[ / / / / / / / / / / / / / ] [ dir / random / brains / hnt / jewess / qsource / svgc / vrgg / wtp / yapers ]

/qresearch/ -  Q Research

Research and discussion about Q's crumbs

Name
Email
Subject
REC
STOP
Comment *
File
Password (Randomized for file and post deletion; you may also set your own.)
Archive
* = required field[▶Show post options & limits]
Confused? See the FAQ.
Embed
(replaces files and can be used instead)
Options

Allowed file types:jpg, jpeg, gif, png, webp,webm, mp4, mov, pdf
Max filesize is16 MB.
Max image dimensions are15000 x15000.
You may upload5 per post.


Welcome Page | Archive | qnotables archive | Q's Board: /projectdcomms/ | Legacy Boards: /CBTS /TheStorm | TOR link
Practice Bake HERE: /comms | /qrn |

File: 04d99161d854161⋯.jpg (7.44 KB,250x140,25:14,04d99161d854161c86edffc2cc….jpg)

e7da19 No.22294661 [Last50 Posts]

Welcome to Q Research General

We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.

"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness.'

VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH

Q's Latest Posts

>>18284019 Nov. - Dec. 2022

Q's Private Board

>>>/projectdcomms/ & Q's Trip-code: Q!!Hs1Jq13jV6

Find Q drops here

Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku

Q Posts Archives

* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u

* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app

* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news

* Q Raw Text Dumps: q-clock.com/q_raw.txt

* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/

* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188

* Q Research Notables: Archive Board >>>/qnotables/

* Q Adjacent infographs and moar: https://deepstatemappingproject.com/

Q Research Board

Key Resources below. Check DOUGH RESOURCES thread for more: >>17225239

New to QR?

>>17240320 Welcome to Q Research | >>20424387 Board Info

Meme Warfare

MEME WARRIOR UI 1.3 #240904: https://archive.is/3Pe0E

Board History

>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon

TOR Access

TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html

TOR Banner: https://www.youtube.com/watch?v=MLCupx1UEx

____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e7da19 No.22294663

International Q Research Threads

>>22225133 Australia #39

>>21503242 Brazil #1

>>22267360 Canada #69

>>21284558 France #8

>>21435975 Germany #107

>>21988292 Japan #26

>>16694250 Nederland #10

>>21452596 QAJF #2

>>22228099 Scotland #12

>>21699204 Singapore #1

>>20969267 South Africa #13

>>19804572 UK #51

GLOBALS

KNOW YOUR BUNKER = https://endchan.org/qrbunker/catalog.html

>>17322509, >>19089065 Baking Tools & Guidelines

>>20022853 Posting Guidelines for Anons

>>22053329 Administrator JW TripCode

IMPORTANT!Help support 8KUN

>>21438634, >>21189998, >>21462480, >>21190032, >>21543513 @thejimwatkins: Is it worth keeping 8kun online?? (Make bitcoin pmts via Proto)

>>18024378, >>18561054, >>21587855 PROTO Instructions & CONTACT info for Q's or problems

Please Support The Watkins Project #8KUN [DONATE LINK ABOVE]

Follow The Owner: Jim Watkins x.com/thejimwatkins/

Bookmark Watkins Report: https://watkinsreport.com/

Advertise Here: ads@isitwetyet.com

Donate Bitcoin: 1KiJD44WeWKaDb4Newr7bDXadtGn21ACqY

Proto Membership: https://shop.isitwetyet.com/p/Proto-membership/ (Coin Accepted)

Send Anonymous Money Orders: Is It Wet Yet, Inc at 2118 Wilshire Blvd #403 Santa Monica, CA. 90403

Buy Merchandise: (Coin Accepted)

- https://shop.isitwetyet.com/ (proto levels / donations)

- https://shoppers.isitwetyet.com/ (misc.)

- https://www.p2pprinting.com/8kun (clothing)

- https://goodstuffcoffee.com/8kuncoffee/ (covfefe)

ANONS: Stay positive, Eyes on the GOAL, not the OBSTACLES!

NOTABLES ARE NOT ENDORSEMENTS

#27270 >>22293896

>>22294472 @DanScavino - 16 DAYS⏳

>>22294502, >>22294507 Babylon Bee: Brit arrest for make meme offensive to child rapists

>>22294555 Why Washington Post cartoonist QUIT over this risky drawing that the paper rejected

>>22294573 Reform just six points off becoming biggest party, says election predictor. Electoral Calculus analysis shows Nigel Farage’s party could leapfrog both Conservatives and Labour if it continues to pick up support

>>22294609 Woman arrested in Airway Heights on suspicion of possessing multiple explosive devices

>>22294658 #27270

#27269 >>22292828

>>22292874 Dough claim

>>22292841 Col. John Mills: “This Is A Chinese Malign Influence That Could Topple South Korea.”

>>22292885 Texas high school football team takes to the field with American flags

>>22292895 Lionel Messi SNUBBED Joe Biden, and skipped the Presidential Medal of Freedom ceremony, where he was supposed to receive the award

>>22293089 Rep. Chip Roy: "We Need To Hold The Speaker Accountable And That Needs To Start Now"

>>22293279, >>22293284 Indie filmmaker Jeff Baena, Aubrey Plaza’s husband, found dead at Los Angeles home

>>22293708 Army CID offers $10,000 reward for stolen HMMWV doors that no one likes

>>22293730 ITALIAN PM MELONI ARRIVES AT MAR-A-LAGO FOR DINNER WITH TRUMP

>>22293779 @RepMTG - Jan 6th at 1:00 pm Congress must certify President Trump’s historic election. Washington has a winter storm warning for Jan 5-7th expecting possibly a foot of snow. Many members of congress left town this weekend even though they were told to stay. I’m here and will walk to the Capitol if I have to.

>>22293885 #27269

#27268 >>22291778

>>22291832, >>22291842 Morgan Ortagus appointed as Deputy Special Presidential Envoy for Middle East Peace

>>22291833, >>22291873 @ChanelRion - Why did Biden REMOVE this clause from Policy Directive 28?

>>22291844 Biden awarded Medal of Freedom to Jose Andres who appears in photos with RYAN ROUTH

>>22291915 Loop Capitalis in the deltas for tomorrow.

>>22291988, >>22292015 Now Tim Walz is suddenly concerned about the massive fraud occurring in Minnesota

>>22292003, >>22292511, >>22292623, >>22292736 Hillary walks past Oval Office, stops, hangs her head and keeps moving

>>22292007 A 2.7 magnitude earthquake was felt in the eastern West Bank on Saturday night

>>22292053 Hamas published a video of hostage Liri Albag on Saturday.

>>22292080 (ICE) has halted two programs aimed at providing social services to undocumented immigrants

>>22292086 @SenAdamSchiff - California is a big state with big dreams

>>22292112 @babylonbee FBI Turns Itself In For Planting Jan 6 Pipe Bomb To Collect $500,000 Reward From FBI

>>22292129 @Papi OK, WHO DID THIS???

>>22292159, >>22292337, >>22292366, >>22292399, >>22292537 Jimmy Carter Memorial Service @Carter Center

>>22292265 JUST IN: 🇦🇹 Austria's Chancellor Karl Nehammer resigns.

>>22292286 Grrr Ben Garrison - responds to new X policy - Wish Him Luck!

>>22292290 @ADL - Radicalized Bad Pepe still bad

>>22292365 Joe Rogan re-tweeted this post about DMSO (natural painkiller)

>>22292426 Ezra Cohen On Biden’s Middle Of The Night Changes To Orders Of Succession

>>22292539, >>22292540, >>22292712, >>22292793 @WarRoom on Medal of Freedom

>>22292610 Costello on Livelsberger "He's Making A Claim That The Drones We've Been Seeing Are From China"

>>22292656 Musk's Hypocrisy: X will Alter Algorithm to Suppress "Negativity"

>>22292663 @JDVance1 Biden giving the Presidential Medal of Freedom (posthumously) to Pol Pot and Count Dracula.

>>22292727, >>22292763 Jabbar used a very rare explosive compound in the two devices - Meaning he had help

>>22292746 Destroying National Sovereignty All Over The World

>>22292804, >>22292809 Puerto Rico’s New Governor Breaks Out the Trump Dance at Inaugural Ball

>>22292813 #27268

#27267 >>22290955

>>22290982 Prince William shocked by death of ex-nanny's stepson in New Orleans attack

>>22290993, >>22291283, >>22291301, >>22291315 Ezra Cohen @Warroom - Potato changed the orders of succession last night?

>>22290985, >>22291032, >>22291202, >>22291273, >>22291452, >>22291456 Ft. Bragg Deaths & Psyops DIG

>>22290998, >>22291016, >>22291368 The cybertruck psyop has failed spectacularly. People are too awake

>>22291003 US NSA Jake Sullivan visits India on Jan 5-6

>>22291015, >>22291309, >>22291474 Today in Q Post History we have 04 Deltas - 7/10 - What Makes A Movie GOOD?

>>22291029, >>22291058, >>22291290, >>22291403 WINTER STORM BLAIR Incoming! Calm Before The Storm

>>22291041, >>22291045 EAS Time - Everybody would believe everything, if it only comes out of TV

>>22291066, >>22291083 Ford recalls nearly 400,000 trucks, SUVs, other vehicles

>>22291070 Loop Capital reiterates Buy on McDonald's stock despite sluggish same-store sales

>>22291086, >>22291374 Jimmy Carter funeral: LIVE state service in Georgia

>>22291088 Far Left, BLM, Hamas Caucus Hosts ‘Peace Ball’ During Trump Inaugural Week

>>22291102 DOD, GSA, NASA Recommend Changes to Cyber Acquisition Rules

>>22291139, >>22291140 Elon Musk: “We’re going straight to Mars. The Moon is a distraction.”

>>22291141, >>22291171, >>22291211 @elonmusk Posting on the Grooming Rape Gangs Targeting Thousands of British Girls

>>22291220 ICYMI “Drone Rodeo” at the Constellis Training Facility (CTF) in Moyock, NC Oct 2024

>>22291225, >>22291245, >>22291270, >>22291327, >>22291381, >>22291394, >>22291458, >>22291470, >>22291482, >>22291721 NASA UAP Drone Space Related

>>22291288, >>22291292 MSNBC The United States Army is a much bigger problem than the southern border

>>22291303 Honduras President Threatens to Shut Down U.S. Military Base Over Trump’s Plan to Deport Illegal Honduran Immigrants

>>22291346 Sonny Smart, father of Georgia head coach Kirby Smart, dies after fall in New Orleans

>>22291358 ALLY CARTER NEW YEARS LIVESTREAM ASKING JAGUAR WRIGHT ABOUT…THE CHILDREN

>>22291375 @realDonaldTrump There has never been a President who was so evilly and illegally treated as I.

>>22291391, >>22291405 Deborah Birx sparks controversy with new bird flu warnings

>>22291407, >>22291409, >>22291421, >>22291564, >>22291571 George Soros Is Awarded the Presidential Medal of Freedom

>>22291416 U-Haul report places Illinois near the bottom of places people are moving to

>>22291441 Dramatic moment huge blast rocks Russian gas terminal after drone attack

>>22291501, >>22291521, >>22291715 Biden's Presidential Medals of Freedom – Says They Made World a ‘Better Place’

>>22291509 The Propaganda Push For Digital ID Kicks Into Gear In The UK

>>22291513 Michigan to Clear 400 Acres of Forest to Build Chinese-Made Solar Panel Farm

>>22291536, >>22291558 @Papi - Biden awards Hitler, Hannibal Lecter and The Devil the Presidential Medal of Freedom

>>22291574 Livelsberger's Alleged 'Manifesto' Says Gravitic Propulsion Drones To China 'Attack'

>>22291597, >>22291613 @carolrosenberg - Guantánamo Bay News GITMO

>>22291639, >>22291747 Russian Attackers Swarm Ukrainian Defensive Positions With Scooters, ATVs and Motorcycles

>>22291649 BlackRock offloads 3,510 Bitcoin, marking its largest outflow ever

>>22291767 #27267

#27266 >>22289987

>>22290012 Biden blocks Japan's Nippon Steel from buying US Steel

>>22290033 Elon Musk has shared Tommy Robinson’s documentary “Silenced”. This now has over 100 million views.

>>22290049, >>22290211 Biden to present Hillary Clinton, George Soros and 17 others the Presidential Medal of Freedom

>>22290066 DISGUSTING: MSNBC Host Lawrence O’Donnell Says American Veterans Are Greater Terror Threat Than Illegals Crossing the Border (VIDEO)

>>22290073 Illegal migrant accused of stashing AR-15, $750,000 in drugs at taxpayer-funded hotel

>>22290166 Senator’s Young Son Tells Kamala Harris ‘I’m Sorry You Didn’t Win’ The Election

>>22290177 EU Commission President Ursula von der Leyen is seriously ill with pneumonia - has cancelled engagements in the first two weeks of January 2025

>>22290258 New Orleans attacker had a transmitter to set off explosive devices, F.B.I. says

>>22290271 4 people shot in Washington DC last night in apparent mass shooting.

>>22290315, >>22290364, >>22290368 Biden is also awarding a posthumous Presidential Medal Of Freedom to Robert F. Kennedy, the list

>>22290389, >>22290445, >>22290667, >>22290765, >>22290777, >>22290814 Greenland/Thule???

>>22290440, >>22290768 ICYMI: @GenFlynn on NOLA/royal interest in NO???

>>22290495, >>22290499, >>22290633, >>22290640, >>22290657, >>22290739 Moar cyber explosion LV *WARNING: Psyop Smell Intensifies*

>>22290601, >>22290594, >>22290830 Farage/Robinson

>>22290607 Thanks to Bill Gates, ‘OPT’ Is What’s REALLY Killing American Jobs

>>22290620 Caste behind bars: In Indian prisons, the marginalized

>>22290650, >>22290668 Americans FUME After Adam Schiff Announces New Senate Committee Assignments

>>22290675 Thomas Jefferson’s Prayer for The Nation

>>22290693 Biden administration accused of covering up directed energy weapon attacks on intelligence officers

>>22290698 CFPB sues JPMorgan, Wells Fargo and BofA for gross negligence that cost consumers over $870M

>>22290716 Top 10 most alarming crime statistics in the U.S.

>>22290728 Brain implants and the erosion of privacy: Are our thoughts safe from manipulation?

>>22290730 1,000 Al-Qaeda fighters in U.S. as open borders fuel terror threat???

>>22290762 Gold Confiscation and 14 Other Government Screwups

>>22290815, >>22290865, >>22290896, >>22290920, >>22290929, >>22290939 NASA/Space/Science

>>22290828 Dasting History: New Orleans, 1972.

>>22290903 A note from Turo CEO Andre Haddad

>>22290947 #27266

#27265 >>22289171

>>22289214 Dough claim

>>22289311 Honduras President Xiomara Castro just issued a threat to President Trump, saying she'll shutdown U.S. military bases if he deports Honduran nationals.

>>22289655 @realDonaldTrump - The Democrats are all “giddy” about our magnificent American Flag potentially being at “half mast” during my Inauguration. They think it’s so great, and are so happy about it because, in actuality, they don’t love our Country, they only think about themselves.

>>22289772 @SLDelta45 - The Trusted Traveler program has been suspended at Patrick SFB & Cape Canaveral SFS. Any individuals WITHOUT a DoD-approved access credential (e.g. CAC, dependent ID, retiree ID) will be required to obtain a visitor pass.

