e7da19 No.22294661 [Last50 Posts]
Welcome to Q Research General
We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.
"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness.'
VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH
Q's Latest Posts
>>18284019 Nov. - Dec. 2022
Q's Private Board
>>>/projectdcomms/ & Q's Trip-code: Q!!Hs1Jq13jV6
Find Q drops here
Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku
Q Posts Archives
* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u
* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app
* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news
* Q Raw Text Dumps: q-clock.com/q_raw.txt
* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/
* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188
* Q Research Notables: Archive Board >>>/qnotables/
* Q Adjacent infographs and moar: https://deepstatemappingproject.com/
Q Research Board
Key Resources below. Check DOUGH RESOURCES thread for more: >>17225239
New to QR?
>>17240320 Welcome to Q Research | >>20424387 Board Info
Meme Warfare
MEME WARRIOR UI 1.3 #240904: https://archive.is/3Pe0E
Board History
>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon
TOR Access
TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html
TOR Banner: https://www.youtube.com/watch?v=MLCupx1UEx
____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7da19 No.22294663
International Q Research Threads
>>22225133 Australia #39
>>21503242 Brazil #1
>>22267360 Canada #69
>>21284558 France #8
>>21435975 Germany #107
>>21988292 Japan #26
>>16694250 Nederland #10
>>21452596 QAJF #2
>>22228099 Scotland #12
>>21699204 Singapore #1
>>20969267 South Africa #13
>>19804572 UK #51
GLOBALS
KNOW YOUR BUNKER = https://endchan.org/qrbunker/catalog.html
>>17322509, >>19089065 Baking Tools & Guidelines
>>20022853 Posting Guidelines for Anons
>>22053329 Administrator JW TripCode
IMPORTANT!Help support 8KUN
>>21438634, >>21189998, >>21462480, >>21190032, >>21543513 @thejimwatkins: Is it worth keeping 8kun online?? (Make bitcoin pmts via Proto)
>>18024378, >>18561054, >>21587855 PROTO Instructions & CONTACT info for Q's or problems
Please Support The Watkins Project #8KUN [DONATE LINK ABOVE]
Follow The Owner: Jim Watkins x.com/thejimwatkins/
Bookmark Watkins Report: https://watkinsreport.com/
Advertise Here: ads@isitwetyet.com
Donate Bitcoin: 1KiJD44WeWKaDb4Newr7bDXadtGn21ACqY
Proto Membership: https://shop.isitwetyet.com/p/Proto-membership/ (Coin Accepted)
Send Anonymous Money Orders: Is It Wet Yet, Inc at 2118 Wilshire Blvd #403 Santa Monica, CA. 90403
Buy Merchandise: (Coin Accepted)
- https://shop.isitwetyet.com/ (proto levels / donations)
- https://shoppers.isitwetyet.com/ (misc.)
- https://www.p2pprinting.com/8kun (clothing)
- https://goodstuffcoffee.com/8kuncoffee/ (covfefe)
ANONS: Stay positive, Eyes on the GOAL, not the OBSTACLES!
NOTABLES ARE NOT ENDORSEMENTS
#27270 >>22293896
>>22294472 @DanScavino - 16 DAYS⏳
>>22294502, >>22294507 Babylon Bee: Brit arrest for make meme offensive to child rapists
>>22294555 Why Washington Post cartoonist QUIT over this risky drawing that the paper rejected
>>22294573 Reform just six points off becoming biggest party, says election predictor. Electoral Calculus analysis shows Nigel Farage’s party could leapfrog both Conservatives and Labour if it continues to pick up support
>>22294609 Woman arrested in Airway Heights on suspicion of possessing multiple explosive devices
>>22294658 #27270
#27269 >>22292828
>>22292874 Dough claim
>>22292841 Col. John Mills: “This Is A Chinese Malign Influence That Could Topple South Korea.”
>>22292885 Texas high school football team takes to the field with American flags
>>22292895 Lionel Messi SNUBBED Joe Biden, and skipped the Presidential Medal of Freedom ceremony, where he was supposed to receive the award
>>22293089 Rep. Chip Roy: "We Need To Hold The Speaker Accountable And That Needs To Start Now"
>>22293279, >>22293284 Indie filmmaker Jeff Baena, Aubrey Plaza’s husband, found dead at Los Angeles home
>>22293708 Army CID offers $10,000 reward for stolen HMMWV doors that no one likes
>>22293730 ITALIAN PM MELONI ARRIVES AT MAR-A-LAGO FOR DINNER WITH TRUMP
>>22293779 @RepMTG - Jan 6th at 1:00 pm Congress must certify President Trump’s historic election. Washington has a winter storm warning for Jan 5-7th expecting possibly a foot of snow. Many members of congress left town this weekend even though they were told to stay. I’m here and will walk to the Capitol if I have to.
>>22293885 #27269
#27268 >>22291778
>>22291832, >>22291842 Morgan Ortagus appointed as Deputy Special Presidential Envoy for Middle East Peace
>>22291833, >>22291873 @ChanelRion - Why did Biden REMOVE this clause from Policy Directive 28?
>>22291844 Biden awarded Medal of Freedom to Jose Andres who appears in photos with RYAN ROUTH
>>22291915 Loop Capitalis in the deltas for tomorrow.
>>22291988, >>22292015 Now Tim Walz is suddenly concerned about the massive fraud occurring in Minnesota
>>22292003, >>22292511, >>22292623, >>22292736 Hillary walks past Oval Office, stops, hangs her head and keeps moving
>>22292007 A 2.7 magnitude earthquake was felt in the eastern West Bank on Saturday night
>>22292053 Hamas published a video of hostage Liri Albag on Saturday.
>>22292080 (ICE) has halted two programs aimed at providing social services to undocumented immigrants
>>22292086 @SenAdamSchiff - California is a big state with big dreams
>>22292112 @babylonbee FBI Turns Itself In For Planting Jan 6 Pipe Bomb To Collect $500,000 Reward From FBI
>>22292129 @Papi OK, WHO DID THIS???
>>22292159, >>22292337, >>22292366, >>22292399, >>22292537 Jimmy Carter Memorial Service @Carter Center
>>22292265 JUST IN: 🇦🇹 Austria's Chancellor Karl Nehammer resigns.
>>22292286 Grrr Ben Garrison - responds to new X policy - Wish Him Luck!
