191 No. 1285786
>>1285726
This company uses facial pictures to identify genetic disorders. It used as part of the screening process at medical centers. They claim its very effective.
https:// www.fdna.com/
Anonymous 05/03/18 (Thu) 15:00:40 188591 No. 1285788
money (laundering) beauty industries >> feminine occult symbols
these people seem interested in DNA (every product has some sort of double helix like promo graphic)
american society for aesthetic plastic surgury inc == Nefertiti (conehead - king lineage? - vanity)
award statues for the beauty industry = gold female with wings "goddess"
Anti-Aging & Beauty Trophy
1st BIOPTRON (redcross insignia)
2nd mesoestetic
3rd Teoxane Laboratories +(redcross insignia) (RHA-4)
4th …..{lost interest}
(swiss) & all that but that, i know
but crosses stood out seems like an Lynn [LdR] & Red cross sorta thing,
might need a beautyfag? don't know the industry
could be nothing but i'll nick a bit of bread incase anyone else is on the beauty industry
Anonymous 05/03/18 (Thu) 15:00:50 72e318 No. 1285789
>>1285764
Date and time of posting???
Anonymous 05/03/18 (Thu) 15:00:56 f9f1ca No. 1285790
>>1285238
That Hillary email is one of the "From Hillary To Hillary"… where they were probably all just using "drafts" without sending, THINKING they couldn't be surveilled/captured. But Q said THEY HAVE IT ALL… INDEED THEY DO!! oh Hillary and Cheryl Mills, not as smart as you think you are!
Anonymous 05/03/18 (Thu) 15:01:09 30bab8 No. 1285791
Maybe Q is showing us the extent of technology that is available. Were those pictures captured off of other people's phones. Perhaps even different phones. JetBlue has integrated apple wallet check-ins. Apple has given it all up. Think of Eagle Eye and Empire of the State. With geospatial information and root device access, "he has it all".
Want to see a story of shipping Apple products to HK? Now you have and from multiple perspectives.
Q has given us a demo and he could be on the east coast for all we know!
Anonymous 05/03/18 (Thu) 15:01:24 3cc9e0 No. 1285792
>>1285785
https
://www.sott.net/article/384462-Salisbury-gate-smoking-gun-found-Initial-reports-said-Skripals-poisoned-with-Fentanyl#
Anonymous 05/03/18 (Thu) 15:01:30 a87a8c No. 1285793
>>1285778
number games are not in my wheelhouse anon
i wish i could help
Anonymous 05/03/18 (Thu) 15:01:36 8439f9 No. 1285795
>>1285789
was just on my fox page so now
Anonymous 05/03/18 (Thu) 15:01:46 51783e No. 1285796
>>1285752
I can't find the same perspective as Q's pics but here is SFO.
Anonymous 05/03/18 (Thu) 15:01:55 ee7c64 No. 1285797
Anonymous 05/03/18 (Thu) 15:02:01 72e318 No. 1285798
Just a thought… Q posted a handful of random pics because (like 95% of us here), Q was also sick and tired of reading shit about Jews and gave these stupid fucks something new to play with.
Anonymous 05/03/18 (Thu) 15:02:13 51783e No. 1285799
I can't find the same perspective as Q's pics but here is SFO.
Anonymous 05/03/18 (Thu) 15:02:24 903612 No. 1285800
BAKER
Sealed indictments up to almost 29k!!
→ >>1285776
Holy shit!
Anonymous 05/03/18 (Thu) 15:02:44 e97ff9 No. 1285801
>>1285602
VERY plausible &
NOTABLE imho
—-
btw: Rudy said it's VERY common for lawyers to handle that sorta smut claims themselves, SOP, and pay the STFU money. they get reimbursed thru their monthly retainer. Probably the only reason a client has this lawyer, gets a nice fee and has to handle the bimbo squad out of pocket
Anonymous 05/03/18 (Thu) 15:02:50 607f0b No. 1285802
>>1285752
If it's in the US I say it is def out west to start
Anonymous 05/03/18 (Thu) 15:03:11 777edd No. 1285803
>>1285775
Pretty sure that the EMP, electronic tricks, etc. are out the window, right? I am not a planefag, but don't think that a C130 would have most of the more recent electronic controls.
Anonymous 05/03/18 (Thu) 15:03:25 b06664 No. 1285804
This marker thing looks very promising. Spider web marker.
Crude image, but:
Looks like this string of messages points to falsifying identities to keep them secret, move them thru society and then put them out there on behalf of the cabal.
Connect this line.
Angela Merkel
Ray Chandler
NoName's wife
Is the spider web marker all about this?
Anonymous 05/03/18 (Thu) 15:03:31 3b9ea1 No. 1285806
There is a major shift underway in the public sentiment that is underscoring why our computer has been forecasting the collapse in Marxist/Socialism. The message of the Democrats has been the same since the Great Depression – vote for us and we will rob those who have more and give it to you. When we just look at the fact and put aside the political biases, the chart shows a very striking trend. When we combine both the Senate and the House and then plot the number of seats each party held as a percent of the whole combination, we see that the Democrats peaked with FDR. They have won at times ever since, but the percentage of seats held has been gradually declining.
Now an online survey of more than 16,000 registered voters ages 18 to 34 has revealed that support for Democrats over Republicans in Congress has continued to decline among the youth. It has fallen another 9% since the 2016 election to just 46%. The responses say that the Republican Party is a better steward of the economy. This should come as no surprise. The entire Marxist agenda resonated with the Great Depression generation as the Marxists blamed corporations and never mentioned the Global Sovereign Debt Crisis of 1931. The younger generations are simply viewing the world differently as to what they can do themselves rather than what government can do for them. They simply want to keep more of what they work for. The Marxist message of the Democrats is gradually fading out. Equal Justice for All means it should apply fairly to everyone, not just some.
-Armstrong Economics today.
https: //www.armstrongeconomics.com/international-news/politics/the-changing-wind-in-politics-by-generation/
Anonymous 05/03/18 (Thu) 15:03:33 51783e No. 1285807
>>1285780
Tell that to my family in San Francisco.
Anonymous 05/03/18 (Thu) 15:03:36 4d87a3 No. 1285808
>>1285738
Does it matter when the images are heavily cropped?
Anonymous 05/03/18 (Thu) 15:04:02 72e318 No. 1285809
>>1285764
IMHO, once this BS/fake case ends, Q swings immediately to the offensive.
Anonymous 05/03/18 (Thu) 15:04:09 683915 No. 1285810
>>1284613
The process starts in China, where pallets of iPhones are moved from factories in unmarked containers accompanied by a security detail. The containers are then loaded onto trucks and shipped via pre-bought airfreight space, including on old Russian military transports. The journey ends in stores where the world's biggest technology company makes constant adjustments based on demand, said people who have worked on Apple's logistics and asked not to be identified because the process is secret. https:// www.engadget.com/2013/09/11/the-logistics-behind-transporting-millions-of-iphones-from-china/
Anonymous 05/03/18 (Thu) 15:04:18 5cda55 No. 1285811
>>1285794
Superimposing Jordan Sather over David Wilcock only gets people two sources of information in one image.
p.s. careful with COBRA, contact was lost recently
Anonymous 05/03/18 (Thu) 15:04:35 345feb No. 1285812
>>1285737
Looking at it some more, it looks like there is a box missing on the one in the back because of the way that the shrink wrap sags. That usually happens when you take a box off the top and creates slack in the tension of the shrink wrap.
Anonymous 05/03/18 (Thu) 15:04:54 7f92d4 No. 1285813
>>1285310
Ref to 130 could be Notable
Anonymous 05/03/18 (Thu) 15:05:01 e97ff9 No. 1285814
>>1285786
So why THE FUCK do they let us die of cancer if all it fucking takes is a 30 sec retina scan????
I'm gonna dig if they can measure hormonal levels in a ret scan. Get someone with elevated adreno chrome levels?? YUMMY
Anonymous 05/03/18 (Thu) 15:05:05 8c78b9 No. 1285815
>>1285809
completely agree
the end of the which hunt, SIGNALS PHASE [3]
Anonymous 05/03/18 (Thu) 15:05:31 1b8f68 No. 1285817
Anonymous 05/03/18 (Thu) 15:05:48 2b2eb8 No. 1285818
>>1285739
Timestamps important.
Countdown?
Markers.