>>22289783 @SpaceForceDoD Protect – Defend – Deliver 💪

>>22289815 🇦🇶🇨🇱President Gabriel Boric Font launched Operation Pole Star III, the first visit by a sitting Latin American president to the southernmost Antarctic extreme.

>>22289947 Washington State Democrats Accidentally Leak Their ‘Radical’ Tax Plan

>>22289979 #27265

Previously Collected

>>22287661 #27262, >>22288460 #27263, >>22289160 #27264

>>22285281 #27259, >>22286102 #27260, >>22286884 #27261

>>22282471 #27256, >>22283284 #27257, >>22284254 #27258

>>22279871 #27253, >>22280788 #27254, >>22281667 #27255

Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com

Q Research Notables Archive Board >>>/qnotables/

Q Research Notables #26: High Hopes >>22083727

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e7da19 No.22294667

File: ffc1ce297656e4b⋯.png (1.54 MB,1057x793,1057:793,geneticmemory.png)

Dough; Looking for handoff or ghosting shortly

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e7da19 No.22294671

File: a88d99261973c09⋯.jpg (62.65 KB,639x403,639:403,7937677646_ee03e55794_z.jpg)

Dough; Looking for handoff or ghosting shortly.

https://pastebin.us/?33e605efaf2058e1#AwbScA9Ked617ivygWiDsi8WAaPshomz2phMgz66qnUE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

41f373 No.22294674

File: fde39fe1498e90f⋯.jpg (124.82 KB,1182x747,394:249,britt.JPG)

Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

https://www.hollywoodreporter.com/tv/tv-news/britt-allcroft-dead-thomas-the-tank-engine-1236098959/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

62a0f1 No.22294677

File: 8aa9ef3bba2ce46⋯.mp4 (3.7 MB,720x1280,9:16,8aa9ef3bba2ce46d92f9a8122d….mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

51ab55 No.22294680

>>22294674

Don’t click that shit, nigga

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b1ceda No.22294682

YouTube embed. Click thumbnail to play.

Alberta’s $70 Billion AI Data Center

Holy fuck. Alberta's premiere just said Canada has 200 trillion tcf of oil.

That is worth:

$2.644897959183673 × 10^27

$26,000,000,000,000,000,000,000,000,000

https://www.youtube.com/watch?v=yVKxjAQyMTg

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294683

File: 5d1ee3bb912f316⋯.jpeg (157.21 KB,1195x1280,239:256,IMG_7672.jpeg)

WOMAN’s Breasts go from B cup to GGG cup after COVID-19 VACCINE.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294684

File: 17205ce6a54aedf⋯.mp4 (688.52 KB,644x360,161:90,ssstwitter_com_17360480569….mp4)

File: 642d104e78f06e9⋯.png (331.6 KB,824x721,8:7,2025_01_04_22_13_25.png)

>>22294671

TY BAKER

@nicksortor

🚨 JUST IN: New video has just been released of the Cybertruck being detonated at Trump Las Vegas

This is a MUCH better view of the driver

It’s pretty obvious where the detonation originates, and if you look closely, you can see the driver’s head turn

https://x.com/nicksortor/status/1875711087762665630

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ef1f4b No.22294685

File: aa575b3aaff4213⋯.png (1.39 MB,736x920,4:5,ClipboardImage.png)

>>22294671

Thank you, Baker!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

51ab55 No.22294686

File: 54d93d9f7e0dbb7⋯.jpeg (331.04 KB,573x521,573:521,IMG_7496.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294691

File: 02f7fb64a927049⋯.jpeg (68.25 KB,460x750,46:75,IMG_7673.jpeg)

>>22294683

A healthy, nulliparous 19-year-old woman experienced significant breast hypertrophy starting 1 week after receiving the Pfizer COVID-19 vaccine in September 2022. Her medical history was unremarkable, with no hormonal disturbances detected on bloodwork.

The patient initially reported tingling paresthesia in her breasts, followed by sudden bilateral growth which worsened after receiving the second vaccine dose. Over 6 months, her breast size increased from a B cup to a triple G (Fig. 1). Physical examination revealed dense, warm, edematous, ptotic breasts with no palpable masses or axillary lymphadenopathy.

https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx

The “Pfizer Boob Job”: A Case of Unexplained Gigantomastia

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b1ceda No.22294693

>>22294686

Fuck free energy; I'm rich, biatch!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a1dea8 No.22294694

Ignore the strange particle fog. No one at a university should use their vacuum cleaner to sample it and put it under an electron microscope. If they do, they should not conduct an elemental analysis using x-rays. No one who does this should put the results on X.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294695

File: 9fd3db4a37d271d⋯.png (318.78 KB,470x373,470:373,Screen_Shot_2025_01_05_at_….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b1ceda No.22294696

>>22294691

Wouldn't there be serious stretch marks all over her tits for that kind of growth within a week?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294697

File: cb0e3eb4ae8c5a4⋯.jpg (765.15 KB,1545x1536,515:512,IMG_6479.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1df607 No.22294698

I like the cut of your jib fren

>>22294694

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4dcc07 No.22294701

File: ec0947188d38b14⋯.png (4.17 MB,1332x1990,666:995,Screenshot_2025_01_04_at_1….png)

The Maid of Orleans in New Orleans

Because of the deep French roots in New Orleans, Joan of Arc has long been honored here. The French were the first European settlers to lay claim to this land (that had already long been occupied by Native American tribes), and Orléans, the saint’s birthplace, is a sister city of NOLA. For the past 15 years, we have celebrated Joan of Arc’s birthday, January 6, in one of the city’s best loved traditions: with a parade! The saint’s birthday happens to fall on Twelfth Night, the end of the Christmas season and the official start of Carnival season here in New Orleans.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5ece76 No.22294706

File: 62c9340f352137a⋯.jpg (7.43 KB,255x215,51:43,00ed9b8a21d185aaa99985a508….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294708

>>22294682

and if it were to hit the market, it's not worth that. And that's in dollars. And using that oil would take years, the years in which oil is in less demand. Still quite the product

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9b2eb8 No.22294709

YouTube embed. Click thumbnail to play.

01-04-2025 Kansas City, MO -Crazy Pile-Up on I-470 Ice-Covered Roads Lead to Multi-Vehicle Crash

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d6db1d No.22294711

File: 19581a21cdb1af3⋯.mp4 (1.33 MB,480x852,40:71,PeacePause_MorbidGorlockOv….mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294712

File: de189fa600e00eb⋯.png (426.25 KB,500x611,500:611,ClipboardImage.png)

File: 2ff6fe1054fccdf⋯.png (160.64 KB,640x408,80:51,ClipboardImage.png)

File: b364bb23e9382b5⋯.gif (9.99 MB,540x570,18:19,gif.gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b6214f No.22294714

File: b14778265542fb6⋯.jpeg (11.59 KB,211x250,211:250,b14778265542fb60061776d34….jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e7da19 No.22294715

File: add7812c6927cd7⋯.png (296.26 KB,575x433,575:433,scbbydoo3.png)

>>22294671

Bread is ghosted

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5ece76 No.22294716

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a1dea8 No.22294717

>>22294698

.>>1234567

WWG1WGA!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1df607 No.22294718

>>22294683

You know someone somewhere is thinking how to perfect this to sell it as the new way to enlarge breasts no surgery required.

It will be an off label use for vaccines like Botox is used off label for wrinkles, headaches and sweat reduction.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294720

>>22294715

Bless you, baker.

Good night.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b1ceda No.22294721

>>22294708

Knock off a couple 0s and that's still unfathomable amounts of $.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1df607 No.22294722

>>22294698

>>22294717

>>22294694

Whomever does this should film each step of the experiment.

Including the vacuuming.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b0805f No.22294723

>>22294691

If that were true

There would be Stretch Marks

& there are none

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

10c0fd No.22294724

File: 24b3b73bd51995e⋯.png (270.96 KB,593x867,593:867,ClipboardImage.png)

File: eb975f2f0e4259d⋯.png (389.44 KB,951x532,951:532,ClipboardImage.png)

File: 7c5bbebee4d87de⋯.png (163.65 KB,737x593,737:593,ClipboardImage.png)

File: d8b82da4b49f15a⋯.png (1.76 MB,1933x1323,1933:1323,ClipboardImage.png)

>>22294683

>>22294691

>>22294022 (pb)

Case of a 19 year-old woman experiencing significant breast hypertrophy starting 1 week after receiving the Pfizer COVID-19 vaccine in September 2022.

"The patient initially reported tingling paresthesia in her breasts, followed by sudden bilateral growth which worsened after receiving the second vaccine dose. Over 6 months, her breast size increased from a B cup to a triple G."

https://x.com/DrJohnB2/status/1875214374182248677

https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx>>22294691

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b1ceda No.22294725

File: f9d0f1563eeaa77⋯.png (424.24 KB,1429x804,1429:804,ClipboardImage.png)

>>22294721

America is gunna want our juicy asses now.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294726

>>22294701

I know just the girl for that role

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a1dea8 No.22294727

>>22294722

Checkt

Not an experiment, it is environmental sampling

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294729

File: 3753ea4ff1e3d6c⋯.gif (986.8 KB,500x270,50:27,IMG_7675.gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294731

File: 53b11be665b1b89⋯.png (1.78 MB,1280x1013,1280:1013,ClipboardImage.png)

>>22294720

not long for this anon either.

almost mornin

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cf8b41 No.22294732

File: e671957026eba55⋯.jpeg (87.55 KB,504x500,126:125,IMG_0849.jpeg)

15 days…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bebde1 No.22294733

JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE.

✅PRAGERFORCE (IDF Unit 8200)

Recruitment Head

✅AIPAC REPRESENTATIVE (Mossad)

Schusterman High School Summit

✅CHABAD, UNIV. OF ARIZONA (Lubavitch)

Outreach Chair

*NOTE: Chabad Lubavitch is a literal MOSSAD TERRORIST ORGANIZATION. It is PARTNERED with SAVE THE CHILDREN, BOSTON CONSULTING GROUP, CLINTON FOUNDATION and IJM in the same GLOBAL KID TRAFFICKING racket that was recently RAIDED in GUATEMALA, and leads right back to LUBAVITCH HQ in BROOKLYN, NY.

I mean this with every fiber of my being when I say I want these fucking SPY terrorists and kid traffickers out of my fucking country.

Yesterday.🤬🤬🤬

https://x.com/DecentBackup/status/1875040357114691630

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d967e2 No.22294734

File: bfa04df5b63b938⋯.png (358.96 KB,640x531,640:531,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1df607 No.22294735

Whatever it is called, film it all a-Z, then poast on out board

>>22294727

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294736

>>22294721

Count Me Willing To Fathom

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b0805f No.22294737

>>22294734

an Army of Darkness

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294738

File: 5096994c40cccb7⋯.jpg (70.07 KB,581x569,581:569,5096994c40cccb78a1efaeffb7….jpg)

We're gonna have to snowblow this shit in the wind, aren't we?

Anon hates snowblowing in the wind.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294739

File: 6fca75ae90688df⋯.png (834.6 KB,581x745,581:745,6fca75ae90688dfd2a4b329b36….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294741

File: 50acfe61e8d791f⋯.jpeg (19.66 KB,474x266,237:133,IMG_7676.jpeg)

>>22294724

My wife wanted bigger boobs so I told her to try rubbing toilet paper between her breasts as it had worked on her ass.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4dcc07 No.22294742

America was French first? Statue of Liberty makes moer sense now

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ef1f4b No.22294743

>>22294691

Eleven months post vaccine, the plastic surgery team opted for bilateral reduction mammoplasty, as breast growth had stabilized for 5 months and comprehensive work-up was normal.

Left and right specimens weighed 1906 and 1664 g, respectively, reducing her breast size from a triple G to a double D

At 5 months postoperation, breast asymmetry and areolar hypopigmentation were noted.

https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9b2eb8 No.22294744

File: 5b037f570a99ee2⋯.jpg (10.06 KB,191x275,191:275,5b037f570a99ee28fd73972276….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22294745

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294747

File: c8d0a0a47a5ee71⋯.png (212.14 KB,765x1280,153:256,ClipboardImage.png)

File: 281783ca9cb5ba2⋯.png (310.95 KB,777x1280,777:1280,ClipboardImage.png)

File: 999975f71649b00⋯.png (299.17 KB,742x1280,371:640,ClipboardImage.png)

no source but anons on x can try out these question on grok.

no anon is not a jew hater

just a look at the programmers input

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d967e2 No.22294748

File: b9a46b27cf0141b⋯.png (3.33 MB,1080x1316,270:329,ClipboardImage.png)

TY B

seen you got my sight

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4cebfe No.22294749

File: cec75eac04226b4⋯.jpg (78.16 KB,600x429,200:143,cartoonfromMay2017.jpg)

>>22294638

>>22294641

yeah, we're like an index?

but it was hinted that this project is for this:

They, the people deep inside, who are in charge of being watchdogs, can do investigations on a high level using super-FISA or whatever detailed mass surveillance to see whatever they need to know BUT without a Probably Cause, or prerequisite (can't think of a more technical term) they can't look anywhere, because that would be illegal

So they use our open source work for their probably cause.

they can't follow the investigation nor turn it into actual indictments without the original tip, even if they knew the information themselves, because of their position- because it's disallowed.

To keep it robust, legal and to avoid the security secrecy laws, (since they are under those and don't want to break them)

they can take what we say and find -what we figure out, (as though we are informants) - sine all we do is open source, so we find it on our own, no secrecy laws are abridged.

Nobody 's telling us.

That's also why the q texts were structured as they were.

The super-police who need to stop the nonsense that's going on, can use what we discover on our own as a jump off point for their deeper investigations, legally.

We do have our own informants occasionally who may point where to look, but who never tell us outright; much like Q itself.

Catch is: we have to prove it to ourselves, since we don't know which is which; disinformation mixed with information.

Q is same. Mixes in disinfo

Such as "Trust Wray" etc. etc.

So our work is not used for the purpose to tag what needs to be erased.

Nothing is ever erased.

If anything, we spread things the crooks would like to have erased

>>22294678

>>22294661

>>22294663

tyb

Hillary's still claiming that Russia Backs DJT

"everybody knows"

"So democrats should as for the backing of China"

WUT

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d967e2 No.22294750

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294751

areolar hypopigmentation

NOTABLE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4cebfe No.22294753

File: 88de10c0cd1a250⋯.jpg (200.92 KB,1024x768,4:3,109_dangerous_freedom.jpg)

>>22294749

everything, all of it is

Lb

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bebde1 No.22294754

File: e60229f06b7da9c⋯.jpg (195.67 KB,1319x1761,1319:1761,GgWTnGZXIAA97XW.jpg)

File: 0dc7c62a2b36fd0⋯.jpg (10.36 KB,200x250,4:5,GgWTnGaXIAA_UDY.jpg)

>>22294733

CHABAD: These are the same people, fyi.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22294755

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294756

File: 2e007a7f3644335⋯.png (424.86 KB,469x529,469:529,Screen_Shot_2019_02_05_at_….png)

>>22294751

>areolar hypopigmentation

Is there a market for albino nipples?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294757

>>22294749

Sounds logical but things posted here disappear.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4dcc07 No.22294758

File: 0ed80f27ffb13ba⋯.jpg (1.23 MB,2500x3333,2500:3333,joaparade.JPG)

Revelers line the streets of the famed French Quarter to watch this unique procession that is part history lesson, part pageantry, and fully New Orleans. Parade participants (known as the krewe) dress as a wide cast of characters from angels to foot soldiers to prominent figures from the saint’s history, as well as several versions of Joan at different points in her life. Krewe members pass out handmade throws, and the crowd cheers as the young woman who portrays Joan rides by on her horse.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

51ab55 No.22294761

File: fb580386de2a42f⋯.png (690.78 KB,750x1005,50:67,ClipboardImage.png)

It’s m’an!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294762

File: d608e8dab6b040b⋯.jpeg (30.75 KB,474x258,79:43,IMG_7677.jpeg)

File: d3074d73350a87a⋯.jpeg (63.25 KB,735x987,35:47,IMG_7679.jpeg)

How to get more retards to take the clot shots tell them it makes your boobs or cock bigger.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4cebfe No.22294763

>>22294757

they disappear from the public.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4dcc07 No.22294764

File: e2a83a248256963⋯.jpg (51.97 KB,737x500,737:500,5e13e044a6955_image.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4cebfe No.22294765

>>22294757

We're told to save everything offline.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

51ab55 No.22294766

File: 9c330ed34a708f6⋯.jpeg (21.43 KB,400x224,25:14,IMG_7562.jpeg)

>>22294762

It will grow your bobs!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294768

>>22294763

Buried in mountains of fake stories, search engines will never find them.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294770

.