>>22292290 @ADL - Radicalized Bad Pepe still bad
>>22292365 Joe Rogan re-tweeted this post about DMSO (natural painkiller)
>>22292426 Ezra Cohen On Biden’s Middle Of The Night Changes To Orders Of Succession
>>22292539, >>22292540, >>22292712, >>22292793 @WarRoom on Medal of Freedom
>>22292610 Costello on Livelsberger "He's Making A Claim That The Drones We've Been Seeing Are From China"
>>22292656 Musk's Hypocrisy: X will Alter Algorithm to Suppress "Negativity"
>>22292663 @JDVance1 Biden giving the Presidential Medal of Freedom (posthumously) to Pol Pot and Count Dracula.
>>22292727, >>22292763 Jabbar used a very rare explosive compound in the two devices - Meaning he had help
>>22292746 Destroying National Sovereignty All Over The World
>>22292804, >>22292809 Puerto Rico’s New Governor Breaks Out the Trump Dance at Inaugural Ball
>>22292813 #27268
#27267 >>22290955
>>22290982 Prince William shocked by death of ex-nanny's stepson in New Orleans attack
>>22290993, >>22291283, >>22291301, >>22291315 Ezra Cohen @Warroom - Potato changed the orders of succession last night?
>>22290985, >>22291032, >>22291202, >>22291273, >>22291452, >>22291456 Ft. Bragg Deaths & Psyops DIG
>>22290998, >>22291016, >>22291368 The cybertruck psyop has failed spectacularly. People are too awake
>>22291003 US NSA Jake Sullivan visits India on Jan 5-6
>>22291015, >>22291309, >>22291474 Today in Q Post History we have 04 Deltas - 7/10 - What Makes A Movie GOOD?
>>22291029, >>22291058, >>22291290, >>22291403 WINTER STORM BLAIR Incoming! Calm Before The Storm
>>22291041, >>22291045 EAS Time - Everybody would believe everything, if it only comes out of TV
>>22291066, >>22291083 Ford recalls nearly 400,000 trucks, SUVs, other vehicles
>>22291070 Loop Capital reiterates Buy on McDonald's stock despite sluggish same-store sales
>>22291086, >>22291374 Jimmy Carter funeral: LIVE state service in Georgia
>>22291088 Far Left, BLM, Hamas Caucus Hosts ‘Peace Ball’ During Trump Inaugural Week
>>22291102 DOD, GSA, NASA Recommend Changes to Cyber Acquisition Rules
>>22291139, >>22291140 Elon Musk: “We’re going straight to Mars. The Moon is a distraction.”
>>22291141, >>22291171, >>22291211 @elonmusk Posting on the Grooming Rape Gangs Targeting Thousands of British Girls
>>22291220 ICYMI “Drone Rodeo” at the Constellis Training Facility (CTF) in Moyock, NC Oct 2024
>>22291225, >>22291245, >>22291270, >>22291327, >>22291381, >>22291394, >>22291458, >>22291470, >>22291482, >>22291721 NASA UAP Drone Space Related
>>22291288, >>22291292 MSNBC The United States Army is a much bigger problem than the southern border
>>22291303 Honduras President Threatens to Shut Down U.S. Military Base Over Trump’s Plan to Deport Illegal Honduran Immigrants
>>22291346 Sonny Smart, father of Georgia head coach Kirby Smart, dies after fall in New Orleans
>>22291358 ALLY CARTER NEW YEARS LIVESTREAM ASKING JAGUAR WRIGHT ABOUT…THE CHILDREN
>>22291375 @realDonaldTrump There has never been a President who was so evilly and illegally treated as I.
>>22291391, >>22291405 Deborah Birx sparks controversy with new bird flu warnings
>>22291407, >>22291409, >>22291421, >>22291564, >>22291571 George Soros Is Awarded the Presidential Medal of Freedom
>>22291416 U-Haul report places Illinois near the bottom of places people are moving to
>>22291441 Dramatic moment huge blast rocks Russian gas terminal after drone attack
>>22291501, >>22291521, >>22291715 Biden's Presidential Medals of Freedom – Says They Made World a ‘Better Place’
>>22291509 The Propaganda Push For Digital ID Kicks Into Gear In The UK
>>22291513 Michigan to Clear 400 Acres of Forest to Build Chinese-Made Solar Panel Farm
>>22291536, >>22291558 @Papi - Biden awards Hitler, Hannibal Lecter and The Devil the Presidential Medal of Freedom
>>22291574 Livelsberger's Alleged 'Manifesto' Says Gravitic Propulsion Drones To China 'Attack'
>>22291597, >>22291613 @carolrosenberg - Guantánamo Bay News GITMO
>>22291639, >>22291747 Russian Attackers Swarm Ukrainian Defensive Positions With Scooters, ATVs and Motorcycles
>>22291649 BlackRock offloads 3,510 Bitcoin, marking its largest outflow ever
>>22291767 #27267
#27266 >>22289987
>>22290012 Biden blocks Japan's Nippon Steel from buying US Steel
>>22290033 Elon Musk has shared Tommy Robinson’s documentary “Silenced”. This now has over 100 million views.
>>22290049, >>22290211 Biden to present Hillary Clinton, George Soros and 17 others the Presidential Medal of Freedom
>>22290066 DISGUSTING: MSNBC Host Lawrence O’Donnell Says American Veterans Are Greater Terror Threat Than Illegals Crossing the Border (VIDEO)
>>22290073 Illegal migrant accused of stashing AR-15, $750,000 in drugs at taxpayer-funded hotel
>>22290166 Senator’s Young Son Tells Kamala Harris ‘I’m Sorry You Didn’t Win’ The Election
>>22290177 EU Commission President Ursula von der Leyen is seriously ill with pneumonia - has cancelled engagements in the first two weeks of January 2025
>>22290258 New Orleans attacker had a transmitter to set off explosive devices, F.B.I. says
>>22290271 4 people shot in Washington DC last night in apparent mass shooting.
>>22290315, >>22290364, >>22290368 Biden is also awarding a posthumous Presidential Medal Of Freedom to Robert F. Kennedy, the list
>>22290389, >>22290445, >>22290667, >>22290765, >>22290777, >>22290814 Greenland/Thule???
>>22290440, >>22290768 ICYMI: @GenFlynn on NOLA/royal interest in NO???
>>22290495, >>22290499, >>22290633, >>22290640, >>22290657, >>22290739 Moar cyber explosion LV *WARNING: Psyop Smell Intensifies*
>>22290601, >>22290594, >>22290830 Farage/Robinson
>>22290607 Thanks to Bill Gates, ‘OPT’ Is What’s REALLY Killing American Jobs
>>22290620 Caste behind bars: In Indian prisons, the marginalized
>>22290650, >>22290668 Americans FUME After Adam Schiff Announces New Senate Committee Assignments
>>22290675 Thomas Jefferson’s Prayer for The Nation
>>22290693 Biden administration accused of covering up directed energy weapon attacks on intelligence officers
>>22290698 CFPB sues JPMorgan, Wells Fargo and BofA for gross negligence that cost consumers over $870M
>>22290716 Top 10 most alarming crime statistics in the U.S.