Anonymous 05/03/18 (Thu) 15:05:52 8439f9 No. 1285819
>>1285809
me hopes so, the plan is coming along as planned
Anonymous 05/03/18 (Thu) 15:06:01 fc982e No. 1285820
>>1280036
Jetblue and Apple pioneer together with facial recognition techniques. A very dangerous development. (picture related)
Anonymous 05/03/18 (Thu) 15:06:21 e02a8a No. 1285821
>>1285752
That is SJC, San Jose International. The plane's wheels are up so it is taking off. If you take off from SJC to the northwest, you go over the wetlands at the south end of San Francisco Bay. That looks like the Eden Landing Ecological Reserve in the photo.
Anonymous 05/03/18 (Thu) 15:06:24 6610aa No. 1285822
>>1285776
>>1285800
Sorry for the type = "on"
My best sources & my personal guess is most will be Sealed Arrest Warrants & Search Warrants.
Impossible to have these many Indictments w/o a record number of Grand Juries,
And so far, info on this fact has been virtually ZIPPO, Nil, Nada…..
Anonymous 05/03/18 (Thu) 15:06:26 164379 No. 1285823
>>1285808
Yes. You get more of those pixels filled in with detail, which means that when it's cropped, whatever you're cropping has more detail. You always start with the most amount of detail, so that as things get widdled down you still end up with the most amount of information possible.
Anonymous 05/03/18 (Thu) 15:06:34 8c78b9 No. 1285824
>>1285809
completely agree
the end of the which hunt, SIGNALS PHASE [3] >>1285811
let me guess, you are here ecause of the ONE post Q replied to about incarnated extraterrestrials (which Q DIDN'T even acknowledge, he replied to the picture, and the anon used SARCASTICALLY)
Anonymous 05/03/18 (Thu) 15:07:12 2b2eb8 No. 1285825
>>1285818
Quoting Q. Should have posted a snap.
Anonymous 05/03/18 (Thu) 15:07:13 d921a4 No. 1285826
>>1285770
>with a parachute job at the New York Times I think.
>>1285255 confirms.
>not 100% sure what this is about.
Original sauce for the Mark Thompson dig is in Notables #1610 -
>>1284656 Left/Right TV - possible left/right up/down explanation
Looks like the NY Times is getting into Cable TV with some "innovative programming".
>Mark Thompson covered up the Jimmy Savile affair at the BBC.
Quelle surprise. Thx. for the sauce. Picture is becoming earlier, yes?
Anonymous 05/03/18 (Thu) 15:07:33 a04698 No. 1285828
>>1285210
Possibly Iphones due to ZTE and Blackberry in D.C. being infected w/virus?
Anonymous 05/03/18 (Thu) 15:07:40 baaab5 No. 1285829
>>1285816
USAID/CIA promoting American MSM-style journalism throughout the world. Maybe media is a keystone for the cabal.
Anonymous 05/03/18 (Thu) 15:07:51 8c78b9 No. 1285830
>>1285811
let me guess, you are here because of the ONE post Q replied to about incarnated extraterrestrials (which Q DIDN'T even acknowledge, he replied to the picture, and the anon used SARCASTICALLY)
Anonymous 05/03/18 (Thu) 15:07:53 51783e No. 1285831
Hmmmmm……..
Brennan and Clapper endorse her but her conf vote will be close?
Anonymous 05/03/18 (Thu) 15:08:04 e97e19 No. 1285833
San Jose!!
Notice same fields at top of pic.
Plane going in for landing
Anonymous 05/03/18 (Thu) 15:08:43 607f0b No. 1285835
>>1285781
Where is that "130 tons" statement from?
Anonymous 05/03/18 (Thu) 15:08:52 024e28 No. 1285837
>>1285727
Awesome, thanks. I'm no photofag, was it discussed how to unpack these images when we figure the key out?
Anonymous 05/03/18 (Thu) 15:08:58 56a8a7 No. 1285838
Anonymous 05/03/18 (Thu) 15:09:00 92c9f9 No. 1285839
“roll” could equal bread roll, shout out to the anons
Anonymous 05/03/18 (Thu) 15:09:10 115657 No. 1285840
trying to learn to read the map correctly.
this is what I came up with for the 12/12 correlation to the 1/19 posts.
Anonymous 05/03/18 (Thu) 15:09:23 074f90 No. 1285841
>>1285778
I'm lost.
Not saying your not onto something here. But it seems a bit elaborate. Even still, lets say we do this … what would be our result if we do. We unlock the key to what? Some cache of new information?
Anonymous 05/03/18 (Thu) 15:09:41 ee7c64 No. 1285842
>>1285753
I've been looking for a "number sixteen" connection in regards to AS. Why do you ask Anon?
Anonymous 05/03/18 (Thu) 15:09:51 4c53f3 No. 1285843
>>1285803
Depends on what sort of INS sensors the autopilot on this particular C130 relied on and if the plane was flying with any sort of autopilot at the time. Theoretically, certain MEMs-based INS systems could be disrupted using electronic warfare, but doubtful this thing was using MEMs-based INS. C130s also have varying levels of EMP-hardening that would protect it from all but the most powerful of attacks.
Anonymous 05/03/18 (Thu) 15:10:00 f9f1ca No. 1285844
>>1285831
Brennan and Clapper endorse her? THAT can't be good!
Anonymous 05/03/18 (Thu) 15:10:06 5cda55 No. 1285845
>>1285830
I've been here before Q mentioned or implied anything about aliens at all, because some people can see where this is headed.
Anonymous 05/03/18 (Thu) 15:10:14 7b8c97 No. 1285846
Anonymous 05/03/18 (Thu) 15:10:15 45364b No. 1285847
>>1285667
>>1285628
LEARN[OC] = learn our comms
also [A]UDIT:PENT_S2:G5
could be audit Pentagon and s2…? G5 possibly means "Group of 5"
Recent Audit of Pentagon:
"Audit finds Pentagon failed to properly keep track of $800 million in projects, says report"
https:// www.cnbc.com/2018/02/05/audit-finds-pentagon-failed-to-properly-keep-track-of-800-million-in-projects-says-report.html
Anonymous 05/03/18 (Thu) 15:10:18 992ef1 No. 1285848
I think it's quite clearly multiple boxes stacked then shrinkwrapped.
Full of cash?
Anonymous 05/03/18 (Thu) 15:10:27 f5ed6b No. 1285849
Anonymous 05/03/18 (Thu) 15:10:38 c1f1d7 No. 1285850
NEWS UNLOCKS CRUMBS
Do the Apple/boxes/plane pics have anything to do with today being National World Password Day
WORLD PASSWORD DAY – FIRST THURSDAY IN MAY | National Day …
Anonymous 05/03/18 (Thu) 15:10:40 7b42bc No. 1285851
>>1285618
If they cut their toes of, trying to harvest rice, then they're doing it rong, lol.
Anonymous 05/03/18 (Thu) 15:11:00 8c78b9 No. 1285852
Anonymous 05/03/18 (Thu) 15:11:07 4d145e No. 1285853
Site embedded in plane pic!!!
http:// www.w3.org/2005/10/Process-20051014/cover.html#toc
Anonymous 05/03/18 (Thu) 15:11:09 72e318 No. 1285854
>>1285820
That's one slippery fucking slope!
Anonymous 05/03/18 (Thu) 15:11:10 51783e No. 1285855
>>1285833
Must be San Jose bc it's only 30 min from Apple HQ. So was Q's pallet pic taken in HK or US?
Anonymous 05/03/18 (Thu) 15:11:15 aee2d4 No. 1285856
NOTABLES SO FAR
#1611
>>1285096 ; >>1285225 Xiaomi (Chinese Electronics Producer)
>>1285227 You realize Trump literally tweeted the court case in a nutshell.
>>1285241 Jet Blue and Apple
>>1285363 Anon Analysis - Cook has been brought to heel.
>>1285430 Bill McDermott, CEO of SAP
>>1285496 Giuliani says 3 Americans held by North Korea to be released Thursday
>>1285528 Relative to the Aircraft Incidents and EW (Electronic Warfare)
>>1285543 Crytic Post Could Be More Than It Seems
>>1285316 POTUS tweet uses GOOD and GREAT (in that order), shout out to Q post
>>1285581 US Trade Deficit Drops Sharply
>>1285527 possible use of the word marker related to other Q posts at same time
>>1285605 ; >>1285625 Marker Graphics
>>1285629 Chinese Products in the USA
>>1285685 Manafort Lawyers Claim Leaky Mueller Probe Has Provided No Evidence Of Contacts With Russian Officials
>>1285727 Q Posts Photo ID
>>1285726 Perfect Way to Find Perfect Specimens
>>1285602 Analysis of the Stormy Situation
Anything I missed anons?