>>22294757

which is why it is good to archive on secondary site and offline plus archive sites.

adjust adapt and keep moving forward.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294771

>>22294770

Just a lone person not part of any Company

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

51ab55 No.22294772

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4cebfe No.22294773

>>22294768

it's not for search engines.

Search engines are controlled.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294774

>>22294773

Good you know how you do it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294775

>>22294731

>>22294739

Gnight responsible fam

Don't adopt the dreams of your neighbors

Have your own

Unless you have great neighbors

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4cebfe No.22294777

>>22294770

Archives are also scrubbed of certain data / info.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294778

>>22294771

neither is anon

but if you name a subject

anons internet search skills plus archives are pretty good

anon if this anon cannot find it

there will another anon who will post it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

51ab55 No.22294779

File: 79d4eaafbba7466⋯.jpeg (346.51 KB,750x845,150:169,IMG_7584.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bebde1 No.22294780

KLEINER PERKINS: Genentech, Google, Ghislane.

💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥

“ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER.”

“We knew about her supplying underage girls for sex, but I guess that was fine for the ‘cool’ people who managed the TIGHTLY CONTROLLED GUEST LIST,” she added.

Oh. So the COVID BIOTERRORISTS are the SAME GROUP as the EPSTEIN/MAXWELL/MOSSAD KID TRAFFICKERS after all. Weird.

And THAT explains why SILICON VALLEY is chock full of TECH COMPANIES “founded” by IDF UNIT 8200 retreads grabbing the LION’S SHARE of IN-Q-TEL/CIA (American TAXPAYER) FUNDING, while actively building platforms to PREVENT AMERICAN WHITES from getting similar opportunities across a number of key professional domains.

Imagine all THAT, sports fans.

https://x.com/DecentBackup/status/1875639750155014575

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294781

File: 2f24d3959486f79⋯.jpeg (23.01 KB,320x484,80:121,2f24d3959486f7902304eebfe….jpeg)

>>22294762

Anon always preferred B or C cup anyway.

Will leave the ginormous bewbs to niggas who can palm a basketball.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294783

File: 894e161e92be8f9⋯.png (43.95 KB,566x156,283:78,ClipboardImage.png)

>>22294780

you know this post will get forwarded at some point.

but this was known to anons.

reddit was their safe space

now it is login only access

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b6d3ab No.22294785

https://en.wikipedia.org/wiki/Barak_(name)

Barak ("lightning") is a masculine name of Hebrew origin. It appears in the biblical Book of Judges as the name of the Israelite general Barak, who alongside Deborah led an attack against the forces of King Jabin of Hazor.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294786

>>22294778

Jesuit Anon?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294787

>>22294781

At age 100 no preference

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294788

File: 7630b5b60499031⋯.jpeg (484.23 KB,846x697,846:697,IMG_7683.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294789

File: 6d2f7c0a6852f96⋯.png (488.68 KB,667x374,667:374,ClipboardImage.png)

>>22294786

you continue to project

try another name.

how about calling anon something new

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294790

When everything about the Jesuits and their Minions Roman Catholics is filtered it makes me know that many Anons are Jesuits Filtering all mention of the Roman Catholic Church and all the Evil things they do.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

042c47 No.22294791

File: 57bd37ff6b1374f⋯.mp4 (2.66 MB,632x360,79:45,000_Alonese_and_Gates_Mala….mp4)

File: aa255b666145c12⋯.mp4 (2.29 MB,640x360,16:9,000_Gates_Klaus_2008_legac….mp4)

Bill Gates is with the AUS GOV blessing, planning to release Malaria Mosquito's.

He's done it before back in 2019

https://www.worldmosquitoprogram.org/en/news-stories/stories/far-north-queensland-essentially-dengue-free

Anon isn't sure if the statements are in context, or if you could be mistaken.

Nope, he's a shitcunt.

Humanspective

@Humanspective

·

6h

Australian PM: “I’ve admired your work”.

Doesn’t look like we’ll get much push back from the Prime Minister against genetically modified Oxitec mosquitoes.

Wonder if Anthony Albanese has seen what Bill Gates has been up to in Kenya

https://x.com/Humanspective/status/1875701084498620750

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294792

File: cf5fff869adce58⋯.jpeg (139.03 KB,884x691,884:691,IMG_7684.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294793

File: 632e24e7226396e⋯.jpeg (69.94 KB,308x420,11:15,BigMike_DFTF_01.JPEG)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294794

File: f6f910ff4377197⋯.jpg (10.28 KB,320x300,16:15,f6f910ff4377197aac5491167d….jpg)

>>22294787

>At age 100 no preference

At age 100, there's always a zipper hazard.

kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

73a8d7 No.22294795

>>22289005 lb

This

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294796

>>22294794

You are assuming our future involves clothing? Much less zippers

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

de14f2 No.22294797

File: 7ae88f79e9beb54⋯.png (477.63 KB,477x528,159:176,Babe_with_lurking_Pepe_s.PNG)

>>22294781

Mmm boobs

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294798

File: bcf361eef60afaa⋯.jpeg (22.02 KB,255x215,51:43,bcf361eef60afaa5c9d6ae2c4….jpeg)

>>22294796

>You are assuming our future involves clothing?

Anon would just like to emigrate to the moon where bewbs only get 1/6 gravity.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294800

File: f3ec3770c2c1df0⋯.jpeg (40.84 KB,595x344,595:344,566e9cbd770de94e5b194408f….jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294801

File: 1c1ca9d84b4880c⋯.png (667.21 KB,500x553,500:553,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294802

Those filtering everything Roman Catholic on this Board must know that Many Roman Catholics have already Confessed.

You Know that we know but yet you continue

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294803

>>22294802

stop hidin v.d

anon can see you

filtered

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b0805f No.22294805

Trust only in God

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294806

Good people who became RCMP to do good found out they are the Baddies and have switched to the good side.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294807

File: 4a4fa1ace6d2881⋯.gif (1.79 MB,300x398,150:199,4a4fa1ace6d2881ce3fdf908da….gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294808

>>22294807

watch the water

seriously see if you can watch the water

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22294814

File: e51948acbbaee6d⋯.png (75.34 KB,777x1024,777:1024,ClipboardImage.png)

>>22294671

Tyb

>>22294715

Claiming Bake

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22294815

>>22294460 lb

im thinking ill juss skip this.

Shawn's a nice enough guy, but i don't want to hear shitall from "C_A". Every one i ever heard is a smug fuck always winking at the audience that they know more stuff than they can say outloud, but still want people to believe the 'oh so generous' little crumbs.

9/11 was an inside job

start there and i might listen, ya "IC" shitbags

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22294817

>>22294747

How many non-Jews died in WW2 so that the Jews could establish Israel?

Were those camps meant to protect the Jews?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b6d3ab No.22294818

https://www.instagram.com/jennieontheborder/reel/DEV5luWOyrp/

https://x.com/JennieSTaer/status/1874956197457244497

https://nypost.com/2025/01/02/us-news/new-orleans-isis-terrorist-shamsud-din-jabbar-had-bomb-making-station-and-quran-open-to-chilling-passage-new-photos-reveal/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

62a0f1 No.22294819

File: 02b2621e27175cf⋯.jpeg (219.58 KB,768x960,4:5,02b2621e27175cf0d7c954166….jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294820

>>22294815

oh great another one of these 'witholding information is a power play' types

can't you imagine that it might also be because they are cowards?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294823

>>22294821

I thought it sounded like sciency nipples, which are my favorite kind

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

62a0f1 No.22294824

File: a03788bda719e0f⋯.png (353.61 KB,445x835,89:167,ec6a99e737f32fcac7a1e7663c….png)

>>22294811

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22294825

>>>22292895 Lionel Messi SNUBBED Joe Biden, and skipped the Presidential Medal of Freedom ceremony, where he was supposed to receive the award

What's interesting is although he was awarded the medal, non-citizens cannot be awarded the medal…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294829

>>22294817

Had three family members in Palestine in 1936 preparing for the flood of Fake Jews from Europe.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294830

>>22294814

got some notes, baker, take what you want and leave the rest

KEK

#27271 >>22294671

>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

>>22294682 Alberta’s $70 Billion AI Data Center

>>22294683, >>22294691, >>22294743 The “Pfizer Boob Job”: A Case of Unexplained Gigantomastia

>>22294709 01-04-2025 Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads

>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE

>>22294749 Anons discuss purpose of /qresearch

>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL

>>22294791 Bill Gates is with the AUSRALIAN GOV blessing, planning to release Malaria Mosquito's

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22294837

>>22294829

Why were the Fake Jews so intent on that tiny bit of land? Do they really think they are entitled to it for thinking that they are "God's Chosen People?" Or is there moar to it?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294839

>>22294837

Biblical lands need for the big religious Con, how much fake artifacts have been found and authenticated by the makers?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294841

>>22294830

>>22294831

>that's NOT a high explosive….

u know more than i would

baker can either drop it or add your comment

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22294842

>>22294839

So it's all about setting up a seat for their Anti-Christ?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22294843

File: 7b3371ca808d301⋯.png (7.8 KB,131x162,131:162,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22294844

>>22294820

if she's 'a coward' on Shawn Ryan's show (and so she's compromised?), then still untrustworthy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294846

>>22294842

Good as anything else, holds so much power for Casting Spells, they are just slaves of Rome as is the world.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fdfd1b No.22294848

File: 170b7d4c8cb4444⋯.jpeg (1.83 MB,3227x2334,3227:2334,IMG_3074.jpeg)

Been gone about 3 years

Can’t believe u faggots are still here

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

73a9df No.22294851

>>22294848

Everything has meaning.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294852

>>22294848

Days of Our Lives

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22294855

>>22294826

Be [they] masterminds or subcontractors…..

There is no way for 9/11 WITHOUT sedition and treason INSIDE the USA

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22294857

>>22294846

Slaves of Rome?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22294860

>>22294837

location

location

location

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4705fe No.22294863

>>22294694

does the X algorithm render the results forbidden?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22294867

File: b06b85b40675459⋯.png (1.26 MB,1080x740,54:37,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294872

>>22294850

makes sense, why i tagged baker.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294877

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22294878

>>22294848

Just Biden' our time waiting for the Return of Trump.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4705fe No.22294879

>>22294854

"get your covid-19 vaccine now to stop the spread and save grandma."

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294884

File: a54949fb3abd489⋯.png (1.34 MB,1080x1557,120:173,Night_Shift_Star_Cats_1009….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294885

>>22294848

where ya been?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

34196f No.22294889

Trinidad and Tobago declares state of emergency after tiny Caribbean nation sees record number of murders in brutal year of bloodshed

…Trinidad and Tobago has declared a state of emergency after the nation saw a record-breaking 623 murders in just one year of bloodshed…

https://www.dailymail.co.uk/news/article-14236739/Trinidad-Tobago-state-emergency-murders.html

article is from December 30, 2024

but maybe still important

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4705fe No.22294892

>>22294822

a way to shut up the vaccine injured through fear of being labeled mentally-ill.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294893

https://rumble.com/v64azfv-america-first-means-reviving-the-american-dream-interview-with-peter-schwei.html

America First Means Reviving the American Dream, Interview with Peter Schweizer | TRIGGERED Ep.203

Donald Trump Jr.

1.55M followers

12/30/2024

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2664fe No.22294895

>>22294844

I don't know her, but if you find someone trustworthy by all means tell me.

I mean other than Ron Paul obviously

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22294899

>>22294791

Bill Gates Plays God Again, Funds Project That Is Turning Mosquitoes Into 'Flying Vaccinators'

by Samuel Short, The Western Journal Jan. 2, 2025 2:40 pm

Bill Gates is dead set on his goal of vaccinating the planet by any means necessary.

His latest project, the Blaze reported Monday, involves funding research for mosquitoes to be “flying vaccinators.”

A grant from the Bill and Melinda Gates Foundation of over $2.2 million dollars for Leiden University Medical Center has the express purpose as follows:

“To improve health outcomes and prevent premature death in populations around the world suffering from high rates of Malaria infection by developing next generation malaria vaccine candidates.”

To that end, LUMC published a study in the New England Journal of Medicine showing their work in using mosquitoes to vaccinate against malaria.

The Blaze highlighted, in the study, GA1 — a malaria parasite modified to stop developing after 24 hours of infection in humans — and GA2 — another parasite that stops developing around six days — were given to a test group of 43 adults via mosquito bites.

Subjects were given 50 bites from either GA1, GA2, or an uninfected mosquito in three sessions at 28-day intervals.

Three weeks following the third session, subjects were administered five bites by malaria infected mosquitoes.

Eight of nine GA2 participants were offered protection from malaria. One of eight from GA1 was protected, and those that received bites from mosquitoes that did not have the parasite did not show protection.

The results are startling for a number of reasons, especially because Gates is working towards engineering a method to vaccinate people without their consent.

Gates noted the ramifications in seeing where the real barriers are to this research being implemented.

“One of our biggest challenges isn’t scientific; it’s financial and political,” he said.

Yes, clearly there are political barriers as lawmakers signing off on a plan to send swarms of “flying vaccinators” into the general public would create pandemonium due to this gross infringement on liberty.

Gates does not care about liberty as he sees humans as a mass of test subjects — something that’s undeniable from his remarks during the coronavirus pandemic.

This is about choice. We do not live in a scientific oligarchy where we simply do what the experts tell us in every facet of our lives. Although adopting the most well-researched means of living sounds appealing on paper, the reality would be misery in having no say in our own existence.

We eat bad food. We are idle Some of us are in poor health. We consciously make the wrong decisions, but we are justifiably able to make them. That is our choice.

Gates may cite a mountain of research indicating how the science backs his position, but the line is drawn when the freedom to choose is taken away.

This article appeared originally on The Western Journal.

https://www.thegatewaypundit.com/2025/01/bill-gates-plays-god-funds-project-turning-mosquitoes/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ab854e No.22294901

>>22294867

Notification of their coming Executions, they know it is coming.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294907

No shills for hours

then

muh joos shill

dear cia shill

Vati shill

all show up within a minute of each other

makes you wonder, doesn't it?