>>22290728 Brain implants and the erosion of privacy: Are our thoughts safe from manipulation?
>>22290730 1,000 Al-Qaeda fighters in U.S. as open borders fuel terror threat???
>>22290762 Gold Confiscation and 14 Other Government Screwups
>>22290815, >>22290865, >>22290896, >>22290920, >>22290929, >>22290939 NASA/Space/Science
>>22290828 Dasting History: New Orleans, 1972.
>>22290903 A note from Turo CEO Andre Haddad
>>22290947 #27266
#27265 >>22289171
>>22289214 Dough claim
>>22289311 Honduras President Xiomara Castro just issued a threat to President Trump, saying she'll shutdown U.S. military bases if he deports Honduran nationals.
>>22289655 @realDonaldTrump - The Democrats are all “giddy” about our magnificent American Flag potentially being at “half mast” during my Inauguration. They think it’s so great, and are so happy about it because, in actuality, they don’t love our Country, they only think about themselves.
>>22289772 @SLDelta45 - The Trusted Traveler program has been suspended at Patrick SFB & Cape Canaveral SFS. Any individuals WITHOUT a DoD-approved access credential (e.g. CAC, dependent ID, retiree ID) will be required to obtain a visitor pass.
>>22289783 @SpaceForceDoD Protect – Defend – Deliver 💪
>>22289815 🇦🇶🇨🇱President Gabriel Boric Font launched Operation Pole Star III, the first visit by a sitting Latin American president to the southernmost Antarctic extreme.
>>22289947 Washington State Democrats Accidentally Leak Their ‘Radical’ Tax Plan
>>22289979 #27265
Previously Collected
>>22287661 #27262, >>22288460 #27263, >>22289160 #27264
>>22285281 #27259, >>22286102 #27260, >>22286884 #27261
>>22282471 #27256, >>22283284 #27257, >>22284254 #27258
>>22279871 #27253, >>22280788 #27254, >>22281667 #27255
Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com
Q Research Notables Archive Board >>>/qnotables/
Q Research Notables #26: High Hopes >>22083727
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7da19 No.22294667
Dough; Looking for handoff or ghosting shortly
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7da19 No.22294671
Dough; Looking for handoff or ghosting shortly.
https://pastebin.us/?33e605efaf2058e1#AwbScA9Ked617ivygWiDsi8WAaPshomz2phMgz66qnUE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41f373 No.22294674
Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81
https://www.hollywoodreporter.com/tv/tv-news/britt-allcroft-dead-thomas-the-tank-engine-1236098959/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
62a0f1 No.22294677
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ab55 No.22294680
>>22294674
Don’t click that shit, nigga
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1ceda No.22294682
YouTube embed. Click thumbnail to play. Alberta’s $70 Billion AI Data Center
Holy fuck. Alberta's premiere just said Canada has 200 trillion tcf of oil.
That is worth:
$2.644897959183673 × 10^27
$26,000,000,000,000,000,000,000,000,000
https://www.youtube.com/watch?v=yVKxjAQyMTg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294683
WOMAN’s Breasts go from B cup to GGG cup after COVID-19 VACCINE.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294684
>>22294671
TY BAKER
@nicksortor
🚨 JUST IN: New video has just been released of the Cybertruck being detonated at Trump Las Vegas
This is a MUCH better view of the driver
It’s pretty obvious where the detonation originates, and if you look closely, you can see the driver’s head turn
https://x.com/nicksortor/status/1875711087762665630
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ef1f4b No.22294685
>>22294671
Thank you, Baker!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ab55 No.22294686
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294691
>>22294683
A healthy, nulliparous 19-year-old woman experienced significant breast hypertrophy starting 1 week after receiving the Pfizer COVID-19 vaccine in September 2022. Her medical history was unremarkable, with no hormonal disturbances detected on bloodwork.
The patient initially reported tingling paresthesia in her breasts, followed by sudden bilateral growth which worsened after receiving the second vaccine dose. Over 6 months, her breast size increased from a B cup to a triple G (Fig. 1). Physical examination revealed dense, warm, edematous, ptotic breasts with no palpable masses or axillary lymphadenopathy.
https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx
The “Pfizer Boob Job”: A Case of Unexplained Gigantomastia
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1ceda No.22294693
>>22294686
Fuck free energy; I'm rich, biatch!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a1dea8 No.22294694
Ignore the strange particle fog. No one at a university should use their vacuum cleaner to sample it and put it under an electron microscope. If they do, they should not conduct an elemental analysis using x-rays. No one who does this should put the results on X.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294695
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1ceda No.22294696
>>22294691
Wouldn't there be serious stretch marks all over her tits for that kind of growth within a week?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294697
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1df607 No.22294698
I like the cut of your jib fren
>>22294694
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4dcc07 No.22294701
The Maid of Orleans in New Orleans
Because of the deep French roots in New Orleans, Joan of Arc has long been honored here. The French were the first European settlers to lay claim to this land (that had already long been occupied by Native American tribes), and Orléans, the saint’s birthplace, is a sister city of NOLA. For the past 15 years, we have celebrated Joan of Arc’s birthday, January 6, in one of the city’s best loved traditions: with a parade! The saint’s birthday happens to fall on Twelfth Night, the end of the Christmas season and the official start of Carnival season here in New Orleans.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ece76 No.22294706
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294708
>>22294682
and if it were to hit the market, it's not worth that. And that's in dollars. And using that oil would take years, the years in which oil is in less demand. Still quite the product
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b2eb8 No.22294709
YouTube embed. Click thumbnail to play. 01-04-2025 Kansas City, MO -Crazy Pile-Up on I-470 Ice-Covered Roads Lead to Multi-Vehicle Crash
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6db1d No.22294711
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294712
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b6214f No.22294714
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7da19 No.22294715
>>22294671
Bread is ghosted
…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ece76 No.22294716
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a1dea8 No.22294717
>>22294698
.>>1234567
WWG1WGA!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1df607 No.22294718
>>22294683
You know someone somewhere is thinking how to perfect this to sell it as the new way to enlarge breasts no surgery required.
It will be an off label use for vaccines like Botox is used off label for wrinkles, headaches and sweat reduction.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294720
>>22294715
Bless you, baker.