WARMING THE OVEN
Anonymous 05/03/18 (Thu) 15:11:16 3c4309 No. 1285857
>>1285386
^^^^^^^This. Notable.
Anonymous 05/03/18 (Thu) 15:11:43 2b2eb8 No. 1285859
>>1285786
First your employer will offer a $100 discount on your insurance if you get The Diagnostic Scan.
Then, if you hold out against that little carrot and all the peer shaming that will come not taking the scan, they're make a condition of ongoing employment.
#imho
Anonymous 05/03/18 (Thu) 15:11:51 8439f9 No. 1285860
>>1285827
i do not like rudy one bit, dont trust him
he was Complicit on 911
he either flipped or potus is using him
because he does have cred with the normies
Anonymous 05/03/18 (Thu) 15:11:57 777edd No. 1285861
Anonymous 05/03/18 (Thu) 15:12:04 c33a3e No. 1285863
>>1285840
by the way, if the [markers] analyzing anon is around: i don't think you should focus on the posts where Q says marker, but the posts containing the markers he's refering to…
Anonymous 05/03/18 (Thu) 15:12:10 e96332 No. 1285864
>>1285844
Practically everyone in intelligence has, current and former.
Anonymous 05/03/18 (Thu) 15:12:10 607f0b No. 1285865
>>1285813
You know where this 130 ton statement comes from?
pic here:
>>1285781
Anonymous 05/03/18 (Thu) 15:12:18 4c53f3 No. 1285866
>>1285833
>>1285821
Personally, I feel like the plane the pic was taken from was landing at Moffett field since it is at a lower altitude and to the west of the Jet Blue plane taking off from SJC Mineta International, but thats just me.
Anonymous 05/03/18 (Thu) 15:12:19 d921a4 No. 1285867
>>1285466
Which Q pics are you referring? The latest ones last appear to have nothing to do with HK (at this point).
Have you discovered a link between last night's and the ones from HK last month, etc.?
Anonymous 05/03/18 (Thu) 15:12:45 51783e No. 1285870
>>1285848
It would be funny if we all found new iPhones in our mailboxes one day. Hahahaha. Qphones.
Anonymous 05/03/18 (Thu) 15:13:04 ef36d9 No. 1285871
>>1285229
Alice connection?https:// www.osha.gov/pls/oshaweb/owadisp.show_document?p_id=22695&p_table=INTERPRETATIONS
Anonymous 05/03/18 (Thu) 15:13:06 b97d2d No. 1285872
>>1285820
Chertoff's handrubbing intensifies
>>1285860
Smokescreen?
Anonymous 05/03/18 (Thu) 15:13:11 164379 No. 1285874
>>1285339
>>1285339
Now this sounds like the real shit!
>>1279851
Anonymous 05/03/18 (Thu) 15:13:18 8439f9 No. 1285875
>>1285856
not putting me toe theory in notables???
oh come on : )
Anonymous 05/03/18 (Thu) 15:13:22 17b2ac No. 1285876
Rudy Giuliani Says Trump Paid Back Stormy Daniels’ Hush Money, Rips ‘Pervert’ Comey
In an appearance stuffed with odd factual errors, like saying no president had ever before been subpoenaed, and sweeping claims about “criminal” Hillary Clinton and “disgraceful liar” and “very perverted man” James Comey, Giuliani flat out said Trump had paid back the money shelled out to buy the porn star’s silence, and that there was no problem there.
https ://www.thedailybeast.com/rudy-giuliani-says-trump-paid-back-stormy-daniels-hush-money-rips-pervert-comey
Anonymous 05/03/18 (Thu) 15:13:27 7f2232 No. 1285877
>>1285835
https:// www.zerohedge.com/news/2017-01-09/obama-gifts-iran-massive-uranium-shipment-russia-sufficient-more-10-nuclear-bombs
There are a few others. I like zero hedge as the comments provide more stuff to look through
Anonymous 05/03/18 (Thu) 15:13:31 fc2bf3 No. 1285879
>>1285856
We have the best people don't we folks!
Anonymous 05/03/18 (Thu) 15:14:23 17b2ac No. 1285880
>>1285876
In an appearance stuffed with odd factual errors, like saying no president had ever before been subpoenaed, and sweeping claims about “criminal” Hillary Clinton and “disgraceful liar” and “very perverted man” James Comey, Giuliani flat out said Trump had paid back the money shelled out to buy the porn star’s silence, and that there was no problem there.
Anonymous 05/03/18 (Thu) 15:14:25 db98f1 No. 1285881
>>1285770
He's an expert on fake news, apparently.
https:// www.nytco.com/mark-thompson-delivers-speech-on-fake-news/
Anonymous 05/03/18 (Thu) 15:14:37 b97d2d No. 1285882
>>1285879
The day shift today is impressive AF
Anonymous 05/03/18 (Thu) 15:15:07 ca143d No. 1285883
Put the pictures in a particular order to tell a story
Anonymous 05/03/18 (Thu) 15:15:21 083284 No. 1285884
Pentagon bans sale of ZTE, Huawei phones on military bases, report says
http:// www.foxnews.com/tech/2018/05/03/pentagon-bans-sale-zte-huawei-phones-on-military-bases-report-says.html
Anonymous 05/03/18 (Thu) 15:15:38 aee2d4 No. 1285885
>>1285882
It's amazing what you can get done if you ignore the shills and get down to the business of HELPING POTUS SAVE THE FUCKING WORLD.
Anonymous 05/03/18 (Thu) 15:15:50 c33a3e No. 1285886
>>1285874 <
>>1285339 <
>Now this sounds like the real shit!
>>1279851 <
>>1285874 <
yeah, good stuff… sad timing with the Qdrops coming right after, it sorta pushed that momentum out of the way…
>>1279851 We need to find the key.
>>1279958 this post key to everything.
>>1280033 timestamps
This would deserve its own thread…
anyone on it?
DOIT
Anonymous 05/03/18 (Thu) 15:15:53 2f6a0b No. 1285887
>>1285870
KEK!!! That WOULD be great
Anonymous 05/03/18 (Thu) 15:15:56 edc754 No. 1285888
>>1285848
If it is intercepted cash, I can see it being shipped in a reefer truck in order to preserve possible DNA evidence of the individuals connected to the money
Anonymous 05/03/18 (Thu) 15:16:00 eb0bec No. 1285889
Anonymous 05/03/18 (Thu) 15:16:33 d0fd8f No. 1285890
>>1285834
What are they hiding in their Bunker?
Anonymous 05/03/18 (Thu) 15:16:34 6054bc No. 1285891
I dont know where this Stormy Daniels thing is going. But the more I think about it, the more Stormy HAS to be working FOR Trump and playing some role that will ultimately benefit the storm movement
Anonymous 05/03/18 (Thu) 15:16:37 5cda55 No. 1285892
>>1285852
You really need to up your game son
Anonymous 05/03/18 (Thu) 15:16:44 c33a3e No. 1285893
>>1285856
>Anything I missed anons?
see >>1285766 for small updates, not notable-related:
>>1285750 GERMANARCHIVEANAON UPDATE
to replace
>>1285137 Threads & Research Section
>>1245678 Germanarchiveanon
>>1285750 Germanarchiveanon
ohalso
>>945864 EMINEM THREAD
fell off the board
Anonymous 05/03/18 (Thu) 15:16:50 51783e No. 1285894
>>1285862
We are sure it's not HK int'l right? The bottom of the pic looks like there is standing water.
Anonymous 05/03/18 (Thu) 15:16:59 607f0b No. 1285895
Anonymous 05/03/18 (Thu) 15:17:01 a756c8 No. 1285896
>>1285882
Day shift and Friday nights …last night was a nightmare during drops …anons arguing it’s not a reefer when it obviously is …fine if ya don’t know but correcting the educated then saying “well I drive a forklift” was just ugly last night
Anonymous 05/03/18 (Thu) 15:17:03 8439f9 No. 1285897
>>1285849
nope that is an actual toe, when i was grabbing it off the web, there was a story i glanced at.
had surgery to shorten the big toe, lmao
Anonymous 05/03/18 (Thu) 15:17:10 fc982e No. 1285898
>>1285856
Maybe this one. Apple and Jetblue - facial recognition
>>1285820
Anonymous 05/03/18 (Thu) 15:17:22 992ef1 No. 1285899
MARKERS
Ok you fuck faces, here's the dealio
Q/Tweet Markers are not the only markers. That's a variety of them. Not sure what those ones are for, but those ones are number markers.