>>22294814

@170

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4705fe No.22294909

what was the nothing that could stop what was coming?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

be7715 No.22294912

File: 887e99f8a571652⋯.png (104.81 KB,648x704,81:88,ClipboardImage.png)

>>22294762

>How to get more retards to take the clot shots tell them it makes your boobs or cock bigger.

Inject it straight into the deep dorsal vein and you will be erect for life.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294916

File: f06ed9d73951c00⋯.png (266.37 KB,581x384,581:384,bfe34798ce565c825e226d5a65….png)

>>22294907

Tanks for nuking them.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294923

>>22294893

'the bidens learned it from the clintons cuz nothing was done when clintons did it' - Schweizer

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22294927

>>22294849

>die clowns

kek

didn't realize at first you were writing in German

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22294933

>>22294895

(yes, other than Ron Paul obviously)

The only reason i think of listening to her being interviewed on Shawn's show… is like the meteorologist taking note of the prevailing winds, barometer and temp

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

446986 No.22294935

MELONI, nice.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

20034e No.22294941

File: ae63e1678ca5c4c⋯.png (145.66 KB,1794x1484,897:742,2025_01_05_02_48_39_15_Tru….png)

https://truthsocial.com/@DC_Draino/posts/113773576356247901

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294944

File: 0664ca3fb341d05⋯.png (2.73 MB,1662x1248,277:208,Ben_Garrison_010142025_spe….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294946

File: dcb7f1b9fc42e99⋯.png (742.32 KB,1200x676,300:169,terrorist_encounters_01022….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294949

File: c9b1a3745c11cf7⋯.png (659.71 KB,1100x612,275:153,ukraine_64_billion_since_f….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294951

File: e190fac15f567ae⋯.png (900.45 KB,1100x607,1100:607,biden_illegal_aliens_10_mi….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294956

File: a525753eccecee5⋯.png (197.77 KB,898x872,449:436,border_Children_12232024.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22294957

File: 8a7fcb5a890dcc0⋯.jpeg (1.86 MB,2752x1838,1376:919,IMG_0035.jpeg)

I filturd one ID and half the posts went away.

Why is China so nigger?

Also, where’s the littlesberger shit? I work for a living and haven’t gotten to see the real tea on dude. Seems like he would be fighting for the good guys.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294960

File: 205b092b8c8c9a4⋯.png (632.02 KB,1100x611,1100:611,GTFO_cavuto_12192024.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294961

>>22294957

vati came back

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294964

File: 76ff88703def28e⋯.png (263.34 KB,1422x879,474:293,socialism_to_communism_121….png)

File: 00672ce0c1ce806⋯.png (682.54 KB,1100x621,1100:621,socialist_barandon_johnson….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22294966

>>22294951

10.7 Million million is a lot, anon

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294968

File: 75985a169359e45⋯.png (292.61 KB,977x983,977:983,gaslight_population_121620….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22294970

File: 6b7eb4e568f5175⋯.png (1003.52 KB,854x749,122:107,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294971

File: c1c162066ef0dfe⋯.png (729.06 KB,900x496,225:124,chicago_city_council_appro….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294973

>>22294916

more fun shitposting.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d744b8 No.22294974

File: d7b6cc31db14679⋯.png (446.75 KB,512x500,128:125,ClipboardImage.png)

>>22294848

wb

you look like you got aids

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294975

File: 224b1d6ec4dd899⋯.png (745.53 KB,1200x667,1200:667,abortion_states_04092024.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294976

File: bec2510dae715cc⋯.png (629.32 KB,900x503,900:503,2023_bragg_has_downgraded_….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22294977

>>22294963

>SF command

Star Fleet Command?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294979

File: 875d386324c970f⋯.png (437.98 KB,900x493,900:493,bag_of_washers_cost_milita….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22294981

>>22294957

>littlesberger

Lots of dustup from Shawn Ryan Show interviews

Now rumors that Shawn packed his family and went bugout

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

190f29 No.22294982

>>22294975

mainly black kids aborted too

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294983

File: bbd49f0a80a7327⋯.png (636.37 KB,900x509,900:509,chinese_nationals_illegall….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22294984

>>22294981

shawn didn't look too comfy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294987

File: 30bee59a7b7c8a9⋯.png (280.34 KB,818x482,409:241,margaret_sanger.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22294988

>>22294967

> govt sucks same as here

Yeah that’s certainly true.

I like most chinese peeble i meet. They generally have an ability to laugh at themselves and a brutally honest perspective on things.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22294989

File: 9433ead9ce524a5⋯.png (325.18 KB,881x875,881:875,4_step_plan_to_hide_china_….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d1351b No.22294990

>>22294985

W-t-f

A-r-e u d-o-i-n-g?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22294991

>>22294978

>why does Vivek float?

Magic carpet

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d1351b No.22294993

>>22294958

>bs

<my brain reads barry soetero now

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

190f29 No.22294995

>>22294986

>>22294987

black society in the 40's and 50's wasn't as crime-ridden as it is now, for various reasons

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22294996

File: 2267450bf5b51f6⋯.jpeg (34.79 KB,480x480,1:1,21d8f0beff60cb73bd50041f7….jpeg)

>>22294973

Know how you feel, and empathize.

Anon isn't mod material.

Have been begged to do it on three different platforms in the past and told them no, but they insisted.

Would up getting banned from all three.

Have good flameout stories, tho.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22294998

>>22294981

>SR went innawoods w/ family

Well, at least he took his family

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22294999

AI gives us another reason to highlight the 14th amendment…

Stripping natural-born citizens of their citizenship would be a bold move, potentially requiring something beyond tyranny. Focus in on "unless they make an explicit and voluntary decision to renounce it." Objective behavior, as determined by a jury, to be reasonably interpreted to express renunciation would fit the bill in my book.

"No, a natural-born U.S. citizen cannot be denaturalized or deported. However, a natural-born citizen can voluntarily renounce their citizenship.

Type of citizenship loss

Description

Denaturalization

A rare but controversial legal procedure that can occur for naturalized citizens. Reasons include funding terrorist groups, war crimes, or joining a terrorist group within five years of gaining citizenship.

Renunciation

A voluntary decision to give up citizenship. The process involves appearing in person at a U.S. embassy or consulate in a foreign country, signing an oath of renunciation, and paying a $2,350 fee.

The U.S. Supreme Court has established that natural-born citizens cannot lose their citizenship unless they make an explicit and voluntary decision to renounce it.

The only ways to change birthright citizenship guaranteed in the Constitution are through amending the Constitution itself or successfully challenging the 14th Amendment in the courts."

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295000

File: 8c77a4d8d9189b6⋯.png (993.24 KB,800x1100,8:11,soros_bragg.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295002

File: 83c93014878acf7⋯.png (243.19 KB,809x860,809:860,Durham_report_crossfire_hu….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295004

>>22294997

I guess both

The Chinese friends I’ve had have had family that are FOB. I grew up in Orange County, CA so had a lot of Asian friends.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295006

File: 25a95890de42b0e⋯.png (909.71 KB,1200x658,600:329,biden_presidential_medals_….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

048962 No.22295008

>>22294899

I get tired of hearing this person's name and nothing good associated with it. Do not play god bill gates, or I will ask the Living Lord God Almighty about you and your deeds.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22295010

>>22294980

same same

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295011

File: 5a6fd61942ff78e⋯.png (214.79 KB,1067x925,1067:925,wray_violations_12112024_v….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295013

File: 77f562c19adecc8⋯.png (858.51 KB,1088x732,272:183,Maralago_value_12042024_vi….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

893eeb No.22295017

File: 724a9e5ff5f5cc3⋯.jpeg (602.73 KB,1284x721,1284:721,IMG_2703.jpeg)

File: 2b3bb4b521714c9⋯.jpeg (744.81 KB,1284x690,214:115,IMG_2702.jpeg)

File: 80d0f2bf6476312⋯.jpeg (333.91 KB,732x719,732:719,IMG_2720.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295018

File: 7d2d38a5d2f648e⋯.jpg (495.2 KB,1080x1438,540:719,Silk_Gaetz_11142024_2.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8dc234 No.22295021

File: 7ffe7c358c55002⋯.gif (2.56 MB,300x424,75:106,dance_gif.gif)

>>22295014

filtered

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d1351b No.22295024

>>22295007

>8 channels?

<8kun..

[Birth certificate

Bc

Basis for so much fraud]

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295026

File: c9f48d7f93c5d59⋯.png (2.28 MB,1483x956,1483:956,syria_map.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22295028

>>22294957

>>22294984

>didn't look too comfy

His interview from yesterday (day before) touched on one particular part (very subtle) i totally agree…. either their is a real Whistleblower Extravaganza about to kick off… or a FAKE Whistleblower Extravaganza trying to kickoff to drown out any real whistleblowers.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22295030

>>22295003

enabled by the legal system

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295031

File: cb1111dfeed24e3⋯.png (87.58 KB,386x171,386:171,pepe_share_beer_with_fren.png)

>>22294996

came to dig, not mod

KEK

>good flameout stories

i'll bet

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22295034

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295035

>>22295013

I’m interested in Trumps future project in the Golan Heights

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d1351b No.22295036

>>22295025

[Illegals?

Citizen gift-> visa?]

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295038

File: 4bda2a5b84aa5b2⋯.png (523.32 KB,1100x486,550:243,Roseanne_11082024.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295047

YouTube embed. Click thumbnail to play.

>>22295028

>>22295028

this one

https://youtu.be/xglaXVtQcis

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295048

File: 75fb9fdd9dc617b⋯.png (279.64 KB,1100x728,275:182,help_these_purple_states_m….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b5d27e No.22295049

YouTube embed. Click thumbnail to play.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295055

File: 3dae4b0551db559⋯.png (731.62 KB,1100x600,11:6,non_detained_non_citizen_c….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d1351b No.22295058

>>22295051

Kek very fiat

Much fakery

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295060

EARLY Notables @ ~250

#27271 >>22294671

>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center

>>22294684 New footage of Cybertruck explosion

>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia

>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads

>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE

>>22294749 Anons discuss purpose of /qresearch

>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL

>>22294740 VIDEO: Hawaii Fireworks Explosions Update

>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery

>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22295068

File: 76844ecacd91a26⋯.png (133.57 KB,480x360,4:3,ClipboardImage.png)

File: 5fd1b7a37d3483d⋯.png (127.28 KB,500x230,50:23,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295070

File: 6b994607a747387⋯.jpg (161.86 KB,672x559,672:559,racism_is_evil.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295075

File: b850403fec967a3⋯.jpg (139.3 KB,1012x489,1012:489,Remember_011918.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295079

File: c6034d5002fa9dd⋯.jpg (180.61 KB,698x867,698:867,Yale_secret_societies.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ede023 No.22295080

>>22294971

seems to be a zero missing in that number to the right

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

47d0e1 No.22295081

First order of the day when power returns to the people and President Trump returns home, is to charge any falsified events as if the real events occurred and be equally charged. This will stop most FF. narratives, and stop misleading others into wrongful actions.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295083

File: 283d96d4773ab8a⋯.jpg (161.31 KB,1024x878,512:439,Perfect_cover.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d1351b No.22295084

>>22295072

[More closure

Would be

G-R-E-A-T

recent PMB

Was some

Closure

But not

Enough

]

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b110e3 No.22295085

File: 0dc6ac0608f3bd5⋯.jpeg (648.67 KB,1284x715,1284:715,IMG_2701.jpeg)

File: 2b3bb4b521714c9⋯.jpeg (744.81 KB,1284x690,214:115,IMG_2702.jpeg)

File: 724a9e5ff5f5cc3⋯.jpeg (602.73 KB,1284x721,1284:721,IMG_2703.jpeg)

>>22295064

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295086

File: 31d147b28ae3184⋯.jpg (98.29 KB,736x717,736:717,ford_believe_in_something.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22295088

File: c22e5a624002bfd⋯.png (430.48 KB,604x372,151:93,ClipboardImage.png)

>>22295052

>very driven to succeed

driven to beat you…slightly different from general success. similar to a Napoleon complex, you can see the ambition to destroy you in their eyelids.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fb9f83 No.22295090

File: b047aab072a5228⋯.jpg (79.2 KB,600x463,600:463,tanksalive.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

47d0e1 No.22295091

>>22295081

This has caused our society to move in certain directions that are not beneficial to them, humanity at large, impoverish most as the liars enrich themselves and create more slaves into their systems.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

042c47 No.22295092

>>22294837

Jacob is not their father, as for Israel,

only Abraham is their father, as they claim.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295096

File: e97d431ab6504bf⋯.jpg (239.25 KB,1184x673,1184:673,Q_drop_09052018_1.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22295097

>>22295047

yes, that's the rumored 'controversial' interview

I have not watched it, i listened to it while working

i do not know if it used any particular visual aids

I was NOT impressed with their explanation of "gravitics" and US vs China in weapons-bigger-than-nukes-war… but whateves.

I think the hot spot was the conversation about the absurdities of the Jan 1st 'terrorist in NO and silly suicide bomber in NV

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295098

>>22295052

My first friend and best lifelong friend was Chinese but moved here when he was 4 with his large family. I spent most my time growing up in their house. I really got to appreciate their candidness.

He went on to become a mechanical engineer and after high school, we didn’t end up speaking often, but stayed in touch.

When we were kids, he was being mean to me so I punched him and gave him a bloody nose. Years later he thanked me for doing it and told me he had always been jealous of me because I never had to work hard at anything. That somehow I could hear something in passing and never forget it or pick up a controller to a game I never played and be a master at it.

I always hated this about myself. Always just wanted to be “normal” and did a lot of drinking to fit in.

He died from the Covid shit (not being ambiguous on purpose, just that’s all I know) and I can now say the better one of us passed in 2020.

I’ll miss him til the day I die and possibly beyond. He was my real friend.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8df370 No.22295099

>>22295091

We live in a fear and greed based society. The greedy will pine for work from the taskmasters and carry out their dirty work as the innocent will become enslaved to both.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295100

File: 833fb89d6feff49⋯.jpg (223.56 KB,786x931,786:931,Q_drop_09082018_2.jpg)

>MAGA

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295101

File: 4f5453a268a61ea⋯.png (467.66 KB,989x648,989:648,2025_01_05_0_19_49.png)

>>22295060

>Hawaii Fireworks Explosions Update

mainly taking out VS, he must have posted the deleted note.

most of the reports are 3 days old, the most recent thing i saw (3 hrs old) is below.