Good night.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1ceda No.22294721
>>22294708
Knock off a couple 0s and that's still unfathomable amounts of $.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1df607 No.22294722
>>22294698
>>22294717
>>22294694
Whomever does this should film each step of the experiment.
Including the vacuuming.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0805f No.22294723
>>22294691
If that were true
There would be Stretch Marks
& there are none
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10c0fd No.22294724
>>22294683
>>22294691
>>22294022 (pb)
Case of a 19 year-old woman experiencing significant breast hypertrophy starting 1 week after receiving the Pfizer COVID-19 vaccine in September 2022.
"The patient initially reported tingling paresthesia in her breasts, followed by sudden bilateral growth which worsened after receiving the second vaccine dose. Over 6 months, her breast size increased from a B cup to a triple G."
https://x.com/DrJohnB2/status/1875214374182248677
https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx>>22294691
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1ceda No.22294725
>>22294721
America is gunna want our juicy asses now.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294726
>>22294701
I know just the girl for that role
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a1dea8 No.22294727
>>22294722
Checkt
Not an experiment, it is environmental sampling
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294729
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294731
>>22294720
not long for this anon either.
almost mornin
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cf8b41 No.22294732
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bebde1 No.22294733
JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE.
✅PRAGERFORCE (IDF Unit 8200)
Recruitment Head
✅AIPAC REPRESENTATIVE (Mossad)
Schusterman High School Summit
✅CHABAD, UNIV. OF ARIZONA (Lubavitch)
Outreach Chair
*NOTE: Chabad Lubavitch is a literal MOSSAD TERRORIST ORGANIZATION. It is PARTNERED with SAVE THE CHILDREN, BOSTON CONSULTING GROUP, CLINTON FOUNDATION and IJM in the same GLOBAL KID TRAFFICKING racket that was recently RAIDED in GUATEMALA, and leads right back to LUBAVITCH HQ in BROOKLYN, NY.
I mean this with every fiber of my being when I say I want these fucking SPY terrorists and kid traffickers out of my fucking country.
Yesterday.🤬🤬🤬
https://x.com/DecentBackup/status/1875040357114691630
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d967e2 No.22294734
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1df607 No.22294735
Whatever it is called, film it all a-Z, then poast on out board
>>22294727
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294736
>>22294721
Count Me Willing To Fathom
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0805f No.22294737
>>22294734
an Army of Darkness
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294738
We're gonna have to snowblow this shit in the wind, aren't we?
Anon hates snowblowing in the wind.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294739
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294741
>>22294724
My wife wanted bigger boobs so I told her to try rubbing toilet paper between her breasts as it had worked on her ass.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4dcc07 No.22294742
America was French first? Statue of Liberty makes moer sense now
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ef1f4b No.22294743
>>22294691
Eleven months post vaccine, the plastic surgery team opted for bilateral reduction mammoplasty, as breast growth had stabilized for 5 months and comprehensive work-up was normal.
Left and right specimens weighed 1906 and 1664 g, respectively, reducing her breast size from a triple G to a double D
At 5 months postoperation, breast asymmetry and areolar hypopigmentation were noted.
https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b2eb8 No.22294744
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22294745
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294747
no source but anons on x can try out these question on grok.
no anon is not a jew hater
just a look at the programmers input
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d967e2 No.22294748
TY B
seen you got my sight
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cebfe No.22294749
>>22294638
>>22294641
yeah, we're like an index?
but it was hinted that this project is for this:
They, the people deep inside, who are in charge of being watchdogs, can do investigations on a high level using super-FISA or whatever detailed mass surveillance to see whatever they need to know BUT without a Probably Cause, or prerequisite (can't think of a more technical term) they can't look anywhere, because that would be illegal
So they use our open source work for their probably cause.
they can't follow the investigation nor turn it into actual indictments without the original tip, even if they knew the information themselves, because of their position- because it's disallowed.
To keep it robust, legal and to avoid the security secrecy laws, (since they are under those and don't want to break them)
they can take what we say and find -what we figure out, (as though we are informants) - sine all we do is open source, so we find it on our own, no secrecy laws are abridged.
Nobody 's telling us.
That's also why the q texts were structured as they were.
The super-police who need to stop the nonsense that's going on, can use what we discover on our own as a jump off point for their deeper investigations, legally.
We do have our own informants occasionally who may point where to look, but who never tell us outright; much like Q itself.
Catch is: we have to prove it to ourselves, since we don't know which is which; disinformation mixed with information.
Q is same. Mixes in disinfo
Such as "Trust Wray" etc. etc.
So our work is not used for the purpose to tag what needs to be erased.
Nothing is ever erased.
If anything, we spread things the crooks would like to have erased
>>22294678
>>22294661
>>22294663
tyb
Hillary's still claiming that Russia Backs DJT
"everybody knows"
"So democrats should as for the backing of China"
WUT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d967e2 No.22294750
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294751
areolar hypopigmentation
NOTABLE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cebfe No.22294753
>>22294749
everything, all of it is
Lb
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bebde1 No.22294754
>>22294733
CHABAD: These are the same people, fyi.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22294755
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294756
>>22294751
>areolar hypopigmentation
Is there a market for albino nipples?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294757
>>22294749
Sounds logical but things posted here disappear.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4dcc07 No.22294758
Revelers line the streets of the famed French Quarter to watch this unique procession that is part history lesson, part pageantry, and fully New Orleans. Parade participants (known as the krewe) dress as a wide cast of characters from angels to foot soldiers to prominent figures from the saint’s history, as well as several versions of Joan at different points in her life. Krewe members pass out handmade throws, and the crowd cheers as the young woman who portrays Joan rides by on her horse.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ab55 No.22294761
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294762
How to get more retards to take the clot shots tell them it makes your boobs or cock bigger.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cebfe No.22294763
>>22294757
they disappear from the public.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4dcc07 No.22294764
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cebfe No.22294765
>>22294757
We're told to save everything offline.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ab55 No.22294766
>>22294762
It will grow your bobs!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294768
>>22294763
Buried in mountains of fake stories, search engines will never find them.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294770
.
>>22294757
which is why it is good to archive on secondary site and offline plus archive sites.
adjust adapt and keep moving forward.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294771
>>22294770
Just a lone person not part of any Company
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ab55 No.22294772
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cebfe No.22294773
>>22294768
it's not for search engines.
Search engines are controlled.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294774
>>22294773
Good you know how you do it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294775
>>22294731
>>22294739
Gnight responsible fam
Don't adopt the dreams of your neighbors
Have your own
Unless you have great neighbors
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cebfe No.22294777
>>22294770
Archives are also scrubbed of certain data / info.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294778
>>22294771
neither is anon
but if you name a subject
anons internet search skills plus archives are pretty good
anon if this anon cannot find it
there will another anon who will post it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
51ab55 No.22294779
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bebde1 No.22294780
KLEINER PERKINS: Genentech, Google, Ghislane.
💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥
“ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER.”
“We knew about her supplying underage girls for sex, but I guess that was fine for the ‘cool’ people who managed the TIGHTLY CONTROLLED GUEST LIST,” she added.
Oh. So the COVID BIOTERRORISTS are the SAME GROUP as the EPSTEIN/MAXWELL/MOSSAD KID TRAFFICKERS after all. Weird.
And THAT explains why SILICON VALLEY is chock full of TECH COMPANIES “founded” by IDF UNIT 8200 retreads grabbing the LION’S SHARE of IN-Q-TEL/CIA (American TAXPAYER) FUNDING, while actively building platforms to PREVENT AMERICAN WHITES from getting similar opportunities across a number of key professional domains.
Imagine all THAT, sports fans.
https://x.com/DecentBackup/status/1875639750155014575
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294781
>>22294762
Anon always preferred B or C cup anyway.
Will leave the ginormous bewbs to niggas who can palm a basketball.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294783
>>22294780
you know this post will get forwarded at some point.
but this was known to anons.
reddit was their safe space
now it is login only access
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b6d3ab No.22294785
https://en.wikipedia.org/wiki/Barak_(name)
Barak ("lightning") is a masculine name of Hebrew origin. It appears in the biblical Book of Judges as the name of the Israelite general Barak, who alongside Deborah led an attack against the forces of King Jabin of Hazor.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294786
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294787
>>22294781
At age 100 no preference
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294788
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294789
>>22294786
you continue to project
try another name.
how about calling anon something new
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294790
When everything about the Jesuits and their Minions Roman Catholics is filtered it makes me know that many Anons are Jesuits Filtering all mention of the Roman Catholic Church and all the Evil things they do.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
042c47 No.22294791
Bill Gates is with the AUS GOV blessing, planning to release Malaria Mosquito's.
He's done it before back in 2019
https://www.worldmosquitoprogram.org/en/news-stories/stories/far-north-queensland-essentially-dengue-free
Anon isn't sure if the statements are in context, or if you could be mistaken.
Nope, he's a shitcunt.
Humanspective
@Humanspective
·
6h
Australian PM: “I’ve admired your work”.
Doesn’t look like we’ll get much push back from the Prime Minister against genetically modified Oxitec mosquitoes.
Wonder if Anthony Albanese has seen what Bill Gates has been up to in Kenya
https://x.com/Humanspective/status/1875701084498620750
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294792
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294793
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294794
>>22294787
>At age 100 no preference
At age 100, there's always a zipper hazard.
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
73a8d7 No.22294795
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294796
>>22294794
You are assuming our future involves clothing? Much less zippers
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
de14f2 No.22294797
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294798
>>22294796
>You are assuming our future involves clothing?
Anon would just like to emigrate to the moon where bewbs only get 1/6 gravity.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294800
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294801
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294802
Those filtering everything Roman Catholic on this Board must know that Many Roman Catholics have already Confessed.
You Know that we know but yet you continue
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294803
>>22294802
stop hidin v.d
anon can see you
filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0805f No.22294805
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294806
Good people who became RCMP to do good found out they are the Baddies and have switched to the good side.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294807
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294808
>>22294807
watch the water
seriously see if you can watch the water
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22294814
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22294815
>>22294460 lb
im thinking ill juss skip this.
Shawn's a nice enough guy, but i don't want to hear shitall from "C_A". Every one i ever heard is a smug fuck always winking at the audience that they know more stuff than they can say outloud, but still want people to believe the 'oh so generous' little crumbs.
9/11 was an inside job
start there and i might listen, ya "IC" shitbags
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22294817
>>22294747
How many non-Jews died in WW2 so that the Jews could establish Israel?
Were those camps meant to protect the Jews?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b6d3ab No.22294818
https://www.instagram.com/jennieontheborder/reel/DEV5luWOyrp/
https://x.com/JennieSTaer/status/1874956197457244497
https://nypost.com/2025/01/02/us-news/new-orleans-isis-terrorist-shamsud-din-jabbar-had-bomb-making-station-and-quran-open-to-chilling-passage-new-photos-reveal/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
62a0f1 No.22294819
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294820
>>22294815
oh great another one of these 'witholding information is a power play' types
can't you imagine that it might also be because they are cowards?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294823
>>22294821
I thought it sounded like sciency nipples, which are my favorite kind
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
62a0f1 No.22294824
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22294825
>>>22292895 Lionel Messi SNUBBED Joe Biden, and skipped the Presidential Medal of Freedom ceremony, where he was supposed to receive the award
What's interesting is although he was awarded the medal, non-citizens cannot be awarded the medal…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294829
>>22294817
Had three family members in Palestine in 1936 preparing for the flood of Fake Jews from Europe.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294830
>>22294814
got some notes, baker, take what you want and leave the rest
KEK
#27271 >>22294671
>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81
>>22294682 Alberta’s $70 Billion AI Data Center
>>22294683, >>22294691, >>22294743 The “Pfizer Boob Job”: A Case of Unexplained Gigantomastia
>>22294709 01-04-2025 Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads
>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE
>>22294749 Anons discuss purpose of /qresearch
>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL
>>22294791 Bill Gates is with the AUSRALIAN GOV blessing, planning to release Malaria Mosquito's
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22294837
>>22294829
Why were the Fake Jews so intent on that tiny bit of land? Do they really think they are entitled to it for thinking that they are "God's Chosen People?" Or is there moar to it?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294839
>>22294837
Biblical lands need for the big religious Con, how much fake artifacts have been found and authenticated by the makers?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294841
>>22294830
>>22294831
>that's NOT a high explosive….
u know more than i would
baker can either drop it or add your comment
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22294842
>>22294839
So it's all about setting up a seat for their Anti-Christ?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22294843
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22294844
>>22294820
if she's 'a coward' on Shawn Ryan's show (and so she's compromised?), then still untrustworthy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294846
>>22294842
Good as anything else, holds so much power for Casting Spells, they are just slaves of Rome as is the world.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdfd1b No.22294848
Been gone about 3 years
Can’t believe u faggots are still here
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
73a9df No.22294851
>>22294848
Everything has meaning.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294852
>>22294848
Days of Our Lives
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22294855
>>22294826
Be [they] masterminds or subcontractors…..