But there's many markers. For example, Q says Biden/Chine is an important marker.
Also, this fag here:
>>1282709
Has got the right zeal, but you can't count a rt as a marker too! WTF
So here's my theory.
Find markers that match each other, then check the timestamp of those two or three.
I'm not entirely sure if [marker] is a marker itself, but trying to hint that there's a marker inside the current crumb.
Anonymous 05/03/18 (Thu) 15:17:26 5479dd No. 1285900
SNOWDEN - Hong Kong
APPLE PIC FROM Q - Hong Kong
British Monarch still OWNS Hong Kong
WE NEED TO DIG GENERAL HONG KONG
Anonymous 05/03/18 (Thu) 15:17:27 aee2d4 No. 1285901
>>1285893
Meant to tell you I got that. It's done.
Anonymous 05/03/18 (Thu) 15:17:27 5e2daf No. 1285902
Just a reminder - 2 scampers involved with China
Mitch McConnell - China deal
Senator Joe Handsy Biden's Son - China deal
Anonymous 05/03/18 (Thu) 15:18:20 777edd No. 1285904
>>1285843
Curious thing is:
All nine crew members were Puerto Ricans who had helped with hurricane recovery efforts as part of the 198th Fighter Squadron, nicknamed the Bucaneros, which flies out of Base Muniz in the northern coastal city of Carolina.
http:// www.dailymail.co.uk/news/article-5686877/Doomed-military-cargo-plane-FINAL-FLIGHT-60-YEARS-service.html
Anonymous 05/03/18 (Thu) 15:18:21 c19122 No. 1285905
ANONS! Another anon above pbserved that Q posted about "Find the Roll"
>>279968
Find the roll.
1 of 4.
Find the 4th.
Find the film.
Not the capture.
Enhance.
Spread.
Will go viral.
Source _ archive offline.
Raw only.
Q
Here's what we know:
- The images are screenshots from Q's iphone, not taken by the camera ("Find the film, not the capture")
- The number 4 always appears in the file names as the 15th digit ("4th")
Is Q trying to tell us to FIND the source film from which he took these screenshots? Something in that film is important to archive and spread.
FIND IT ANONS!!!
Anonymous 05/03/18 (Thu) 15:18:34 c33a3e No. 1285906
Anonymous 05/03/18 (Thu) 15:18:52 aee2d4 No. 1285907
Anonymous 05/03/18 (Thu) 15:19:03 5479dd No. 1285908
>>1285837
example
LPFUDZUTUCVLMVMFCSTUDXURBMZAICMJWUXFCNLYOWZLSGSSWDQLWDEBWCSIXBHPMLLKABISBZCCYUEMXWVUMMSOGRCSASGEAISVYOHRZKBSAKOSDHRCJQCWPSISGGFTSMENJJGYDYIVQMGRWOKSARMCEGZJPPCUCMOJVBNAMNOLONXTHKXWEGEZHYBSNQNENRSEOXGVJWFJWVIPBVIKKZLZBESPBEJQAKSHOMHLKFDYMEYUGMHULHEBMGOFDPKBAZBSGGXQKYWARSDMSGXHDHSURWSAMSZO
VAU - S-E V-N
BJVQLSWFDQFVXOPJSRIXSNKCWCBKFJEFOVBNRAOTDLUIORBPINJQNKUYFQYRLXXIHRCFDCJIDWLWWKFWFIYABWAJAOYLLIOWFBIANRZNBHFEVXAGSSXPTEHTWIZROCESJTCPCDAGGSBQCWFLDWWZIYNHMNYQKYBRTZUHIMRFHJDGGYQQOTUBPUYREPNXEAHHRHANRECYZSHIBQFTSALBOWVVLGHUHGUMNSLRUKKJUWFTXWANDFQNXCQZNUUCOVYGVWDJJJMRLMIVOPCPONPMEWTKQMUEBJUR
??????? Doesn't look right at all. Should be something different?
↑↓ ↑↓ ↑↓
W 17× 5.9%
F 15× 5.21%
N 15× 5.21%
R 15× 5.21%
I 13× 4.51%
U 13× 4.51%
B 13× 4.51%
J 13× 4.51%
H 12× 4.17%
Q 12× 4.17%
C 12× 4.17%
O 12× 4.17%
Y 11× 3.82%
L 11× 3.82%
A 11× 3.82%
S 10× 3.47%
V 9× 3.13%
X 9× 3.13%
D 9× 3.13%
T 9× 3.13%
E 9× 3.13%
P 9× 3.13%
G 8× 2.78%
K 8× 2.78%
M 7× 2.43%
Z 6× 2.08%
#N : 26 Σ = 288.00 Σ = 100.03
ZZQ - Z-N A-C
ZHOANEYWAPHACPFWEGCARYCVZRNMOTVKVTUTMIMIZSRYRZWWTHUAUAIFDVWLADJFBAQIQOSPEDSNSTUIFTMCEXNVSXGMSDUUUOXOFRSNXOFACRMIUVCEXYZQCBNJEDBIIQMOXMVVNFDBXDBHKVNMMLQYRWWRYNMOGDUIMDYCKBFKAXNNQQMRQZZBASODHBOUHBKNKZQTALNUBHRRVQZMQQDANRVQGRKXQTEBFGLVBWHWCHQDILWNKVIYGCRCKLMXOYQUXDWJCKHWQNZNZXHAYWVRUNPLWFQE
Look like garabage? WTF
↑↓ ↑↓ ↑↓
N 18× 6.25%
Q 18× 6.25%
M 15× 5.21%
R 15× 5.21%
A 14× 4.86%
V 14× 4.86%
W 14× 4.86%
U 13× 4.51%
D 13× 4.51%
B 12× 4.17%
C 12× 4.17%
X 12× 4.17%
I 11× 3.82%
H 11× 3.82%
O 11× 3.82%
Z 11× 3.82%
Y 10× 3.47%
F 10× 3.47%
K 10× 3.47%
E 8× 2.78%
S 8× 2.78%
T 8× 2.78%
L 7× 2.43%
G 6× 2.08%
P 4× 1.39%
J 3× 1.04%
#N : 26 Σ = 288.00 Σ = 100.00
Well that didn't work for shit. Back to the drawing board. We need the Right Rotors and Plug board for this B…….
Anonymous 05/03/18 (Thu) 15:19:26 aa8e69 No. 1285910
why is
Kelly Conway’s husband badmouthing geotus on twitter?
how much would anfew pallets of refrigerated adrenochrome be worth?
Anonymous 05/03/18 (Thu) 15:19:33 aee2d4 No. 1285911
Anonymous 05/03/18 (Thu) 15:19:42 5cda55 No. 1285912
>>1285908
PASTEBIN that stuff
Anonymous 05/03/18 (Thu) 15:19:42 839e8a No. 1285913
>>1285744
Didn't POTUS tweet about an "e"?
Anonymous 05/03/18 (Thu) 15:19:44 5479dd No. 1285914
>>1285908
OPERATIO DEFCON This seems off? Shouldn't it be OPERATION? That could be a clue. Looks like there is only one N? Maybe we got a keys right here? We need 3 rotors and the plug board. I think they normally have 2 sets? but there could be more?
OPE ← Rotors?