Hawaii fireworks explosion update

Arizona Burn Center after being injured in a fireworks explosion in Hawaii. 12News got new details on how they will be treated.

https://www.msn.com/en-us/news/crime/hawaii-fireworks-explosion-az-burn-center-director-details-victims-treatment/vi-AA1wYtOy#details

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8f3242 No.22295102

Self awareness goes a long way. Don't get caught in the current and find yourself swept out to sea.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

25e4d1 No.22295107

>>22295099

How many actually feared to support PDJT? How many came to his side only when they saw the inevitable as a survival technique? The true is tried.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295110

File: 763b6e9f398f92e⋯.jpg (87.45 KB,800x444,200:111,Fox_news_hillary_and_Russi….jpg)

File: 6d7dc337fd56a4f⋯.jpg (101.77 KB,800x445,160:89,Fox_news_obama_seoul_south….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c229c8 No.22295112

>>22295107

The same that change with the wind will surely become your enemy when the wind dies down. They will look for greener pastures at your expense and others.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1abccf No.22295119

File: 717501e56a9c8be⋯.png (53.86 KB,575x738,575:738,love_and_respect_to_Anons.png)

File: 80a689e5418c13e⋯.png (473.88 KB,653x562,653:562,Trump_write_he_loves_us_AL….png)

rest well, gn

o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295121

File: df8759b0de18666⋯.png (528.85 KB,756x905,756:905,2025_01_05_0_27_11.png)

>>22295097

they were talking about idea of drones having anti-gravity properties, as i recall

worrying about China high tech capabilities

i was also mostly listening, don't think they had visual aids

Codemonkey commented, was notabled sometime today:

https://x.com/CodeMonkeyZ/status/1875388879450132720

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d8aef No.22295126

>>22295112

Actors are cowards and have always been. Those that confront evil and stay true to their word are those that have a law and their deeds are in their actions without fear.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22295128

>>22295081

ummmm? if i understand you correctly…

If some one or group FAKES a school shooting of children… then THEY (the ones who faked it) should be charged and sentenced AS IF they had actually killed children?

What kind of trial and sentencing would there be for the group of people that False Flagged 9/11?

9/11 really happened, but the perpetrators framed other baddies and made CRAZY WAR against all humanity ever since. What do?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c92de5 No.22295130

File: cc6532b80fc6ab6⋯.png (424.83 KB,568x436,142:109,3d93412c8d898758e2f8fd34c5….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d0f284 No.22295132

YouTube embed. Click thumbnail to play.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d8aef No.22295134

>>22295126

Acting is delaying a fight at other's expenses, especially those that stand and confront evil.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295138

>>22295130

Kek

Did you see the Ted talk where they said something like 80% of the worlds poop comes from rural India?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a97413 No.22295139

File: 58a9348f0f6224e⋯.png (449.81 KB,465x575,93:115,ClipboardImage.png)

https://links.truthsocial.com/link/113774743402540142

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d0f284 No.22295142

>>22295132

And I'm actually NOT a bot, kek.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9d150f No.22295145

>>22295134

To have a God, you must act like God Lives and sees and ears everything, and act accordingly. We do not deter from the path even at the cost of our lives.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9d150f No.22295151

>>22295145

If you miss Elijah, you will never know anything except your lame excuses.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d0f284 No.22295152

File: 1e20000d5aef835⋯.png (890.78 KB,600x750,4:5,edec0e58a2d94aa3e0868c0dd1….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295153

>>22295107

There's a reason why astronomy is the royal science. Our society is controlled far more by people following the winds than most know. Quite a bit of the chaos over the past decade resulted from my stunned disbelief to discover just that.

The ideals which the general population believes to be running society are only adopted economically when the signs in the heavens are favourable. This is hidden because if one truly understands the mechanics, individuals have a great deal more power to affect change than the wealthy would like.

Jesus' teachings are far more practical than how they are presented.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295156

File: 0437b7f91a2f400⋯.png (490.32 KB,514x720,257:360,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295157

>>22295137

The concept of pseudo-infinite energy is probably feasible given a person uses about 10 million joules of energy per day and just 8 ounces of enriched uranium contains 1.35x10**12 (10,000,000,000,000) joules

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295158

>>22295137

even when i don't know the properties of the systems discussed, figure there's always more heat than light out there

especially now

not use in getting wigged out

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9d150f No.22295161

>>22295151

It cannot be begged for, borrowed, bought, nor stolen. It has to cost you and you alone. This is why no one knows. Choices for all the wrong reason.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295165

>>22295161

Religion can't help you, rhetoric can't help you, philosophy can't help you; only discipline in God's Law.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295166

Anon knows what a tripcode is, in how it relates to Q posts.

Anon ha not seen a description of what exactly the technical function of a tripcode is, or how it's used.

Like…what does it DO?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295169

>>22295165

Yet many go to their scholars, priests, and are quick with their words. They forsake the Living God.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295172

>>22295168

38? like today or all time

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6e3c8b No.22295177

File: c5f70660fb2bb38⋯.jpg (62.04 KB,750x1000,3:4,flat_750x_075_f_pad_750x10….jpg)

Jan 6 is the official 2 weeks day

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c92c27 No.22295178

>>22295169,

How I wish you all would do well, because there is something more than this life, and if you knew, you would all cease and desist. But they are addicted to their folly.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c92c27 No.22295180

>>22295178

They are more interested in impressing others who are in a state of folly than a True Inheritance.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9abaea No.22295184

>>22295180

They marvel at the wrong things, and think, their ways are righteous in their own sight. Did they ever consider God once, in His Sight?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295187

>>22295177

>2 more weeks

After almost a decade, it’s finally here.

2

MORE

WEEKS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295191

YouTube embed. Click thumbnail to play.

>ANONS!? WHO IS IN CONTROL???

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9abaea No.22295193

>>22295184

If they ever did, they would try to fool no one because they know they are only fooling themselves.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295197

>>22295158

proof that the same guy who posted yesterday is the one you're talking to today

we used em in /comms, where tripcodes are whitelisted (anyone can use)

in name field: ## [someword]

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5ab678 No.22295198

>>22295193

They would make amends, and seek to resolve the damage that they have inflicted on their victims.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295201

>>22295198

Do you ever stop and listen to yourself?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22295202

>>22295177

>Jan 6 is the official 2 weeks day

The Jan 10 sentencing makes anon wonder. He'll already be confirmed by electoral college, just not sworn in.

Why not schedule it for the 5th?

Seems like better legal strategy.

Anon will kek if part of sentence is to check in with a PO once a week to hand over all current financial documents for examination of porn actress payouts.

Imagine Trump actually submitting to that.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295207

>>22295202

>why not the 5th

Because the courts would overrule it as obstruction of an election

The point isn’t to stall anything, its simply a publicity stunt so they can point and say, “Look the criminal president!”

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e081e3 No.22295208

>>22295200

>he will teach them a terrible lesson

sends a sternly worded email

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295209

>>22295195

>>22295166

"it absolutely guarantees the authenticity of authorship"

I'm no IT whiz but it seems like kind of a short string of characters for the encryption to be absolutely guaranteed. Would Q just type that same string in the 'name' box?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295211

>>22295205

No really. These messages are read by many.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295215

test

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295218

File: 6b004d1671c2b6c⋯.gif (2.47 MB,400x297,400:297,6b004d1671c2b6c70f4cffd9be….gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e081e3 No.22295220

>>22295215

test

one ping only

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

92b760 No.22295221

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295223

>>22295209

You don’t know how long the character set is that initiates the trip code for Q. It could be 100 characters. The input characters create a hash that is compared against the database hash which allows the user to initiate posting with that trip code.

I built an encryption that actually accepts words, sentences or even paragraphs and images to set a hash.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

dd118b No.22295225

>>22295198

>>22295201

>Do you ever stop and listen to yourself?

I say these things, not for myself, but to the one who is truly searching. Think about this:

Convenience, Stores, and Stores that steal from Stores.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295226

YouTube embed. Click thumbnail to play.

https://youtu.be/q7zOMr34e4E

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e081e3 No.22295227

File: c5e8a3877212820⋯.jpeg (36.81 KB,474x355,474:355,IMG_4982.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295229

YouTube embed. Click thumbnail to play.

https://youtu.be/zPVOTARWDuQ

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

411fd4 No.22295230

>>22295225

People are motivated by conveniences.

They have become store of.

And then there are those stores that steal from other stores.

Excuses are not reasons, they are excuses.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295234

>>22295197

Ok thank you. so that's what I was asking, it's not just the string of characters but there's a functionality tied to it, and it's turned off here.

I was wondering why none of the fake Q posters were adding a tripcode that was just a few characters off or something

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

34196f No.22295244

Vati shill lives in Asia and this is his second part time job after his main part time job

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fefd83 No.22295251

>>22295230

The best of them still await on their interpretation of a few lines of scripture to be fulfilled. Their work is still limited.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d1351b No.22295252

File: b9aac2bae98a841⋯.jpg (533.96 KB,1080x2340,6:13,Screenshot_20250104_183431….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5ccd4 No.22295253

>>22294743

So now they can make more money on breast reduction surgeries???

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295256

>>22295225

That's really not what it looks like from here. It looks like a lot of rhetoric that, if accepted, sabotages self worth. That may be the right path for some, but such messages can also cause significant harm to some who don't need them, yet can't see that.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8c9bb4 No.22295263

>>22295250

maybe seeweed farmer

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8c9bb4 No.22295265

>>22295263

*seaweed

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295266

Hey vati, who's yer daddy?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295267

>>22295223

wow. impressive and very dasting. reading that and how little I understand it…I realize I am probably like forest gump level intelligence.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fefd83 No.22295268

>>22295251

They search for what is already available. But conveniences.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fefd83 No.22295272

>>22295268

Did you hear that? Can you hear that? Would you delay? Would you make an excuse?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

eabd6e No.22295274

>>22295272

Though shall not test The Lord Thy God. Is a partial equation.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22295276

>>22295105

>they feel it is rude to show their true emotions

>even among friends

actually smart. certainly lost the vast majority of true blood american friends over the last decade+ that I'd made since childhood. these are now example lessons for my children: fuck other people; family first.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

eabd6e No.22295277

>>22295274

People are lazy, because it is convenient.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295278

>>22295271

lighten up francis

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5c87f No.22295279

The irony is that trump will have to sleep in the same bed that biden sharted in.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295280

If the foo shits swear it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

eabd6e No.22295281

>>22295277

Then why not test yourself? Why search for what is readily available?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fdcb89 No.22295282

>>22295281

Because no one wants to go get it, least pay for it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

669f8e No.22295283

File: b19dfa463251d59⋯.jpeg (733.29 KB,1280x1919,1280:1919,IMG_4983.jpeg)

>>22295266

vati was spawned from a disgusting sea-slug

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295284

>>22295230

The bitch of it is that if one truly wants lo live in the world, one must open themselves up to others. Such can cause conflicts of motivations which can be easily misinterpreted by one's self and observers.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

669f8e No.22295286

File: 81d0c50f76fda17⋯.jpeg (43.84 KB,474x316,3:2,IMG_4984.jpeg)

>>22295275

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295287

YouTube embed. Click thumbnail to play.

>>22295229

https://youtu.be/77Cuu61Ci_o

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9a0e96 No.22295288

>>22295284

You can be concerned with others that are in a state of folly or know for yourself.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295289

>>22295284

would you describe yourself as good, or bad, at parties? we already know the answer

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

980197 No.22295290

File: 9e1c80887935e6d⋯.jpg (37.83 KB,600x450,4:3,9e14066c.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295292

>>22295267

Start here

If you find it interesting enough, you will intuitively know the next step after learning this series

https://youtube.com/playlist?list=PL2jrku-ebl3H50FiEPr4erSJiJHURM9BX&si=vNDmG57Rx5geU8MQ

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

669f8e No.22295293

>>22295279

kek

I bet the stank of the obamas still lingers

big mike's jockstrap somewhere still in the lincoln room

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9a0e96 No.22295295

>>22295288

Do not expect anyone to follow you, there are too many conveniences and excuses for them to store.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295296

>>22295288

You make it sound like not caring about others is some sort of higher calling.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295297

>>22295294

It’s not a video

It’s a series

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295298

>>22295060

>>22295060

baker, you can please add anon's comment to this notable? >>22294684

becomes:

>>22294684, >>22294831 New footage of Cybertruck explosion

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295299

So, would you describe yourself as a "power" bottom?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5c87f No.22295300

>>22295293

No new mattress is going to clean this shit up :D

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295301

>>22295296

>You make it sound like not caring about others is some sort of higher calling.

>>22295272 reread this, quite the opposite.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295302

>>22295292

many thanks fren.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295304

>>22295295

And so shall the blind eye and deaf, not see nor hear.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295305

>>22295298

yes, done

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295306

>>22295305

going ok?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295307

>>22295304

Does anyone get The Greatest Value in Life, for nothing? Even gold is dross.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

980197 No.22295308

File: 0d933e9804517ba⋯.png (45.66 KB,600x700,6:7,0d933e9804517bae35861dc750….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295310

File: d68fcd653ccb588⋯.webp (197.5 KB,220x296,55:74,IMG_0027.webp)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295312

>>22295307

You can fool fools, but never God. He judges hearts.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295314

>>22295312

Down to the very soul.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295317

Poke the eye with a jagged, splintered, stick.

Now we twist.

Now we thrust into the eye.

See no more it will.

Stomped beneath my heel.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295320

>>22295310

ayyy! Timestamp for the WIN.

Nicely done

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295321

>>22295314

But time is short.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295322

>>22295312

It's certainly been enlightening, observing the difference between God's judgment and that of man.

Especially when men attempt to falsify god's judgment.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

297cb7 No.22295324

>>22295322

The Law is immutable.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295327

File: 2c9ac154a4b7bde⋯.webp (192.02 KB,500x208,125:52,giphy.webp)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295330

Who's yer daddy vati?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295332

>>22295324

Words and Deeds are mutable, out of convenience. Except to those that know the Law.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295334

File: 07687ee37dc8e3e⋯.png (1.37 MB,795x806,795:806,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295338

>>22295327

Our time is not His Time, unless we remember The Law.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295342

NCSWIC

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295345

File: 32de2443df8dcec⋯.png (125.24 KB,594x480,99:80,ClipboardImage.png)

File: 6c4d9613b6b2b45⋯.png (15.06 KB,213x186,71:62,ClipboardImage.png)

File: 86d7dcdbc62b22b⋯.png (43.34 KB,252x255,84:85,ClipboardImage.png)

File: ed3ab95d7fdd59d⋯.png (580.63 KB,753x801,251:267,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295346

YouTube embed. Click thumbnail to play.

>>22295229

~1

>>22295287

~2

https://youtu.be/f8bMV0g6Owk

~3

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295347

>>22295338

There always comes a time in everyone's life when nothing is funny. Then comes pure attention.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295348

>>22295347

Then comes your training.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295349

>>22295348

What you Mastered.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295351

>>22295306

yea all good

looking into those dna decryption tools posted the other night >>22288888

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295352

>>22295349

Were you ever truly a slave?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295358

>>22295353

>attention is neither retention, nor comprehension

What do you think I mean about pure attention?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

db81b9 No.22295360

>>22295355

>we're ALL slaves

>can you ever stop wiping your ass?

You marvel over the wrong things.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295362

I was just thinking, I don't remember any world leader going to Delaware for dinner at Biden's house…Im just sayin, kek…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295366

You shouldn't have done the crimes.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4ed661 No.22295367

>>22295352

Then you would have already found the Master.

Stores.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295375

>>22295351

happy hunting,

o7.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4ed661 No.22295379

>>22295364

>what do you mean, what do i think?