There is no way for 9/11 WITHOUT sedition and treason INSIDE the USA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22294857
>>22294846
Slaves of Rome?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22294860
>>22294837
location
location
location
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4705fe No.22294863
>>22294694
does the X algorithm render the results forbidden?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22294867
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294872
>>22294850
makes sense, why i tagged baker.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294877
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22294878
>>22294848
Just Biden' our time waiting for the Return of Trump.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4705fe No.22294879
>>22294854
"get your covid-19 vaccine now to stop the spread and save grandma."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294884
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294885
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
34196f No.22294889
Trinidad and Tobago declares state of emergency after tiny Caribbean nation sees record number of murders in brutal year of bloodshed
…Trinidad and Tobago has declared a state of emergency after the nation saw a record-breaking 623 murders in just one year of bloodshed…
https://www.dailymail.co.uk/news/article-14236739/Trinidad-Tobago-state-emergency-murders.html
article is from December 30, 2024
but maybe still important
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4705fe No.22294892
>>22294822
a way to shut up the vaccine injured through fear of being labeled mentally-ill.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294893
https://rumble.com/v64azfv-america-first-means-reviving-the-american-dream-interview-with-peter-schwei.html
America First Means Reviving the American Dream, Interview with Peter Schweizer | TRIGGERED Ep.203
Donald Trump Jr.
1.55M followers
12/30/2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2664fe No.22294895
>>22294844
I don't know her, but if you find someone trustworthy by all means tell me.
I mean other than Ron Paul obviously
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22294899
>>22294791
Bill Gates Plays God Again, Funds Project That Is Turning Mosquitoes Into 'Flying Vaccinators'
by Samuel Short, The Western Journal Jan. 2, 2025 2:40 pm
Bill Gates is dead set on his goal of vaccinating the planet by any means necessary.
His latest project, the Blaze reported Monday, involves funding research for mosquitoes to be “flying vaccinators.”
A grant from the Bill and Melinda Gates Foundation of over $2.2 million dollars for Leiden University Medical Center has the express purpose as follows:
“To improve health outcomes and prevent premature death in populations around the world suffering from high rates of Malaria infection by developing next generation malaria vaccine candidates.”
To that end, LUMC published a study in the New England Journal of Medicine showing their work in using mosquitoes to vaccinate against malaria.
The Blaze highlighted, in the study, GA1 — a malaria parasite modified to stop developing after 24 hours of infection in humans — and GA2 — another parasite that stops developing around six days — were given to a test group of 43 adults via mosquito bites.
Subjects were given 50 bites from either GA1, GA2, or an uninfected mosquito in three sessions at 28-day intervals.
Three weeks following the third session, subjects were administered five bites by malaria infected mosquitoes.
Eight of nine GA2 participants were offered protection from malaria. One of eight from GA1 was protected, and those that received bites from mosquitoes that did not have the parasite did not show protection.
The results are startling for a number of reasons, especially because Gates is working towards engineering a method to vaccinate people without their consent.
Gates noted the ramifications in seeing where the real barriers are to this research being implemented.
“One of our biggest challenges isn’t scientific; it’s financial and political,” he said.
Yes, clearly there are political barriers as lawmakers signing off on a plan to send swarms of “flying vaccinators” into the general public would create pandemonium due to this gross infringement on liberty.
Gates does not care about liberty as he sees humans as a mass of test subjects — something that’s undeniable from his remarks during the coronavirus pandemic.
This is about choice. We do not live in a scientific oligarchy where we simply do what the experts tell us in every facet of our lives. Although adopting the most well-researched means of living sounds appealing on paper, the reality would be misery in having no say in our own existence.
We eat bad food. We are idle Some of us are in poor health. We consciously make the wrong decisions, but we are justifiably able to make them. That is our choice.
Gates may cite a mountain of research indicating how the science backs his position, but the line is drawn when the freedom to choose is taken away.
This article appeared originally on The Western Journal.
https://www.thegatewaypundit.com/2025/01/bill-gates-plays-god-funds-project-turning-mosquitoes/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab854e No.22294901
>>22294867
Notification of their coming Executions, they know it is coming.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294907
No shills for hours
then
muh joos shill
dear cia shill
Vati shill
all show up within a minute of each other
makes you wonder, doesn't it?
>>22294814
@170
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4705fe No.22294909
what was the nothing that could stop what was coming?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be7715 No.22294912
>>22294762
>How to get more retards to take the clot shots tell them it makes your boobs or cock bigger.
Inject it straight into the deep dorsal vein and you will be erect for life.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294916
>>22294907
Tanks for nuking them.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294923
>>22294893
'the bidens learned it from the clintons cuz nothing was done when clintons did it' - Schweizer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22294927
>>22294849
>die clowns
kek
didn't realize at first you were writing in German
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22294933
>>22294895
(yes, other than Ron Paul obviously)
The only reason i think of listening to her being interviewed on Shawn's show… is like the meteorologist taking note of the prevailing winds, barometer and temp
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
446986 No.22294935
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
20034e No.22294941
https://truthsocial.com/@DC_Draino/posts/113773576356247901
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294944
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294946
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294949
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294951
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294956
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22294957
I filturd one ID and half the posts went away.
Why is China so nigger?
Also, where’s the littlesberger shit? I work for a living and haven’t gotten to see the real tea on dude. Seems like he would be fighting for the good guys.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294960
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294961
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294964
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22294966
>>22294951
10.7 Million million is a lot, anon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294968
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22294970
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294971
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294973
>>22294916
more fun shitposting.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d744b8 No.22294974
>>22294848
wb
you look like you got aids
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294975
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294976
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22294977
>>22294963
>SF command
Star Fleet Command?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294979
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22294981
>>22294957
>littlesberger
Lots of dustup from Shawn Ryan Show interviews
Now rumors that Shawn packed his family and went bugout
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
190f29 No.22294982
>>22294975
mainly black kids aborted too
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294983
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22294984
>>22294981
shawn didn't look too comfy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294987
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22294988
>>22294967
> govt sucks same as here
Yeah that’s certainly true.
I like most chinese peeble i meet. They generally have an ability to laugh at themselves and a brutally honest perspective on things.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22294989
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1351b No.22294990
>>22294985
W-t-f
A-r-e u d-o-i-n-g?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22294991
>>22294978
>why does Vivek float?
Magic carpet
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1351b No.22294993
>>22294958
>bs
<my brain reads barry soetero now
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
190f29 No.22294995
>>22294986
>>22294987
black society in the 40's and 50's wasn't as crime-ridden as it is now, for various reasons
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22294996
>>22294973
Know how you feel, and empathize.
Anon isn't mod material.