RATIO ←? Plug board? I guess we would have to match them up? R-A T-I
OPE Engima
IRBGJIGNIHIGIRIDKIKFTFIVRFRSTNGGIIRPWRGGIRRGIRIFIJGIIKSRIVRKIRIIIRFRSRTIRFQPIRTIRFRGRFIGIJSRURILSUFGIRGMIRIFJIIFJIOEIIVRIRNGIINLIRXGIIIGHFTIIRIPIRIFNAFQJFRGIIVGUIRRIRGBIIIIIRIRIIRFCISFIIIRIRGZIAGRIRIIIIUGIRTIRFKGRFRGIORFINRGSIRRIRGGIDLRIFIIIRFFIIUGIRGBYIRFNRFRIRIGIIIPJIRGIRRFHIRRGRGHRFFI
↑↓ ↑↓ ↑↓
I 94× 32.64%
R 63× 21.88%
G 33× 11.46%
F 28× 9.72%
N 7× 2.43%
S 7× 2.43%
J 7× 2.43%
T 6× 2.08%
K 5× 1.74%
U 5× 1.74%
H 4× 1.39%
P 4× 1.39%
V 4× 1.39%
L 3× 1.04%
B 3× 1.04%
A 2× 0.69%
O 2× 0.69%
Q 2× 0.69%
D 2× 0.69%
C 1× 0.35%
Y 1× 0.35%
Z 1× 0.35%
X 1× 0.35%
W 1× 0.35%
E 1× 0.35%
M 1× 0.35%
#N : 26 Σ = 288.00 Σ = 100.01
Seems like we are getting somewhere here. Notice that now we have 4 letters with really high frequency? Gotta mean we are geting close to something and it also means that this could be DNA since there is a high concentration of 4 letter.
OPE R-A T-I (0)
TABGJTGGTHTGTATDKTAFIFTTAFAGTNGGTTAPWAGGTAAGTATFTJGTTKSATVAFTATTTAFATATTAFQPTAITAFAGAFTGTTSATATLTAFGTAGGTATFTTTFJTTETTVATAGGTTNFTAXGTTTGHFTTTATFTATFTAFQJFAGTTVGUTAATAGGTTTTTATFTTAFCTSFTTTATAGZTAGATATTTTUGTATTAFAGAFAGTOAFTNAGTTAATAGGTDLATFTTTAFFTTUGTAGBYTAFTAFATATGTTTFTTAGTAAFHTAATAGTAFFT
↑↓ ↑↓ ↑↓
T 111× 38.54%
A 67× 23.26%
G 37× 12.85%
F 33× 11.46%
J 4× 1.39%
V 3× 1.04%
N 3× 1.04%
H 3× 1.04%
U 3× 1.04%
S 3× 1.04%
L 2× 0.69%
Q 2× 0.69%
P 2× 0.69%
B 2× 0.69%
K 2× 0.69%
D 2× 0.69%
I 2× 0.69%
O 1× 0.35%
Y 1× 0.35%
Z 1× 0.35%
X 1× 0.35%
E 1× 0.35%
W 1× 0.35%
C 1× 0.35%
#N : 24 Σ = 288.00 Σ = 99.980
Well shit we are getting closer! We have a bunch of T's, A's, and G's so we are on the right track it seems. Maybe we nee another part to the plugboard?
Anonymous 05/03/18 (Thu) 15:19:47 8439f9 No. 1285915
Anonymous 05/03/18 (Thu) 15:19:51 7b42bc No. 1285916
>>1285869
That's a social marketing tactic. Normies eat it up. Never really appealed to me, like pretty much all of normie culture.
Anonymous 05/03/18 (Thu) 15:19:57 bfad46 No. 1285917
(Ret.) General McChrystal is on the board of directors for JetBlue.
http:// blueir.investproductions.com/investor-relations/corporate-governance/board-of-directors
Anonymous 05/03/18 (Thu) 15:19:58 5479dd No. 1285918
>>1285914
OPE R-A T-I O-D ← 3 on the plug?
TABGITGGTHTGTATOKTAFUFTTAFAGTNGGTTAPWAGGKAAGTATFTLGTTASATVAFTATTTAFATATTAFQPTAITAFAGAFTFTTSATATLTAFGTYGGTATFTTQFQTTETTVATAGGTTNFTAXGTTTGSFTTTATFTGTFTAFQJFAGTTVGUTTATAGGTTKTQATFTTAFCTSFTTTATAGZTAGASATTTTUGTATTAFAGAFAGTDAFTNAGTTAAWAGGTOZATFTTTAFFTTUGTAABATAFTAFATATGTTTFTTHGTAAFWTAATAGTAFFC
↑↓ ↑↓ ↑↓
T 105× 36.46%
A 66× 22.92%
G 36× 12.5%
F 34× 11.81%
Q 5× 1.74%
S 5× 1.74%
U 4× 1.39%
W 3× 1.04%
N 3× 1.04%
V 3× 1.04%
K 3× 1.04%
Z 2× 0.69%
C 2× 0.69%
P 2× 0.69%
B 2× 0.69%
L 2× 0.69%
H 2× 0.69%
O 2× 0.69%
I 2× 0.69%
D 1× 0.35%
E 1× 0.35%
Y 1× 0.35%
X 1× 0.35%
J 1× 0.35%
#N : 24 Σ = 288.00 Σ = 99.990
Same Bullshit, like it seems the F is an outlayer?
OPE R-A T-I O-D E-F ← Holy shit 4 plug's?
Anonymous 05/03/18 (Thu) 15:19:59 541999 No. 1285919
>>1285905
>Source _ Archive offline.
Sounds like we already have it hidden somewhere. Perhaps hidden in one of the pictures Q has posted?
Anonymous 05/03/18 (Thu) 15:20:01 51783e No. 1285920
>>1285868
I see the same standing water in both pics. 99% sure it's San Jose. 30 min from Apple HQ.
Q's pic posts are usually to confirm their ties to the president and POTUS had hos China/trade tweet late last night when Q was here. Not sure we are meant to be chasing planes, I think it is another conf of Q.
Anonymous 05/03/18 (Thu) 15:20:13 e02a8a No. 1285922
>>1285866
If the plane was squawking then it can be identified by going through the flight history data that the planefags are always showing us. Just have to find that jetBlue plane taking off at SJC on May 2 at the same time.
Anonymous 05/03/18 (Thu) 15:20:13 5479dd No. 1285923
>>1285918
TAKGITGGTHTGTATHKTAEUETTAEAGTNGGTTAYWAGGKAAGTATETLGTTAHATVAETATTTAEATATTAEQPTAXTAEAGAETETTSATATMTAEGTYGGTATETTQEQTTFTTVATAGGTTUETAUGTTTGSETTTATETGTETAEQGEAGTTVGUTTATAGGTTKTQATETTAEVTKETTTATAGOTAGOSATTTTOGTATTAEAGAEAGTJAETKAGTTAAWAGGTQZATFTTTAEETTKGTAAOATAETAEATATGTTTETTHGTAAEWTAATAGTAEEC
Same shit? hmmm That kinda Messed it up? The O and the D don't seem to be doing it right.
OPE R-A T-I D-E F-C
TAGGTTGGTTTGTATTTTACACTTACAGTTGGTTAATAGGTAAGTATCTTGTTTTATTACTATTTACATATTACAGTATTACAGACTGTTTATATTTACGTAGGTATCTTTCTTTTTTTATAGGTTACTAGGTTTGACTTTATCTATCTACTACAGTTGGTTAATAGGTTTTTATCTTACTTTCTTTATAGCTAGCTATTTTGGTATTACAGACAGTTACTTAGTTAATAGGTAGATATTTACCTTTGTAGGTTACTACATATGTTTCTTTGTAACTTAATAGTACCT
↑↓ ↑↓ ↑↓
T 137×47.57%
A 73× 25.35%
G 44× 15.28%
C 34× 11.81%
We got it! Look at all that A T G C peoples. Ok, then we probably gotta decode this DNA into binary like before? Fack I don't have my DNAsolver.exe, Wait Nevermind I found it.
https:// www.dropbox.com/s/90f580t1gn62jy8/DNA_solver.exe?dl=0
Anonymous 05/03/18 (Thu) 15:20:16 0d0d87 No. 1285924
New blow for ZTE and Huawei: Devices pulled from military base stores
https:// www.digitaltrends.com/mobile/senate-intelligence-committee-huawei-zte-news/
Anonymous 05/03/18 (Thu) 15:20:30 fc2bf3 No. 1285926
>>1285885
"Darkness cannot drive out darkness; only light can do that. Hate cannot drive out hate; only love can do that." -Martin Luther King Jr.