The type of attention that I am talking about is not of the mind alone but from ever part of your Living Being not just your living being.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295383

bread's @400

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295386

>>22295383

slightly lower, kek.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4ed661 No.22295387

>>22295376

>when the pupil is ready the master appears

>the master cannot be "found"

This is a cliche. I said before. Though shall not test the Lord Thy God, then test yourself.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295393

Ya'll understand "nobody gets a pass", right?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22295396

File: 2a6f49e66a6fa65⋯.png (1.48 MB,1280x720,16:9,ClipboardImage.png)

Blizzard, enemy of Iron Man

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295399

What's good for the Goose, is good for the Gander.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d8834f No.22295400

File: 534fee6e75ee123⋯.jpeg (193.56 KB,1712x1275,1712:1275,IMG_2707.jpeg)

File: fd3bedfaba736f5⋯.png (6.04 MB,2778x1284,463:214,IMG_2673.png)

>>22295393

Walls of the mind are hard to create… with illusion.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ff20bd No.22295405

>>22295390

Remember, I said it cannot be begged for, borrowed, bought, nor stolen. In essence, it has to be earned. By all means, means work.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295406

>>22295322

Can you leave Heaven if you wanted to?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ff20bd No.22295411

>>22295405

Stores.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5c6953 No.22295413

File: 2c89c7ae504f9f7⋯.jpg (80.63 KB,600x475,24:19,certificate.jpg)

8KUN HTTPS CERTIFICATE EXPIRES TOMORROW

PLEASE REPLACE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295416

>>22295413

will pass along, tx.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ff20bd No.22295417

>>22295411

and the lazy.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

20dedf No.22295423

>>22295378

Updated status on [44]?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295424

>>22295419

That's what I thought. Hell is a prison, Heaven is also a prison..

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295425

>>22295351

looking over the trip_gen trying to understand.

I am not a smart anon. forest gump assessment was accurate.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ff20bd No.22295426

>>22295417

If by words alone, then everyone could achieve.

If by wealth, then everyone could buy.

If by favor, then everyone has nothing to do.

It has to be earned and that will cost you.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295429

test 2

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295431

Deserve

Every

Insult

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22295433

>>22295396

>Blizzard, enemy of Iron Man

https://en.wikipedia.org/wiki/Blizzard_Entertainment

Originally founded in 1991, the company is best known for producing the highly influential massively multiplayer online role-playing game World of Warcraft (2004), as well as the multi-million selling video game franchises Diablo, StarCraft and Overwatch.

Founded as Silicon & Synapse, Inc. [SS]

Microsoft acquired Activision Blizzard in 2023, maintaining that the company will continue to operate as a separate business, while part of the larger Microsoft Gaming division; Blizzard Entertainment retains its function as the publisher of games developed by their studios.

A metric fuckton of data centers are in the path of this storm…is my best guess. Good time to make some changes.

https://www.datacentermap.com/usa/

As an aside, I was learning about Space Law, which is rooted in Maritime law. Lots of extraterritorial issues. Anyway, there are ships floating in US waters paying internationals to do American IT work but pay them jack shit. It's so fucked up.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295434

>>22295426

I thought the words were something like this…my bad, forgive please…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5ab678 No.22295435

>>22295426

To find a well, you have to dig deep and work.

To find the Fountain of Life, you have to go where none are willing to go, except the one that God has already assigned you. The Spirit of Truth.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

281872 No.22295438

>>22295285

>think maybe you've gone too far the opposite direction there…

I think your posting too much.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9ad086 No.22295441

Ugly

Fucking

Oriental

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5ab678 No.22295442

>>22295434

>I thought the words were something like this…my bad, forgive please…

Start from here >>22295347

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295444

>>22295437

I've heard of St Peters Gate, thats where you show your papers to get in but wheres the exit?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295446

t3

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295447

File: efe6c4e3838d6ce⋯.png (445.02 KB,568x647,568:647,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8da304 No.22295451

>>22295351

>>>22288888

here is a single file implementation built from the scripts in that repo from when the author first published the code… slightly cleaner https://gist.github.com/foldxy/b782b16dd205a212d65f0d5a13cfa348

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b9a9e3 No.22295456

>>22295435

>The Spirit of Truth.

Will lead you back to Christ.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

042c47 No.22295459

Usage

user$ python3 dna_encryption.py

Input: hello world

Encryption: ACTACAAGTAGTATGCTTGCGATGCACAGTAAT

user$ python3 dna_decryption.py

Input: ACTACAAGTAGTATGCTTGCGATGCACAGTAAT

Decryption: hello world

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b9a9e3 No.22295460

>>22295456

Then you will know the Father and the Son.

You will know and be known.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295461

File: cb156de400097ff⋯.png (152.51 KB,568x425,568:425,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295462

>>22295449

Sounds like a nice place to visit but I wouldn't want to live there…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

32d814 No.22295464

File: fee9c79179995b3⋯.jpg (60.35 KB,1280x426,640:213,photo_2023_03_25_22_05_39.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295466

>>22295454

you need to care, you're over 10%

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b9a9e3 No.22295467

>>22295460

The information is in The Light.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8555eb No.22295470

File: ced6225a5718fb4⋯.png (5.74 MB,2778x1284,463:214,IMG_0822.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b9a9e3 No.22295473

>>22295467

Until then work.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

88fe5c No.22295475

YouTube embed. Click thumbnail to play.

Live feed of blizzard closures

https://www.youtube.com/watch?v=3xxJXXqUrVg

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

caeee8 No.22295478

>>22295466

Lol of what? Lol

1/10 of a 100 is only 10…

A lot by what standards…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295480

File: ba7ba9a87772a71⋯.png (729.89 KB,568x718,284:359,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295482

>>22295478

Its enough for me…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f98d44 No.22295483

YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295487

>>22295424

cool, thank you

the dna i'm looking at has 'I's and '0's in some of the allele positions

when running the code i get an error since they're not mapped to any of the rulesets

was thinking of setting 'I' to '1' and '0' to '0' or ' '

maybe just them?

any recommendations?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

048962 No.22295489

>>22295473

There is no greater Teacher.

In the blink of an eye, you will understand.

Then you will be accountable, should you chose to be. For you will have a solid foundation that cannot be denied down to your soul, knowing no excuse or convenience.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c01fb6 No.22295490

File: 4d64193d07d01a3⋯.jpeg (180.15 KB,664x496,83:62,IMG_2517.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295491

File: 2efac571d3673c1⋯.png (213.51 KB,500x500,1:1,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295492

>>22295487

**maybe just removing them?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295493

>>22295447

Six Billion.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295494

holy spam bots anons. never seen it this bad

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

048962 No.22295495

>>22295476

>riddle me this…

>what if you proselytizing actually turned more people AWAY from Christ than were drawn to Him?

>would you STFU?

>wouldn't your pontificating be doing Satan's work?

Judas was bound to go his own way.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

dc6807 No.22295496

File: 178472223704d78⋯.png (3.95 MB,2778x1284,463:214,IMG_2493.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295497

>>22295494

try mornings, kek.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295498

>>22295487

I am not the anon you were looking for but GM anyway.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5c6953 No.22295499

YouTube embed. Click thumbnail to play.

>>22295491

The man on the moon, obviously.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295500

If I could go back in time, I'd bring Hitler a microwave!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295501

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1249db No.22295502

File: cb95bbdf3a73b87⋯.png (7.94 MB,2778x1284,463:214,IMG_0174.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

467c8b No.22295503

>>22295495

Those that tire, are already lazy.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295504

File: 13720ce1b19c9ab⋯.png (743.34 KB,687x900,229:300,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

467c8b No.22295507

>>22295503

Milk for children, meat for adults, because some things are harder to digest.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295508

File: faffb85e285ee8a⋯.png (431.93 KB,568x355,8:5,ClipboardImage.png)

if the moon landings are real why aren't the moon landings real?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295510

>>22295505

coffee break?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

32d814 No.22295511

File: 1b721440882cc7d⋯.jpg (121.64 KB,1560x1080,13:9,deep_thoughts_pepe.jpg)

GM retards

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a20789 No.22295513

File: 6955499845986f7⋯.png (280.09 KB,433x661,433:661,gp.PNG)

https://t.me/prevent1984/3143

Biden Quietly Bans Most Gas-Powered Tankless Water Heaters

This is actually happening.

https://vigilantnews.com/post/biden-quietly-bans-most-gas-powered-tankless-water-heaters/

Follow @Vigilant_News 📱

X (https://x.com/VigilantNews) | Rumble (https://rumble.com/c/VigilantNewsNetwork) | IG (https://www.instagram.com/VigilantNewsUS/)

More Stories:

🌐 VigilantNews.com

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4dcc07 No.22295514

HRC is getting a medal of freedom???

benghazi is trending

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295518

>>22295513

Trump's going to have a lot of un-banning to do.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

78784f No.22295520

YouTube embed. Click thumbnail to play.

>>22295519

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295521

>>22295491

Looks a little grainy, maybe an Earth bound telescope?

>>22295514

I remember thinking if a video is all it took, we should all be making videos…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d8834f No.22295522

File: 35d1114e35cf5c7⋯.png (1.44 MB,1284x2778,214:463,IMG_2728.png)

File: 4d64193d07d01a3⋯.jpeg (180.15 KB,664x496,83:62,IMG_2517.jpeg)

File: 568fcd16077fece⋯.jpeg (249.61 KB,1023x747,341:249,IMG_2513.jpeg)

>>22295500

Things are not good ideas… you have remember to think before you speak.

It is shocking to me how some people do not know what something’s mean and only away of common versions that only exist because of function.

?

Not a fan of the statement but what does that matter…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8da304 No.22295529

>>22295487

So you are saying that there the letters "I" and "O" in the sequence you are exploring? not just the base ACGT?

You could expand the rulesets for those additional characters and then introduce additional binary conversions in the script.

ie: the first rule would become (A) 0000, (C) 0001, (G) 0010, (T) 0011, (I)0100, (O)0101

This will also require additional rulesets to cover all possible combinations of ACGTIO

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a81b9 No.22295535

File: 912be61e5a0f909⋯.png (340.09 KB,622x546,311:273,4542.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a7b673 No.22295539

>>22295523

Then your work is already accomplished. Then you have already seen the Truth. There are libraries upon libraires open and in secret, yet none can testify.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1398af No.22295542

>>22295500

Microwave cooking oven was patented on October 8, 1945 with the one of the first prototypes placed at a Boston restaurant for testing. The first public was in January 1947 in a Speedy Weeny vending machine in Grand Central Terminal which sold freshly cooked hot dogs.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295546

>>22295522

You're a right proper cunt aren't you? You don't speak American, do you?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295547

File: df1323a762f050d⋯.png (57.6 KB,236x154,118:77,ClipboardImage.png)

>>22295487

was meant for >>22295451 kek

>>22295529

>So you are saying that there the letters "I" and "O" in the sequence you are exploring? not just the base ACGT?

"I" and "0"(zero)

thanks that makes sense

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295553

File: 7be1dcea5988406⋯.png (631.64 KB,568x696,71:87,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295554

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295556

File: 95c25a2f2216046⋯.png (323.03 KB,568x721,568:721,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295558

>>22295544

you sound like you're vaccinated

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a20789 No.22295559

File: fdde32247665708⋯.png (123.4 KB,642x365,642:365,t.PNG)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bfea1c No.22295561

File: 4d64193d07d01a3⋯.jpeg (180.15 KB,664x496,83:62,IMG_2517.jpeg)

File: b4195d6153b41f2⋯.jpeg (422.15 KB,1284x732,107:61,IMG_2510.jpeg)

File: 568fcd16077fece⋯.jpeg (249.61 KB,1023x747,341:249,IMG_2513.jpeg)

>>22295546

American’s speak English…

They actually have a programed setting for (American English)

You may not understand this you never thought their maybe other versions that you can set your computer OS to. Maybe you should try I hear you can YouTube it.

Just a thought?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

354947 No.22295562

>>22295539

How is it that those that say: The master will appear when the student is ready or something similar, cannot teach about God's Law?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a2a988 No.22295565

File: f3ec27713ddc7d1⋯.png (240.61 KB,615x419,615:419,ClipboardImage.png)

https://x.com/TrackAIPAC/status/1875813461692985450

Scott Pressler… AIPAC boy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295566

>>22295556

Russian Skinheads in Our American Congress?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f8c81f No.22295567

File: 4a4d3622de55858⋯.jpg (37.22 KB,828x575,36:25,Thomas_Tank.jpg)

File: 88e15c13b1e6ad8⋯.jpg (127.96 KB,700x781,700:781,Click_that_shit.jpg)

File: 75a316aa378afac⋯.png (964.36 KB,800x683,800:683,Clicked_it_77.png)

File: 2f6272db7270d77⋯.png (403.48 KB,664x459,664:459,click_now_fucked.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

628faf No.22295568

>>22295121

Wait until they get to the entangled gravitons, let you get past some of the peskier limits with enough energy.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295571

File: 82123e047d1808e⋯.png (591.29 KB,568x568,1:1,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f8c81f No.22295577

File: fe6e806c3c925ea⋯.png (640.54 KB,1069x585,1069:585,TY_Baker_McDonalds_Pepe.png)

>>22294671

TY Baker!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7846c6 No.22295578

File: 11ab82b01fd14bf⋯.jpg (87.34 KB,613x466,613:466,Q_1.jpg)

Wanted: 20 Jan 12:01

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295583

File: 23bd506787e612e⋯.png (1.73 MB,1120x4338,560:2169,2025_01_05_2_20_08.png)

what an absolute bastard

>>22295513

New Biden water heater ban will drive up energy prices for poor, seniors: expert

The Department of Energy is banning non-condensing water heaters

Biden ‘doubling down’ in the face of ‘absurdity’ with latest climate push, expert says

Climate Depot Executive Editor Marc Morano reacts to comments from a Senate hearing on climate concerns and sounds off on the Biden administration's latest climate push on ‘The Bottom Line.’

The Biden administration is banning certain natural gas water heaters from the market as part of its climate change agenda,a move critics say will jack up energy costs for low-income and senior households.

The move in the final days of the administration will take non-condensing, natural gas-fired water heaters off the shelves by 2029 in a bid to reduce carbon dioxide emissions, which climate change advocates and President Biden say cause global warming.

The new rules will require new tankless gas water heaters to use about 13% less energy than today’s least efficient tankless models. ….

https://www.foxbusiness.com/energy/new-biden-water-heater-ban-drive-up-energy-prices-poor-senior-expert

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5536a1 No.22295588

>>22295550

>we are all works in progress

Correct, most make claims, only a remote few can ever testify. Their testimony would teach you about what they learned, and they would tell you what I tell you, it has to be earned, and it will cost you.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

caeee8 No.22295589

File: f2a664421eb4950⋯.jpeg (183.73 KB,1902x1148,951:574,IMG_2715.jpeg)

File: 80d0f2bf6476312⋯.jpeg (333.91 KB,732x719,732:719,IMG_2720.jpeg)

>>22295562

Lol

You seem mixed up about things. Your you the master or the student. You see one must always be willing to learn from all experiences not really setting expectations of being anything but open minded.

There is no real “God’s Law” there are the 10 commandments id that what you are trying to say. This is more like guidance because how do you not kill someone trying to kill you…

Reasonable men have reasonable mines

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295593

File: 1902141d616577f⋯.png (532.11 KB,568x635,568:635,ClipboardImage.png)

>>22295563

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a2a988 No.22295595

File: e1bcfbc8e414487⋯.png (71.68 KB,507x680,507:680,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295597

You ip hopped fur dat?

>>22295561

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

caeee8 No.22295599

File: 0cbcd10c435dbe0⋯.jpeg (2.06 MB,2481x1284,827:428,IMG_2492.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

067373 No.22295600

>>22295585

>maybe bcs rote memorization of dogma authored by men is the antithesis of learning?

This is a world of actions until you can prove that prayers work. How many times have you heard the so called pious say, I am praying for you but other than that, they require no work?