Have been begged to do it on three different platforms in the past and told them no, but they insisted.
Would up getting banned from all three.
Have good flameout stories, tho.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22294998
>>22294981
>SR went innawoods w/ family
Well, at least he took his family
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22294999
AI gives us another reason to highlight the 14th amendment…
Stripping natural-born citizens of their citizenship would be a bold move, potentially requiring something beyond tyranny. Focus in on "unless they make an explicit and voluntary decision to renounce it." Objective behavior, as determined by a jury, to be reasonably interpreted to express renunciation would fit the bill in my book.
"No, a natural-born U.S. citizen cannot be denaturalized or deported. However, a natural-born citizen can voluntarily renounce their citizenship.
Type of citizenship loss
Description
Denaturalization
A rare but controversial legal procedure that can occur for naturalized citizens. Reasons include funding terrorist groups, war crimes, or joining a terrorist group within five years of gaining citizenship.
Renunciation
A voluntary decision to give up citizenship. The process involves appearing in person at a U.S. embassy or consulate in a foreign country, signing an oath of renunciation, and paying a $2,350 fee.
The U.S. Supreme Court has established that natural-born citizens cannot lose their citizenship unless they make an explicit and voluntary decision to renounce it.
The only ways to change birthright citizenship guaranteed in the Constitution are through amending the Constitution itself or successfully challenging the 14th Amendment in the courts."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295000
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295002
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295004
>>22294997
I guess both
The Chinese friends I’ve had have had family that are FOB. I grew up in Orange County, CA so had a lot of Asian friends.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295006
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
048962 No.22295008
>>22294899
I get tired of hearing this person's name and nothing good associated with it. Do not play god bill gates, or I will ask the Living Lord God Almighty about you and your deeds.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22295010
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295011
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295013
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
893eeb No.22295017
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295018
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8dc234 No.22295021
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1351b No.22295024
>>22295007
>8 channels?
<8kun..
[Birth certificate
Bc
Basis for so much fraud]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295026
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22295028
>>22294957
>>22294984
>didn't look too comfy
His interview from yesterday (day before) touched on one particular part (very subtle) i totally agree…. either their is a real Whistleblower Extravaganza about to kick off… or a FAKE Whistleblower Extravaganza trying to kickoff to drown out any real whistleblowers.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22295030
>>22295003
enabled by the legal system
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295031
>>22294996
came to dig, not mod
KEK
>good flameout stories
i'll bet
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22295034
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295035
>>22295013
I’m interested in Trumps future project in the Golan Heights
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1351b No.22295036
>>22295025
[Illegals?
Citizen gift-> visa?]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295038
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295047
YouTube embed. Click thumbnail to play. >>22295028
>>22295028
this one
https://youtu.be/xglaXVtQcis
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295048
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b5d27e No.22295049
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295055
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1351b No.22295058
>>22295051
Kek very fiat
Much fakery
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295060
EARLY Notables @ ~250
#27271 >>22294671
>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81
>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center
>>22294684 New footage of Cybertruck explosion
>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia
>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads
>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE
>>22294749 Anons discuss purpose of /qresearch
>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL
>>22294740 VIDEO: Hawaii Fireworks Explosions Update
>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery
>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22295068
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295070
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295075
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295079
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ede023 No.22295080
>>22294971
seems to be a zero missing in that number to the right
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
47d0e1 No.22295081
First order of the day when power returns to the people and President Trump returns home, is to charge any falsified events as if the real events occurred and be equally charged. This will stop most FF. narratives, and stop misleading others into wrongful actions.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295083
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1351b No.22295084
>>22295072
[More closure
Would be
G-R-E-A-T
recent PMB
Was some
Closure
But not
Enough
]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b110e3 No.22295085
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295086
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22295088
>>22295052
>very driven to succeed
driven to beat you…slightly different from general success. similar to a Napoleon complex, you can see the ambition to destroy you in their eyelids.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fb9f83 No.22295090
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
47d0e1 No.22295091
>>22295081
This has caused our society to move in certain directions that are not beneficial to them, humanity at large, impoverish most as the liars enrich themselves and create more slaves into their systems.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
042c47 No.22295092
>>22294837
Jacob is not their father, as for Israel,
only Abraham is their father, as they claim.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295096
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22295097
>>22295047
yes, that's the rumored 'controversial' interview
I have not watched it, i listened to it while working
i do not know if it used any particular visual aids
I was NOT impressed with their explanation of "gravitics" and US vs China in weapons-bigger-than-nukes-war… but whateves.
I think the hot spot was the conversation about the absurdities of the Jan 1st 'terrorist in NO and silly suicide bomber in NV
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295098
>>22295052
My first friend and best lifelong friend was Chinese but moved here when he was 4 with his large family. I spent most my time growing up in their house. I really got to appreciate their candidness.
He went on to become a mechanical engineer and after high school, we didn’t end up speaking often, but stayed in touch.
When we were kids, he was being mean to me so I punched him and gave him a bloody nose. Years later he thanked me for doing it and told me he had always been jealous of me because I never had to work hard at anything. That somehow I could hear something in passing and never forget it or pick up a controller to a game I never played and be a master at it.
I always hated this about myself. Always just wanted to be “normal” and did a lot of drinking to fit in.
He died from the Covid shit (not being ambiguous on purpose, just that’s all I know) and I can now say the better one of us passed in 2020.
I’ll miss him til the day I die and possibly beyond. He was my real friend.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8df370 No.22295099
>>22295091
We live in a fear and greed based society. The greedy will pine for work from the taskmasters and carry out their dirty work as the innocent will become enslaved to both.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295100
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295101
>>22295060
>Hawaii Fireworks Explosions Update
mainly taking out VS, he must have posted the deleted note.
most of the reports are 3 days old, the most recent thing i saw (3 hrs old) is below.
Hawaii fireworks explosion update
Arizona Burn Center after being injured in a fireworks explosion in Hawaii. 12News got new details on how they will be treated.
https://www.msn.com/en-us/news/crime/hawaii-fireworks-explosion-az-burn-center-director-details-victims-treatment/vi-AA1wYtOy#details
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8f3242 No.22295102
Self awareness goes a long way. Don't get caught in the current and find yourself swept out to sea.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
25e4d1 No.22295107
>>22295099
How many actually feared to support PDJT? How many came to his side only when they saw the inevitable as a survival technique? The true is tried.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295110
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c229c8 No.22295112
>>22295107
The same that change with the wind will surely become your enemy when the wind dies down. They will look for greener pastures at your expense and others.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1abccf No.22295119
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295121
>>22295097
they were talking about idea of drones having anti-gravity properties, as i recall
worrying about China high tech capabilities
i was also mostly listening, don't think they had visual aids
Codemonkey commented, was notabled sometime today:
https://x.com/CodeMonkeyZ/status/1875388879450132720
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d8aef No.22295126
>>22295112
Actors are cowards and have always been. Those that confront evil and stay true to their word are those that have a law and their deeds are in their actions without fear.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22295128
>>22295081
ummmm? if i understand you correctly…
If some one or group FAKES a school shooting of children… then THEY (the ones who faked it) should be charged and sentenced AS IF they had actually killed children?