Anonymous 05/03/18 (Thu) 15:20:38 5479dd No. 1285928
>>1285923
DNA to BINARY
01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101
010010100101101001010110010001010101001100110101001100100101101001010000010010100100001001000111010110010101010001010011010001010100110001000101001100100100010100110010001101100101010001000101010011100100101001000111010101110101010101010100010010100101001101001010010101100011010101000111010001110100110100110010010110100101000001001010010101010100011101010011010101110101010001001011010010110100010101011010010001010011001000110010010100110101001001010000010010100100100001000101010011110101011001001010010100110100110001000110010101110101011001000011010100000100100100111101
BINARY TO BASE64? ←- Malformed input Guess again?
JZVES52ZPJBGYTSELE2E26TENJGWUTJSJV5GGM2ZPJUGSWTKKEZE22SRPJHEOVJSLFWVCPI=
Let's think here. If the Binary to Base64 is out putting base64 then it usually mean there it another base. Let's Try base32.
Binary to Base32
010010100101101001010110010001010101001100110101001100100101101001010000010010100100001001000111010110010101010001010011010001010100110001000101001100100100010100110010001101100101010001000101010011100100101001000111010101110101010101010100010010100101001101001010010101100011010101000111010001110100110100110010010110100101000001001010010101010100011101010011010101110101010001001011010010110100010101011010010001010011001000110010010100110101001001010000010010100100100001000101010011110101011001001010010100110100110001000110010101110101011001000011010100000100100100111101
IIQAP2L6D9K00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Seem Fishy messed up.
Anonymous 05/03/18 (Thu) 15:21:09 58110f No. 1285930
>>1285776
When the indictments are unsealed, do they drop off this list?
Anonymous 05/03/18 (Thu) 15:21:11 607f0b No. 1285931
I'm putting this up to potentially exclude denver intl
Anonymous 05/03/18 (Thu) 15:21:16 5479dd No. 1285932
>>1285928
Binary to Base64
SlpWRVM1MlpQSkJHWVRTRUxFMkUyNlRFTkpHV1VUSlNKVjVHR00yWlBKVUdTV1RLS0VaRTIyU1JQSkhFT1ZKU0xGV1ZDUEk9
Base64 to Base32
KNWHAV2SKZGTCTLMOBIVG22KJBLVMUSUKJKXQRSNNNKXSTTMKJDFI23QJBLDCVSVKNWE4S2WNJLEQURQGB4VO3CCJNLFKZCUKYYVETCTGBLGCUSUJF4VKMKKKFJWW2CGKQYVUS2VGB4EOVRRLJCFKRLLHE======
base32 to MD5
d41d8cd98f00b204e9800998ecf8427e
WTF AM I DOING? No idea schwellington, Didn't that f'n Phone Booth use MD5 hashes? Hmmm making a phone call…… (760) 733-9969….. nothing new it seems. Weird song playing in the background as usual. Sounds like some Mr. Robot type stuff.
Let's get this Straight. We Did Enigma to DNA. Then we took the DNA and ran it threw the DNA_solver.exe we where given and it gave us the binary. Now we need to figure out what to do with the binary code. It seems that binary to base64 does not do the trick and output's some funny business. I also tried to go to base32 and it also doesn't seem to be doing any good with an out that looks understandable. Oh dear me what's the problem son.
Square One. Binary to Base32 to Base64 to ????
01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101
Anonymous 05/03/18 (Thu) 15:21:25 7335ca No. 1285933
>>1285527
By golly, I think you nailed it. Could it have been even more obvious?
Anonymous 05/03/18 (Thu) 15:21:36 e3c319 No. 1285935
>>1285878
Tremendous cocksucka [uncle Joey]
Anonymous 05/03/18 (Thu) 15:21:43 b40f65 No. 1285937
>>1285804
These: middle and right have same times, different dates. Pic to left same time minus 2 mins, different date.
>>1285647
>>1285761
Anonymous 05/03/18 (Thu) 15:22:01 5479dd No. 1285939
>>1285932
Seems to do something interesting, well it worked we going with it.
https:// emn178.github.io/online-tools/base32_encode.html
GAYTAMBRGAYTAIBQGEYDCMJQGEYCAMBRGAYTAMJRGAQDAMJQGAYDCMBREAYDCMBRGAYDCMJAGAYDCMJQGEYDCIBQGAYTCMBQGEYCAMBRGAYTCMBRGAQDAMJQGEYDAMBQEAYDCMBQGEYDCMBAGAYTAMBQGAYTAIBQGEYDAMBRGEYSAMBRGAYTCMBQGEQDAMJQGEYDCMBQEAYDCMBRGAYDCMJAGAYTAMBQGEYDCIBQGEYDAMJRGAYCAMBRGAYDAMJQGEQDAMBRGEYDAMJQEAYDCMBQGAYTAMJAGAYDCMJQGAYTAIBQGAYTCMBRGEYCAMBRGAYTAMJQGAQDAMJQGAYDCMBREAYDCMBQGEYTCMBAGAYTAMBRGAYTAIBQGEYDAMBRGEYSAMBRGAYTAMJRGEQDAMJQGEYDCMBREAYDCMBRGAYTAMBAGAYTAMBRGAYTAIBQGEYDCMBQGEYSAMBRGAYDtCMBRGAQDAMJQGEYDCMJQEAYDAMJRGAYTAMJAGAYTAMBQGEYTCIBQGEYDAMBRGEYSAMBRGAYDCMJQGEQDAMBRGEYDAMJQEAYDCMBRGEYDCMBAGAYTAMJQGAYDAIBQGEYDAMJQGEYCAMBRGAYTAMJQGEQDAMJQGAYDCMJREAYDCMBRGAYDCMJAGAYTAMJQGEYTCIBQGEYDCMBRGAYCAMBRGAYDCMBRGEQDAMJQGAYTAMJREAYDCMBQGAYTAMJAGAYTAMJRGAYTAIBQGEYDAMBRGAYSAMBQGEYTAMBRGAQDAMBRGEYDAMJQEAYDCMBRGAYDCMJAGAYTAMJQGAYTAIBQGEYDCMBQGAYCAMBRGAYDCMBRGAQDAMJQGAYTAMBQEAYDCMBQGAYTAMJAGAYTAMBRGEYTCIBQGEYDCMBRGEYCAMBRGAYDCMBRGAQDAMJQGEYDAMJREAYDCMBQGEYTAMBAGAYTAMBQGEYTAIBQGEYDCMBRGEYSAMBRGAYTAMJRGAQDAMJQGAYDAMJREAYDCMBRGAYDAMBAGAYTAMBRGAYDCIBQGAYTCMJRGAYSA===
The some Base32 to Base64 encoding
http:// www.motobit.com/util/base64-decoder-encoder.asp
R0FZVEFNQlJHQVlUQUlCUUdFWURDTUpRR0VZQ0FNQlJHQVlUQU1KUkdBUURBTUpRR0FZRENNQlJF
QVlEQ01CUkdBWURDTUpBR0FZRENNSlFHRVlEQ0lCUUdBWVRDTUJRR0VZQ0FNQlJHQVlUQ01CUkdB
UURBTUpRR0VZREFNQlFFQVlEQ01CUUdFWURDTUJBR0FZVEFNQlFHQVlUQUlCUUdFWURBTUJSR0VZ
U0FNQlJHQVlUQ01CUUdFUURBTUpRR0VZRENNQlFFQVlEQ01CUkdBWURDTUpBR0FZVEFNQlFHRVlE
Q0lCUUdFWURBTUpSR0FZQ0FNQlJHQVlEQU1KUUdFUURBTUJSR0VZREFNSlFFQVlEQ01CUUdBWVRB
TUpBR0FZRENNSlFHQVlUQUlCUUdBWVRDTUJSR0VZQ0FNQlJHQVlUQU1KUUdBUURBTUpRR0FZRENN
QlJFQVlEQ01CUUdFWVRDTUJBR0FZVEFNQlJHQVlUQUlCUUdFWURBTUJSR0VZU0FNQlJHQVlUQU1K
UkdFUURBTUpRR0VZRENNQlJFQVlEQ01CUkdBWVRBTUJBR0FZVEFNQlJHQVlUQUlCUUdFWURDTUJR
R0VZU0FNQlJHQVlEdENNQlJHQVFEQU1KUUdFWURDTUpRRUFZREFNSlJHQVlUQU1KQUdBWVRBTUJR
R0VZVENJQlFHRVlEQU1CUkdFWVNBTUJSR0FZRENNSlFHRVFEQU1CUkdFWURBTUpRRUFZRENNQlJH
RVlEQ01CQUdBWVRBTUpRR0FZREFJQlFHRVlEQU1KUUdFWUNBTUJSR0FZVEFNSlFHRVFEQU1KUUdB
WURDTUpSRUFZRENNQlJHQVlEQ01KQUdBWVRBTUpRR0VZVENJQlFHRVlEQ01CUkdBWUNBTUJSR0FZ
RENNQlJHRVFEQU1KUUdBWVRBTUpSRUFZRENNQlFHQVlUQU1KQUdBWVRBTUpSR0FZVEFJQlFHRVlE
QU1CUkdBWVNBTUJRR0VZVEFNQlJHQVFEQU1CUkdFWURBTUpRRUFZRENNQlJHQVlEQ01KQUdBWVRB
TUpRR0FZVEFJQlFHRVlEQ01CUUdBWUNBTUJSR0FZRENNQlJHQVFEQU1KUUdBWVRBTUJRRUFZRENN
QlFHQVlUQU1KQUdBWVRBTUJSR0VZVENJQlFHRVlEQ01CUkdFWUNBTUJSR0FZRENNQlJHQVFEQU1K
UUdFWURBTUpSRUFZRENNQlFHRVlUQU1CQUdBWVRBTUJRR0VZVEFJQlFHRVlEQ01CUkdFWVNBTUJS
R0FZVEFNSlJHQVFEQU1KUUdBWURBTUpSRUFZRENNQlJHQVlEQU1CQUdBWVRBTUJSR0FZRENJQlFH
QVlUQ01KUkdBWVNBPT09
OK, well now what? Seems like some weird stuff? kinda looks like a PGP key or a hash or something. Like IDK? MD5? can you go base64 or MD5 and what the hell purpose would that serve us here? No idea.