It has to be earned, and it will cost you.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295601

Notables @ ~510

#27271 >>22294671

>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center

>>22294684, >>22294831 New footage of Cybertruck explosion

>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia

>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads

>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE

>>22294749 Anons discuss purpose of /qresearch

>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL

>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery

>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders

>>22295101 Hawaii fireworks explosion update

>>22295475 LIVE FEED: Blizzard Highway Closures

>>22295513, 22295583 Biden Quietly Bans Most Gas-Powered Tankless Water Heaters

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d06e9d No.22295602

File: 8201fe0c0348210⋯.mp4 (3 MB,634x360,317:180,8201fe0c03482109380ba5a95a….mp4)

>>22295590

>>22295591

>>22295592

>>22295594

>>22295596

>>22295598

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

99bd00 No.22295604

no table

>>22295413

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d06e9d No.22295605

File: 3db09a8cc11b9f0⋯.png (323.78 KB,799x406,799:406,00nsbymb.png)

>>22295601

>>22295603

notable

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295606

>>22295601

tyb

black linky at the end, kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d06e9d No.22295607

JUDGEMENT DAY OF RECKONING - THE DECODE THAT DOES NOT NEED DECODED

Feb18, 2018 8:41:03 PM EST 790

Q !UW.yye1fxo ID: 000000 No. 104

@SNOWDEN

WHERE ARE YOU?

NOT RUSSIA.

[EYES ON]

YOU ARE NOW A LIABILITY.

HELPING @JACK?

PROJECT DEEPDREAMv2[A]].

WE WILL NEVER FORGET.

ES FAILED.

WHERE IS ES?

JOHN PERRY BARLOW.

DEFINE THE END?

THE DAY OF RECKONING IS UPON US.

JOHN3:16

Q

Feb22, 2019 6:03:30 PM EST 2876

Q !!mG7VJxZNCI ID: 592cf1 No. 5333408

https://twitter.com/HillaryClinton/status/1098294023738064898

For those who think this war is fake, or we are not a considered a major threat, this is a direct attack by Hillary Clinton on 'Q' & 'PRO POTUS' PATRIOTS.

The article referenced has an embedded link that literally TARGETS PRO POTUS/Q Twitter accounts that have been IDENTIFIED by CLINTON/DS as serious threats (ability to shift the narrative).

Twitter has already begun to remove targeted accounts (stages) under false pretenses.

The war is real.

The threat is real.

CLINTON PANIC.

CLINTON FEAR.

JUDGEMENT DAY COMING.

Q

Apr02, 2018 11:47:24 PM EDT 989

Q !xowAT4Z3VQ ID: 491f56 No. 875289

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Facebook.

Amazon.

Twitter.

GOOG.

………..

BIG problems.

Q

Apr03, 2018 12:03:57 AM EDT 991

Q !xowAT4Z3VQ ID: 491f56 No. 875587

Apr 02, 2018 11:58:41 PM EDT

Anonymous ID: 015520 No. 875485

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Tip Top Tippy Top Shape

>>875485

It was requested.

Did you listen today?

Q

Apr03, 2018 8:42:09 PM EDT 995

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

Apr03, 2018 8:43:55 PM EDT 996

Q !xowAT4Z3VQ ID: 463ae0 No. 884763

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

Coincidence another MSM narrative change upon release of damaging news?

People are waking up.

Trace the background of the shooter.

Focus on Father.

20 years.

Q

Apr03, 2018 8:45:50 PM EDT 997

Q !xowAT4Z3VQ ID: 463ae0 No. 884799

Apr 03, 2018 8:43:05 PM EDT

Anonymous ID: dd4e73 No. 884748

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

P = pope?

>>884748

[Pope]will be having a terrible May.

Those who backed him will be pushed into the LIGHT>

Dark to LIGHT.

TRUTH.

Q

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d06e9d No.22295608

a 1 january

>>22295607

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d06e9d No.22295609

YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295610

>>22295604

>>22295606

fixed, gonna be looking for a handoff next bread kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d06e9d No.22295611

File: a175047cbc64055⋯.jpg (22.26 KB,400x199,400:199,0000000000000yeah.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295614

>>22295488

acting like a jerk, anon.

57 posts.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fdcb89 No.22295615

>>22295589

Men do not have reason, they have a multitude of excuses out of conveniences. I told you before God's Law is immutable, for it is He Himself, and His Law is His Word, and He is His Word; unlike men that use excuses as reasons.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295618

File: 950537961817c3e⋯.png (331.15 KB,568x641,568:641,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

580551 No.22295623

YouTube embed. Click thumbnail to play.

i was only able to make it to 37 minutes

either she's dumb and being played

or she is acting dumb trying to play her audience

i can't listen to her any more

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295628

File: 14c707ff96b4afb⋯.png (431.47 KB,568x492,142:123,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c97d1f No.22295629

File: ff4c34520518f35⋯.png (559.5 KB,1080x1103,1080:1103,ff4c34520518f35831ac66db5b….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295631

File: def8a225ab25ca9⋯.png (442.14 KB,568x568,1:1,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295632

YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7c84ba No.22295633

>>22295600

For those that find my words obnoxious to them, there is a reason that they are. This is not to make you feel guilty, but to tell you of the path, should you travel down that lonesome road. This is where you will find the one that God has designated to you; and only if you do these things for God's Kingdom come, and not out of vanity.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c01fb6 No.22295636

>>22295600

Praying is much like setting an intention and the will to practice it though your walk of live that day or for a time.

As far as the pray it only will work if the resolve you place to bring it about is there… however there is extra elements out there I believe. The universe will conspire to help you as long as your intention is pure I believe. Being Gods will.

As far as praying working it has mult means as if you speak a pray it has and holds more power, to lay hands is another act of agreement, one of which allows people to interact with in your personal space in agreement, and last and most important speaking that prayer and others in agreement their God himself is said to be there.

I like to think this is because of the action taken a force be it of the words and sound… after all this intention can become much stronger if other share the path to the goal.

Perhaps people may not like my view but I see nothing wrong with this…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295637

YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f8c81f No.22295639

File: b7f47d37c9886d6⋯.jpg (756.21 KB,1800x1800,1:1,Baker.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295640

>>22295610

there's often a gap around now

it'll get picked up at some point

o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295641

File: 91b386279a50f70⋯.png (316.76 KB,568x410,284:205,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295642

YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295644

>>22295002

Never miss an opportunity to point out that Jumpin Jack Flash couldn't get what he wanted but will get exactly what he needs…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295647

>>22295638

one whom Q has broken

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c9e005 No.22295649

Fbi shit, FUCKYOU

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295650

YouTube embed. Click thumbnail to play.

>>22295643

I see you, bitch.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295652

YouTube embed. Click thumbnail to play.

>>22295643

Get ready.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c9e005 No.22295653

File: b6fc23aa163a01f⋯.jpg (32.75 KB,260x318,130:159,d95e07291c14302d565809c11e….jpg)

File: 461b684dd5442c9⋯.jpg (217.78 KB,1360x765,16:9,5610468243939_219206332855….jpg)

File: e36819ba9948fdd⋯.png (773.95 KB,1884x1152,157:96,Beavis_Butt_Head_Remaster_….png)

File: f3d24289ae5ff22⋯.jpg (107.29 KB,300x250,6:5,ddaf8aca12c14830a16a6703df….jpg)

Fucking homes. Pick your banknotes, faggots

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4fe401 No.22295654

>>22295617

Yes, sorry, I actually meant to say, your prayers work not prayers themself. For example, would you want someone to say when your in dire straits, I am praying for that God helps you and leaves you there? Or would you rather have someone taking action to help you? Unless that person's prayers actually work, it is just vanity, laziness, and really not helpful at all.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295655

>>22295646

have 30 posts - notes, digs, BV.

you now have none.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e2646d No.22295656

File: e020569c829a0a3⋯.png (2.06 MB,1536x1152,4:3,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295657

File: b3074e80d9a313d⋯.gif (3.04 MB,590x633,590:633,b3074e80d9a313d24796ddb580….gif)

>>22295643

You're fucked.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a81b9 No.22295658

…in the big soup

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295660

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c9e005 No.22295661

Eh, homos!

2724

Feb 14, 2019 11:42:27 PM EST

Q !!mG7VJxZNCI

A Traitor’s Justice.

Phase III

Panic in DC.

RATS EVERYWHERE.

For those who decide to save the taxpayers some money - There is no escaping God.

Q

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a5e4da No.22295662

File: 9bb23bcae0d69c3⋯.jpg (23.61 KB,195x255,13:17,e6b3b17ef89dd5038480804807….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295664

YouTube embed. Click thumbnail to play.

>>22295659

No bitch, you're fucked.

Eat it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6edd12 No.22295665

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295668

File: e1eb9074365410d⋯.gif (199.49 KB,660x780,11:13,e1eb9074365410d8bfb13d9338….gif)

>>22295666

FUCKED

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

df8815 No.22295670

YouTube embed. Click thumbnail to play.

Ive been doing a ton of digging and I think I found a way out of Hell…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295671

>>22295610

>>22295610

taking out quite a bit, heavy shilling slows the bread down quite a bit

if you prefer, you can bake before 751 - 600 is often a good target - and i will lock

let me know

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e2646d No.22295672

File: 9f3ac081fbb71b9⋯.png (2.18 MB,1536x1152,4:3,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c9e005 No.22295673

YouTube embed. Click thumbnail to play.

You fucking homo ass traitors

Go be a statistic

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4c2450 No.22295674

File: 836f122a05081b5⋯.png (423.2 KB,568x384,71:48,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a5e4da No.22295676

Beautiful Days Ahead

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295677

>>22295654

i get your point and i'm usually the one arguing it

i agree with "the Lord helps those who help themselves"

i'm being devil's advocate because your posts are not unambiguously clear

and there are always occasions when people are helpless and the only action available is prayer

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295678

>>22295654

i get your point and i'm usually the one arguing it

i agree with "the Lord helps those who help themselves"

i'm being devil's advocate because your posts are not unambiguously clear

and there are always occasions when people are helpless and the only action available is prayer

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e2646d No.22295679

File: 95e28f515c38909⋯.png (1.8 MB,1536x1152,4:3,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295682

File: efe7920e9f5b0d9⋯.png (254.79 KB,1047x437,1047:437,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295684

>>22295683

>912 replies

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3015ea No.22295685

>>22295636

Prayers are easy, miracles are hard, you must have down the work beforehand.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e2646d No.22295686

File: 95e28f515c38909⋯.png (1.8 MB,1536x1152,4:3,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e2646d No.22295690

File: 69f1bb504e67d6b⋯.png (2.26 MB,1536x1152,4:3,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a81b9 No.22295692

File: a84441eb33290fb⋯.png (249.57 KB,349x369,349:369,3301.png)

the answer is within you..but it's the wrong one

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5591b1 No.22295693

>>22294748

Exceptionally attractive female model that does not have either of the atypical spirits found typically within QR. That is not a threat or a thread yet.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e2646d No.22295697

File: 3576de76bd9b0b0⋯.png (1.04 MB,1536x1152,4:3,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a5e4da No.22295699

Beautiful Days Ahead

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c61f7f No.22295701

>>22295678

>the Lord helps those who help themselves

Even better yet, those that help others. Those that hearken will be rewarded, should they persist in their intention and actions. They develop the True Spirit.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295709

>>22295704

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295711

>>22295684

mine reads 936

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4a6d25 No.22295714

>>22295701

It is not an easy path, and it may require everything that you have including your life. But I tell you Elijah already came, and they did not recognize him but di whatever that they wanted with him. They will have their excuses, and at the end of the day, it will cost nothing of them, and they will surely miss Elijah. John Baptized with Mercy, watch the water.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295715

>>22295677

It's a big problem with communication online. Far too many ways to read even simple messages. That's why I harp on the importance of speaking with people face to face for anything important. Tremendous errors have been made with confidence because people have been far to certain that their interpretation of online information is correct.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295718

>>22295693

alrighty, around 600 ill start bake

so this is aLAST CALLsince nothing else been added

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b110e3 No.22295719

>>22295692

Who is to say what is wrong or right? I can respect others believes… why not do the same.

I remember a line out of a movie I liked… it was advice from a father to a son.

It went something like this…

“Who ever told you that you should be happy? Happiness is note here nor their… you can’t hold you can’t take it with you.”

Perhaps even if sad there is happiness in the mind set that exist know that it is just as above, an emotion.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c814bc No.22295721

File: 11df985979dfdfd⋯.png (135.66 KB,585x298,585:298,Screenshot_2025_01_05_0354….png)

>>22295704

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295722

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295724

File: 594cbb587db7d7a⋯.png (989.14 KB,1280x720,16:9,ClipboardImage.png)

>>22295668

>>22295666

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295725

>>22295701

true that

but that concept is exactly echoed in The Dao

and it was not necessary to invoke a supernatural being to arrive at the same conclusion

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cb3dcb No.22295727

>>22295719

Life has a funny way of smiling on people… you really think life being easy is a true test of anything.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

71134b No.22295729

File: 92f87579757d539⋯.png (52.49 KB,682x520,341:260,ClipboardImage.png)

>>22294609 lb

Airway Heights, WA is just a mile or so east of Fairchild AFB. Fairchild used to be a B-52 bomber base with a nuke weapon storage area. The B-52's and presumably, the nukes, were moved out years ago and today Fairchild is primarily an aerial refueling base.

A B-52 famously crashed there in 1994 as the pilot, Bud Holland, attempted to avoid an illegal overflight of the nuke storage area while practicing for an air show.

https://en.wikipedia.org/wiki/1994_Fairchild_Air_Force_Base_B-52_crash

Yeah that image is the B-52 on edge just 50ft above the ground. One crewman has ejected but descended into the fireball.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a81b9 No.22295731

YouTube embed. Click thumbnail to play.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bf4d2b No.22295732

>>22295714

>John Baptized with Mercy, watch the water.

The Living Waters was eventually revealed to him.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a20789 No.22295734

File: 29ef73ec2a5920b⋯.png (1.26 MB,1266x707,1266:707,j.PNG)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295736

>>22295718

ok, will stick with you til 600 and lock after you bake

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295740

>>22295718

>so this is aLAST CALLsince nothing else been added

СЛАВА БОГУ

let's wrap this puppy up so i can get some sleep

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bf4d2b No.22295742

>>22295732

First comes the one who baptizes with water, then comes the one who baptizes with fire. This fire is the Living Waters.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d8834f No.22295747

>>22295737

God loves all his people rather they acknowledge them or not. That is what I believe anyways… a head extended is better then one that is not reached.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295749

File: 01e7c0a103faf81⋯.png (799.52 KB,649x950,649:950,ClipboardImage.png)

>>22295718

last call for boobs too fugit

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c5d6d1 No.22295750

File: 20448ed19b74fb7⋯.jpg (3.75 MB,4320x3396,360:283,Screenshot_20250105_035711….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295752

>>22295692

>the answer is within you..but it's the wrong one

the wrong is within you, final answer

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

da99b8 No.22295753

>>22295725

The information is in The Light of Living Waters.

Then you will know the Father and the Son.

All will be revealed.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295754

File: 93a7c6290d2b4a2⋯.mp4 (12.76 MB,480x270,16:9,93a7c6290d2b4a25ec0e0f753a….mp4)

>>22295741

Suck your own dick if JFK Jr is still alive.