https:// cryptii.com/base64/md5 ← SHWING
d41d8cd98f00b204e9800998ecf8427e
Yay, we have a Hash……. The F that does do for us? password for something? or some crap? probably these cicada peoples like to do that kinda stuff.
I thought about it and it doesn't make sense to go from base32 to base64 since they are the same style of encoding I guess. I noticed that if we add a base32 to Hex, then covert the Hex to Base64 we get a different MD5 hash. It also is interesting be that would have made 7 layers or actions to get to the final hash. No idea what it's for and I'm not sure I have seen this before.
Anonymous 05/03/18 (Thu) 15:22:24 5479dd No. 1285940
>>1285939
I thought about it and it doesn't make sense to go from base32 to base64 since they are the same style of encoding I guess. I noticed that if we add a base32 to Hex, then covert the Hex to Base64 we get a different MD5 hash. It also is interesting be that would have made 7 layers or actions to get to the final hash. No idea what it's for and I'm not sure I have seen this before.
Enigma
LPFUDZUTUCVLMVMFCSTUDXURBMZAICMJWUXFCNLYOWZLSGSSWDQLWDEBWCSIXBHPMLLKABISBZCCYUEMXWVUMMSOGRCSASGEAISVYOHRZKBSAKOSDHRCJQCWPSISGGFTSMENJJGYDYIVQMGRWOKSARMCEGZJPPCUCMOJVBNAMNOLONXTHKXWEGEZHYBSNQNENRSEOXGVJWFJWVIPBVIKKZLZBESPBEJQAKSHOMHLKFDYMEYUGMHULHEBMGOFDPKBAZBSGGXQKYWARSDMSGXHDHSURWSAMSZO
DNA
TAGGTTGGTTTGTATTTTACACTTACAGTTGGTTAATAGGTAAGTATCTTGTTTTATTACTATTTACATATTACAGTATTACAGACTGTTTATATTTACGTAGGTATCTTTCTTTTTTTATAGGTTACTAGGTTTGACTTTATCTATCTACTACAGTTGGTTAATAGGTTTTTATCTTACTTTCTTTATAGCTAGCTATTTTGGTATTACAGACAGTTACTTAGTTAATAGGTAGATATTTACCTTTGTAGGTTACTACATATGTTTCTTTGTAACTTAATAGTACCT
BINARY
01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101
Base32
IIQAP2L6D9IB984KGI7B5A56HAC8KP4ACHMAH2KSII7ATAL8IIJ99B3AHQ79KP5KK2AAL3L6LQK9D5KAMI568P56KIG9944AJQM999KOHINAP1L0I9T
HEX
422007E97E1A021E28C8F87A0EF8E01054FE0047600FA54908F826058508487603C3EA7F54AD000BDAFCB8287D50188EF82FEF948373804C18A71D0D03D6B722
base64
QiAH6X4aAh4oyPh6DvjgEFT+AEdgD6VJCPgmBYUISHYDw+p/VK0AC9r8uCh9UBiO+C/vlINzgEwYpx0NA9a3Ig==
MD5
fc74c3b9b2e74e2c1bd37a2db15e29eb
7 layers of Encoding it seems.
Anonymous 05/03/18 (Thu) 15:22:39 51783e No. 1285942
Anonymous 05/03/18 (Thu) 15:22:46 b6e7df No. 1285943
>>1285339
>We need to find the key.
Q mentions a key, a picture of the sky.
>The graphic is your key.
Nov 9, 2017.
Whether that helps, I don't know.
Anonymous 05/03/18 (Thu) 15:22:47 bc175b No. 1285944
>>1285527
See, that is far more inline with Q's Comms than this DNA wannabe spook.
Anonymous 05/03/18 (Thu) 15:22:48 8439f9 No. 1285945
>>1285916
ignorant
its like sniffing condems, tide pods, ice bucket challenge
sheep will do anything, i think higher ups do it just for laughs
these people that do that are like the new court jesters
Anonymous 05/03/18 (Thu) 15:22:57 d921a4 No. 1285947
Anonymous 05/03/18 (Thu) 15:22:59 4d4f5c No. 1285948
Soooo Rudy said his disclosure was "planned long in advance."
Hivemind thinking POTUS wants Stormy in the news a bit longer?
Hivemind being smart now thinking Stormy is a LARP?
Anonymous 05/03/18 (Thu) 15:22:59 e02a8a No. 1285949
>>1285894
jetBlue does not fly to HK
Anonymous 05/03/18 (Thu) 15:23:14 541999 No. 1285951
>>1285940
Hmm, maybe It unlocks the file that JA uploaded with a dead man trigger?
Anonymous 05/03/18 (Thu) 15:23:18 024e28 No. 1285953
>>1285905
I was assuming that sections of the film were embedded within the images themselves, and once we figured out the key, we could parse the hidden files from the image
Anonymous 05/03/18 (Thu) 15:23:24 ee7c64 No. 1285954
>>1285579
No spaces in: MadeintheUSA……..
Anonymous 05/03/18 (Thu) 15:23:37 2f6a0b No. 1285956
>>1285940
Be. Sure. To. Drink. Your. Ovalteen.
Anonymous 05/03/18 (Thu) 15:23:42 b32a2a No. 1285957
Pence reads Jer. 29. You know the plans I have for you to prosper you…. AWESOME
Anonymous 05/03/18 (Thu) 15:23:58 eb0bec No. 1285959
>>1285905
whoa.
nice.
thank you.
Anonymous 05/03/18 (Thu) 15:24:04 c43e9b No. 1285961
>>1285232
I look forward to your Sovereign Citizen takedown video. Stop trying to pretend you don't have to obey the law because your autism gives you technically abilities. Lawfags will pwn you every time, 100% of the time because you're WRONG and deluding yourself is just going to get you in trouble. There's a reason that driving is regulated—it has nothing to do with attempting to restrict your ability to fucking travel you retard.
Anonymous 05/03/18 (Thu) 15:24:04 5479dd No. 1285962
>>1285951
yes, exactly, vault seven
Anonymous 05/03/18 (Thu) 15:24:25 992ef1 No. 1285964
>>1285900
Biden and Apple and HK?
Anonymous 05/03/18 (Thu) 15:24:31 7b42bc No. 1285965
>>1285945
It extends their reach by increasing post interaction. They actually profit from it. Plus they get all that free OC of people branding themselves.
Anonymous 05/03/18 (Thu) 15:24:36 b215f3 No. 1285966
>>1285894
it kind of reminded me of Piarco in Trinidad
Anonymous 05/03/18 (Thu) 15:24:49 f31949 No. 1285967
>>1285841
Here is what I know
Q uses [MARKER] in brackets only 3 times, One more and we would have 4 making 4 points of a clock? 3,6,9,12. I'm trying to find a relation to an actual clock as Q says "Think Clock". Also the 3 in brackets, 2 of them have "Left eye" before them.
Q also says "wind the clock" which I googled and found that you use a key and rotate it clockwise 16 times. Maybe this is relevant maybe not.
Q also posted the following:
The "marker."
Learn to read the map.
News unlocks the map.
I believe Q also indicated by reposting someone talking about the deltas in the posts being markers and we all went off on the POTUS tweet and Q posting deltas but I think we need to focus on the timestamps. Re-reading the posts with "marker in them" makes me think we are supposed to focus on the timestamps themselves rather than just the deltas.
Anonymous 05/03/18 (Thu) 15:24:50 5cda55 No. 1285968
>>1285940
There is also RNA.
Anyways good to see efforts for this
Anonymous 05/03/18 (Thu) 15:24:55 45f433 No. 1285969
>>1285841
Give this guy a call.
https:// www.inc.com/joseph-steinberg/how-to-hide-data-in-plain-sight-so-nobody-can-find-it.html
Anonymous 05/03/18 (Thu) 15:25:03 541999 No. 1285970
>>1285940
>>1285962
Makes sense with the 7 layers of encoding!
Anonymous 05/03/18 (Thu) 15:25:06 2f6a0b No. 1285971
>>1285905
That is great! Thank you anon!
Anonymous 05/03/18 (Thu) 15:25:08 5e2daf No. 1285972
>>1285964
And Mitch McConnell has ships
Anonymous 05/03/18 (Thu) 15:25:11 f5ed6b No. 1285974
>>1285468
why is it you are such an obvious shill?
filtered
Anonymous 05/03/18 (Thu) 15:25:22 1091ad No. 1285976
15 = O
maybe replace all the 4's with the letter O
>>1285905
Anonymous 05/03/18 (Thu) 15:25:32 c0a23d No. 1285978
>>1285940
Block-chain variant?
Anonymous 05/03/18 (Thu) 15:25:34 5479dd No. 1285979
I think we can use this example from vault seven, and place it to Q photo ID
help autists
Anonymous 05/03/18 (Thu) 15:25:39 aa8e69 No. 1285981
aapl only down 1% if qew was posting something bigly bad news for apple, it would be down more
Anonymous 05/03/18 (Thu) 15:25:41 2f6a0b No. 1285983
>>1285967
Or find the roll 1 of 4
Anonymous 05/03/18 (Thu) 15:25:59 a87a8c No. 1285984
Isn’t this the worst rock and Roll musician ever?
I really can’t stand him or his politics.
Do us a favor U2 Bono and go away forever.
He deserves an “F”
Don’t you agree?
Anonymous 05/03/18 (Thu) 15:26:04 51783e No. 1285985
>>1285923
Looks like a DNA map.
Anonymous 05/03/18 (Thu) 15:26:16 5cda55 No. 1285987
>>1285981
He was just posting pictures of a SpaceShip :)
Anonymous 05/03/18 (Thu) 15:26:21 024e28 No. 1285988
>>1285914
All you need is C to have DNA…
wtf??
Anonymous 05/03/18 (Thu) 15:26:29 ce820e No. 1285989
"JARED DISPOSABLE, RUDY SAYS"
And Rudy is exactly right. Rudy is incorrect when he states people would riot to protect Ivanka - he is mistaken. Ivanka is just as disposable.
When to an internal meeting last night of retired military, mostly fairly recently retired Intel guys, SOF guys, etc. People are PISSED. They have started "ABT" campaign - "Anybody but Trump" - and these people were very, very early on the Trump train and worked hard to "make the impossible possible". One guy brought a $1,500 certified check which he states represents "$10 symbolic donations from 150 people in his small town" to throw into the ABT kitty to generate ground support for a third party protest vote campaign.
Lots of heated anger, this are some of the highlights;
-Trump got elected in part because of his promise to "make sure our Veterans are taken care of". Veterans are being royally screwed over by this Administration, no different than prior admins. The focus should NOT be just fixing the VA hospital system, but the VA disability rating system - Veterans who are combat injured and the majority are WHITE guys are getting maximum ratings of 30% for serious injuries, including TBI with the long term, lifetime consequences that, while POC with "knee pain" have 60 - 80% disability ratings. The raters are also overwhelmingly POC as well, and it is a very racially biased system - biased AGAINST actual combat veterans and in particular, white guys. I can not over explain the depth of anger on this issue, and the WH is completely tone deaf and ignoring this, and it will cost them.
-Veteran hiring. Vets are being offered insultingly low wage jobs in the private sector while any new Fed Civ service jobs that open up are "interviewing" veterans for show, but the jobs all go to internal candidates. In 27 cases given in the slideshow presentation of job placement followup, those internal candidates were initially places as Special appointment by Obama and now have burrowed in. Trump not only refuses to get rid of them, he is refusing to do the same for his supporters. Hand another win over to the Progressives, they have no problem taking care of THEIR supporters while Trump tells his to go pound sand or be grateful for some shitty, low pay work. Trump can go get STUFFED was the consensus.
'White is the new Black". It has become very clear that the Trump administration has decided to chase after the black vote at the expense of white men. Apparently he forgot who got him to the finish line. The Trump attitude is that white guys are "locked in", military votes are "locked in" and therefore they can now treat white men and veterans with the same disdain the Dems have shown blacks. Trump campaign team assumes white male veterans are on their plantation and their votes can be taken for granted. BIG MISTAKE.
Lots of anger about this black chick nominated to be the "first black female General in the USMC". She is not well regarded by the troops and she was an express affirmative action promotion over better qualified white guys for political points. Again - this speaks to the "white is the new black" where the Trump campaign thinks they have the white male vote locked down and will now pander to get black votes. HUGE MISTAKE.
A social media consultant was hired with the initial $7500 put into the kitty, with a bigger rollout and on the ground fundraising campaign planned for May and early June. The ABT will be actively seeking an extreme candidate solely to be a store of protest votes with the goal of being the spoilers in many close districts.
Oh …. and many many references to the "Kushner White House" and not in a good way.
Such a shame. I know that these guys worked their guts out for Trump and honestly thought things would be different. Nope, same lies, same bullshit, same race pandering, same contempt for hard working white guys who are discriminated against simply for being white because it's important to have the "first ___ "
Interesting that Trump pushes the need for an immigration system based in "merit" but not for the military or for the federal civil service. We're back to the same cynical racial spoils system we've had in place since affirmative action took place.
Have fun Trump. Enjoy your whispering advice from liddle Jared. Once you've lost good will it's almost impossible to get it back.
I'm done here as well. Larp or no larp, it's pretty much impossible to support the Kushner White House any longer. I didn't vote to fight more wars for Israel and I sure didn't vote to have our government run by dual citizen Jews who are playing the same tired anti-White, anti-Veteran BS.
t. /out/ pissed off family member of a combat injured, Trump screwed over Veteran. "ABT" indeed. We will NOT be taken for granted.
Anonymous 05/03/18 (Thu) 15:26:47 9ca631 No. 1285992
>>1285240
>>1285096
Add this as well. Xiaomi mascot is a White Rabbit and they are moving into Crypto.
Anonymous 05/03/18 (Thu) 15:26:50 d772c5 No. 1285993
>>1285944
>DNA wannabe spook
We had a lot of shit like that the first couple months.
Makes me think major new happenings are underway.
Anonymous 05/03/18 (Thu) 15:26:53 b40f65 No. 1285995
Anonymous 05/03/18 (Thu) 15:26:59 256a57 No. 1285996
>>1285724
Captain Green was killed during an attempted extraction of a Rothin the UK.
The county where this took place is abbreviated "BAYS". (bunker, apple, yellow, sky)
This has NOTHING to do with apple company.
CONTEXT!
Anonymous 05/03/18 (Thu) 15:27:05 992ef1 No. 1285997
>>1285967
Map
Marks
Landmarks
Markers will build the map
MARKER isn't a marker, it's saying there's a marker there.
Anonymous 05/03/18 (Thu) 15:27:18 4d87a3 No. 1285998
>>1285948
Without question (enter Rudy last night) the Stormy distraction needs to go on a little longer, filling the news cycle with chaos.
Anonymous 05/03/18 (Thu) 15:27:18 8439f9 No. 1285999
>>1285984
i never did like them, only 1 or 2 songs i liked out of whole career