Pics or it didn't happen.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c814bc No.22295755

File: 58b0ba52c649e87⋯.png (67.17 KB,1621x809,1621:809,58b0ba52c649e87c873babc0c2….png)

File: 791d6df92c8074f⋯.png (59.92 KB,1526x775,1526:775,791d6df92c8074fe64deaf4741….png)

>975 replies

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

893eeb No.22295757

>>22295747

Hand extended… not head… this maybe the auto correct os bs… going on often.

Lol

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d89154 No.22295760

>>22295754

Not sure why this is necessary rather he is alive or not? Lol

However you do as you like…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a20789 No.22295761

File: 55bb0ea6a5eefb3⋯.png (22.16 KB,594x348,99:58,loom.PNG)

https://x.com/LauraLoomer/status/1875693124586275200

Laura Loomer

@LauraLoomer

THREAD:

🚨ATTENTION MAGA🚨

I am as hard headed as they come. But, sometimes you need time swallow your own pride and agree to disagree on issues for the sake of preventing an implosion.

I thought a lot about this week and I would really like to see all of this division end.

12:57 PM · Jan 4, 2025

·

67.3K

Views

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bebdaa No.22295763

>>22295753

The harvest is now, but the Laborers, workers, are few. It requires work.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295766

File: 5e6aaff4de36373⋯.png (1.12 MB,1072x1280,67:80,ClipboardImage.png)

>>22295760

Rope store, faggot.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f152ee No.22295768

YouTube embed. Click thumbnail to play.

>>22295748

JFK Jr

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295769

File: 4bdf1f5e2243c21⋯.png (354.3 KB,1000x562,500:281,c6526cc3abb197e02cbe24efe0….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295771

>>22294671

>>22295722

need to tag the dough:

baker is baking @600

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1e1fb3 No.22295774

>>22295763

Those that have ears and eyes that grow dull, will never work for the see nothing has to done nor hear about anything that has to be done.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295775

File: 2559a47f5f3c7a4⋯.png (229.48 KB,500x314,250:157,jp.png)

>>22295767

Kill yourself.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a81b9 No.22295777

shouldn't run out of carrots … should know

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c97d1f No.22295779

File: ff961b7ef51155d⋯.png (1.58 MB,1846x1200,923:600,improved_eshatron.png)

File: 810bd7b3c30c047⋯.png (13.9 KB,255x172,255:172,redtext.png)

>>22295524

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

654e4f No.22295780

>>22295749

would

imagine the tittyfuck

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295781

File: 5d060f0ae7350e8⋯.mp4 (626.15 KB,480x374,240:187,domino.mp4)

>>22295773

Suicide isn't forbidden in the Torah.

DO IT.

FUCKING DO IT.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8c82a8 No.22295784

>>22295769

Confucius was a philosopher not a worker.

If by words alone, then all would achieve.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295786

>1006 replies

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a5e4da No.22295787

>>22295761

She showed everyone exactly who she is without a doubt. There's no going back now.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295789

idjits

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295790

>>22295763

>>22295784

fuck off, IP hopping shill

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a81b9 No.22295792

File: 14f6062f7f74963⋯.png (102.53 KB,428x347,428:347,235.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ef41a6 No.22295794

>>22295787

She showed everyone her benis?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295796

>>22295771

bread is past 1000 a while back

DO IT

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

79b4e0 No.22295799

File: 8a10f6c7c4322b8⋯.png (1.99 MB,1926x900,107:50,Screenshot_2023_11_18_at_1….png)

File: 66c7f14c0f273c0⋯.png (1.03 MB,890x1030,89:103,Screenshot_2023_11_18_at_1….png)

File: 5e110abf80a0b9b⋯.png (2.02 MB,1890x902,945:451,Screenshot_2023_11_17_at_2….png)

File: cfb59d9a5e2140d⋯.png (76.17 KB,194x256,97:128,Screenshot_2023_11_18_at_1….png)

File: 13d4b9bff32378a⋯.png (679.74 KB,1202x362,601:181,Screenshot_2023_11_18_at_1….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6c291e No.22295801

>>22295784

His Ways are not our ways. His ways as if one is traveling to their own destruction, as if one has no counsel. But they never counted on the recompense of Holiness, and that was their downfall.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295803

>>22295797

>1017 replies

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295807

>>22295803

>1023 replies

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295811

bread's around 550-560

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295814

>>22295761

>swallow your own pride

what guy hasn't wished he could do THAT

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295815

this is why we can't have nice things

>>22295809

>1029 replies

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

79b4e0 No.22295816

File: eae4a42958317a8⋯.png (1.5 MB,784x1070,392:535,Screenshot_2023_12_01_at_0….png)

File: 3c27a4390a4df77⋯.png (254.53 KB,496x312,62:39,Screenshot_2025_01_04_at_1….png)

File: 5e8a2901d99a047⋯.png (582.5 KB,1068x526,534:263,Screenshot_2025_01_04_at_1….png)

>>22295799

[AS]

what happened at the hotel, negger?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

4f1a9c No.22295822

File: d60c185d06fe9ac⋯.jpg (356.06 KB,720x1600,9:20,Screenshot_20250105_061054….jpg)

File: 034c3eb45ba4ce9⋯.png (246.82 KB,710x1640,71:164,59_5.png)

File: bc5ef3a4c9870b8⋯.jpeg (354.65 KB,1638x2047,1638:2047,Gghklx7WQAAryqt.jpeg)

File: cf895d66dd3658e⋯.jpeg (338.61 KB,2048x1365,2048:1365,GghklxfXgAA7XWK.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

654e4f No.22295824

File: 9f070821b02f3c5⋯.jpeg (105.36 KB,625x485,125:97,IMG_4584.jpeg)

>>22295811

BROKEN ARROW

BROKEN ARROW

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295825

YouTube embed. Click thumbnail to play.

>>22295784

>If by words alone, then all would achieve.

By words alone.

Get out of our fucking way.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295826

>>22295761

"loomer apologizes"

that's something

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295827

>>22295811

what fucking difference does it make?

bread is FIVE HOURS old

how long is baker supposed to hang around in the kitchen?

undelete some damned posts….

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295830

>>22295826

>"loomer apologizes"

>that's something

Bitched out and groveled.

Insta-mute from me personally.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295831

>>22295827

it's all good im chillin

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295832

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

693470 No.22295835

>>22293183 pb

Looks like a combo between Lincoln and Tesla with Laser Eyes.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295837

>>22295833

You already lost faggot.

PREPARE.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295838

>>22295831

that guy's not trying to help, kek….

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295839

YouTube embed. Click thumbnail to play.

what's in those catechism crackers?

You gotta tell EM, anon.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

654e4f No.22295841

File: 39ca9d89112bd16⋯.jpeg (54.08 KB,666x358,333:179,IMG_4852.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d7743d No.22295843

>>22295825

>Get out of our fucking way.

When the time comes, I will go before you, with more than words, but with The Law.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295846

>>22295835

i woulda guessed john mcafee

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295848

YouTube embed. Click thumbnail to play.

>>22295842

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295849

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

79b4e0 No.22295850

File: 05bc3f9e76646d5⋯.png (1.29 MB,1122x1432,561:716,Screenshot_2025_01_05_at_0….png)

File: 32d23e10929085a⋯.png (1.82 MB,1820x1444,455:361,Screenshot_2025_01_05_at_0….png)

File: 2247675710b2705⋯.png (456.66 KB,664x718,332:359,Screenshot_2023_11_11_at_1….png)

File: e08a77275da2994⋯.png (1.02 MB,860x886,430:443,Screenshot_2023_11_12_at_1….png)

File: 8fdcfd7bf5dd9bd⋯.png (328.11 KB,668x502,334:251,Screenshot_2024_01_18_at_1….png)

>>22295799

>>22295816

you better put this bitch back in the shoe box

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

72bd54 No.22295853

@583

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

654e4f No.22295854

File: 62b2a3b36a50e01⋯.png (235.31 KB,502x525,502:525,IMG_4830.png)

>>22295851

fuck off

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295856

File: 41f3b5b99892474⋯.jpg (29.58 KB,590x590,1:1,Thingy.jpg)

>>22295851

Welcome to the bunker, bitch.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295858

>>22295841

no wonder they have to beg people to baker

absolutely ZERO respect for peoples' time

guess that never crosses their self-righteous minds

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a20789 No.22295860

File: e7dc56d4fa9deb6⋯.png (335.29 KB,603x708,201:236,y.PNG)

https://x.com/ChanelRion/status/1875562480455295121

Chanel Rion OAN

@ChanelRion

While no one was looking…

Why did Biden REMOVE this clause from Policy Directive 28?:

“THE UNITED STATES SHALL NOT COLLECT SIGNALS INTELLIGENCE FOR THE PURPOSE OF SUPPRESSING OR BURDENING CRITICISM OR DISSENT.”

@ChadRobo

reminds us… Biden ALSO quietly lifted DoD Directive 5240, a 40 yr rule, preventing the military from collecting on US Citizens… just before the election.

4:18 AM · Jan 4, 2025

·

128.9K

Views

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a5e4da No.22295863

"We're going to stop these Jew-Haters!" Trump

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295865

File: 502158f63440a62⋯.mp4 (696.54 KB,512x512,1:1,solar.mp4)

>>22295859

Some dogs are brown.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

79b4e0 No.22295867

File: c63d6729c8de98d⋯.png (229.01 KB,320x324,80:81,Screenshot_2025_01_04_at_1….png)

File: bd512946c936ff7⋯.png (3.2 MB,1760x1430,16:13,Screenshot_2025_01_04_at_1….png)

File: af0de8df7dc660c⋯.png (670.85 KB,1024x628,256:157,Screenshot_2025_01_04_at_1….png)

File: 4259fa5f4522ceb⋯.png (1.23 MB,1180x1118,590:559,Screenshot_2025_01_04_at_1….png)

File: 367f1c0b08e39ca⋯.png (1.93 MB,1348x1072,337:268,Screenshot_2025_01_04_at_1….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295869

>>22295838

yeah…

and we got self-appointed hall monitors in here bitching about post counts….

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

654e4f No.22295872

File: bdef58dede02d3c⋯.jpeg (101.12 KB,720x537,240:179,IMG_4980.jpeg)

>>22295858

forget about having bakers

should just do back to back auto e-bakes

don't worry about notables, most never read them or they are shit anyway

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295875

>>22295866

>IT IS ALWAYS LISTENING

These are my balls and this is their skin.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

79b4e0 No.22295876

File: c4857694f4a824f⋯.png (1.6 MB,1818x930,303:155,Screenshot_2023_11_17_at_2….png)

File: da2764491a1946d⋯.png (1.53 MB,1084x1154,542:577,Screenshot_2023_12_08_at_2….png)

File: 571a6d35c0d42c9⋯.png (1.46 MB,1212x1106,606:553,Screenshot_2023_12_13_at_0….png)

File: 2b92e3f2ab40456⋯.png (724.98 KB,712x682,356:341,Screenshot_2023_11_17_at_2….png)

>>22295867

say my name, bitch

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295878

YouTube embed. Click thumbnail to play.

>>22295839

>You gotta tell EM, anon.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

306260 No.22295880

File: bc0a5d24d6baba1⋯.jpeg (115.24 KB,977x822,977:822,4mKNlAq8XjMd.jpeg)

7 boxxies 'elon'. Time to go home to mommy and send out your good twin you half breed dumb alien motherfucker.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e8bc44 No.22295881

File: 93b145baf07a731⋯.png (720.28 KB,518x777,2:3,93b145baf07a73182ffb31b089….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3a9d37 No.22295882

>>22295701

Saw an interesting philosophy in a frivolous bit of fiction. The idea is that "luck" is a function of how much you consider others, and how far into the future you consider them. Thus someone who considered all people, for all time, would have fortune unsurpassed by any other living soul, appearing as divinity in the flesh to outside observers.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a20789 No.22295883

File: e396549b0c1f308⋯.png (304.45 KB,589x455,589:455,bob.PNG)

>>22295877

https://x.com/bobscartoons/status/1875863193786212829

Bob Moran

@bobscartoons

12:13 AM · Jan 5, 2025

·

1,125

Views

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

351c61 No.22295885

>>22295845

A symbol is an expression of one thing for a more complete definition of another.

A character is an identifier of a certain value.

Some values change, others are immutable.

Resolve.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295886

YouTube embed. Click thumbnail to play.

>>22295877

>GUISE!!!

>>22295878

>>22295839

>>You gotta tell EM, anon.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

79b4e0 No.22295887

File: 8ace6c431eb24e2⋯.png (1.91 MB,1552x1040,97:65,Screenshot_2025_01_04_at_1….png)

File: aa67753e4478ab4⋯.png (986.38 KB,1148x708,287:177,Screenshot_2025_01_04_at_1….png)

File: 20e365a96cfd02b⋯.png (765.76 KB,1106x666,553:333,Screenshot_2025_01_04_at_1….png)

File: 3c21509fbc28ad9⋯.png (2.86 MB,860x1300,43:65,Screenshot_2025_01_04_at_1….png)

File: 13943705153510a⋯.png (2.33 MB,2704x678,1352:339,Screenshot_2025_01_04_at_1….png)

>>22295876

[HASHTAG]FUCKTHEPOLICE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

19b838 No.22295888

File: d47921e7209f931⋯.png (237.59 KB,686x386,343:193,ClipboardImage.png)

>>22295843

>When the time comes, I will go before you, with more than words, but with The Law.

You're in for a surprise.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295889

FINAL Notables @ ~605

#27271 >>22294671

>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center

>>22294684, >>22294831 New footage of Cybertruck explosion

>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia

>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads

>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE

>>22294749 Anons discuss purpose of /qresearch

>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL

>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery

>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders

>>22295101 Hawaii fireworks explosion update

>>22295475 LIVE FEED: Blizzard Highway Closures

>>22295413 8kun HTTPS certificate expires tomorrow

>>22295513, >>22295583 Biden Quietly Bans Most Gas-Powered Tankless Water Heaters

>>22295860 @ChanelRion: Why did Biden REMOVE this clause from Policy Directive 28?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

872283 No.22295892

>>22294724

Notice there's no before pics- even of her in just everyday life.(At home, out with friends, at the beach, birthday party)

Sounds a bit off.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

654e4f No.22295894

>>22295880

elon is a narcissistic faggot

thinks he is king of the world

dumbass sth african mutt

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a20789 No.22295895

File: f2a055499cb1724⋯.png (767.38 KB,831x703,831:703,dc.PNG)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7e3c58 No.22295896

>>22295882

Interesting. There are treasures and Treasures.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295897

>>22295872

>don't worry about notables, most never read them or they are shit anyway

IDK…

i watched this bread from the top

didn't seeing anything worthwhile that was NOT notabled

some stupid bloatable shit was included

but that's easy to ignore

i collect the good ones and distribute them to normies afraid to venture here

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

000000 No.22295900

YouTube embed. Click thumbnail to play.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bb789f No.22295901

>>22295894

ya left out CCP lackey

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

53e118 No.22295902

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

654e4f No.22295903

File: abb075eb9c728c0⋯.jpeg (67.87 KB,552x591,184:197,IMG_3942.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a0090f No.22295904

>>22295902

Migrate to fresh Locking

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d7743d No.22295905

>>22295888

>You're in for a surprise.

Kek, that wouldn't surprise me. There is a difference between I am The Law and with The Law.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.



[Return][Go to top][Catalog][Nerve Center][Random][Post a Reply]
[]
[ / / / / / / / / / / / / / ] [ dir / random / brains / hnt / jewess / qsource / svgc / vrgg / wtp / yapers ]