What kind of trial and sentencing would there be for the group of people that False Flagged 9/11?
9/11 really happened, but the perpetrators framed other baddies and made CRAZY WAR against all humanity ever since. What do?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c92de5 No.22295130
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d0f284 No.22295132
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d8aef No.22295134
>>22295126
Acting is delaying a fight at other's expenses, especially those that stand and confront evil.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295138
>>22295130
Kek
Did you see the Ted talk where they said something like 80% of the worlds poop comes from rural India?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a97413 No.22295139
https://links.truthsocial.com/link/113774743402540142
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d0f284 No.22295142
>>22295132
And I'm actually NOT a bot, kek.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d150f No.22295145
>>22295134
To have a God, you must act like God Lives and sees and ears everything, and act accordingly. We do not deter from the path even at the cost of our lives.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d150f No.22295151
>>22295145
If you miss Elijah, you will never know anything except your lame excuses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d0f284 No.22295152
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295153
>>22295107
There's a reason why astronomy is the royal science. Our society is controlled far more by people following the winds than most know. Quite a bit of the chaos over the past decade resulted from my stunned disbelief to discover just that.
The ideals which the general population believes to be running society are only adopted economically when the signs in the heavens are favourable. This is hidden because if one truly understands the mechanics, individuals have a great deal more power to affect change than the wealthy would like.
Jesus' teachings are far more practical than how they are presented.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295156
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295157
>>22295137
The concept of pseudo-infinite energy is probably feasible given a person uses about 10 million joules of energy per day and just 8 ounces of enriched uranium contains 1.35x10**12 (10,000,000,000,000) joules
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295158
>>22295137
even when i don't know the properties of the systems discussed, figure there's always more heat than light out there
especially now
not use in getting wigged out
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d150f No.22295161
>>22295151
It cannot be begged for, borrowed, bought, nor stolen. It has to cost you and you alone. This is why no one knows. Choices for all the wrong reason.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295165
>>22295161
Religion can't help you, rhetoric can't help you, philosophy can't help you; only discipline in God's Law.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295166
Anon knows what a tripcode is, in how it relates to Q posts.
Anon ha not seen a description of what exactly the technical function of a tripcode is, or how it's used.
Like…what does it DO?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295169
>>22295165
Yet many go to their scholars, priests, and are quick with their words. They forsake the Living God.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295172
>>22295168
38? like today or all time
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6e3c8b No.22295177
Jan 6 is the official 2 weeks day
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c92c27 No.22295178
>>22295169,
How I wish you all would do well, because there is something more than this life, and if you knew, you would all cease and desist. But they are addicted to their folly.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c92c27 No.22295180
>>22295178
They are more interested in impressing others who are in a state of folly than a True Inheritance.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9abaea No.22295184
>>22295180
They marvel at the wrong things, and think, their ways are righteous in their own sight. Did they ever consider God once, in His Sight?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295187
>>22295177
>2 more weeks
After almost a decade, it’s finally here.
2
MORE
WEEKS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295191
YouTube embed. Click thumbnail to play. >ANONS!? WHO IS IN CONTROL???
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9abaea No.22295193
>>22295184
If they ever did, they would try to fool no one because they know they are only fooling themselves.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295197
>>22295158
proof that the same guy who posted yesterday is the one you're talking to today
we used em in /comms, where tripcodes are whitelisted (anyone can use)
in name field: ## [someword]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ab678 No.22295198
>>22295193
They would make amends, and seek to resolve the damage that they have inflicted on their victims.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295201
>>22295198
Do you ever stop and listen to yourself?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22295202
>>22295177
>Jan 6 is the official 2 weeks day
The Jan 10 sentencing makes anon wonder. He'll already be confirmed by electoral college, just not sworn in.
Why not schedule it for the 5th?
Seems like better legal strategy.
Anon will kek if part of sentence is to check in with a PO once a week to hand over all current financial documents for examination of porn actress payouts.
Imagine Trump actually submitting to that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295207
>>22295202
>why not the 5th
Because the courts would overrule it as obstruction of an election
The point isn’t to stall anything, its simply a publicity stunt so they can point and say, “Look the criminal president!”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e081e3 No.22295208
>>22295200
>he will teach them a terrible lesson
sends a sternly worded email
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295209
>>22295195
>>22295166
"it absolutely guarantees the authenticity of authorship"
I'm no IT whiz but it seems like kind of a short string of characters for the encryption to be absolutely guaranteed. Would Q just type that same string in the 'name' box?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295211
>>22295205
No really. These messages are read by many.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295215
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295218
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e081e3 No.22295220
>>22295215
test
one ping only
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
92b760 No.22295221
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295223
>>22295209
You don’t know how long the character set is that initiates the trip code for Q. It could be 100 characters. The input characters create a hash that is compared against the database hash which allows the user to initiate posting with that trip code.
I built an encryption that actually accepts words, sentences or even paragraphs and images to set a hash.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dd118b No.22295225
>>22295198
>>22295201
>Do you ever stop and listen to yourself?
I say these things, not for myself, but to the one who is truly searching. Think about this:
Convenience, Stores, and Stores that steal from Stores.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295226
YouTube embed. Click thumbnail to play. https://youtu.be/q7zOMr34e4E
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e081e3 No.22295227
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295229
YouTube embed. Click thumbnail to play. https://youtu.be/zPVOTARWDuQ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
411fd4 No.22295230
>>22295225
People are motivated by conveniences.
They have become store of.
And then there are those stores that steal from other stores.
Excuses are not reasons, they are excuses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295234
>>22295197
Ok thank you. so that's what I was asking, it's not just the string of characters but there's a functionality tied to it, and it's turned off here.
I was wondering why none of the fake Q posters were adding a tripcode that was just a few characters off or something
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
34196f No.22295244
Vati shill lives in Asia and this is his second part time job after his main part time job
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fefd83 No.22295251
>>22295230
The best of them still await on their interpretation of a few lines of scripture to be fulfilled. Their work is still limited.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1351b No.22295252
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5ccd4 No.22295253
>>22294743
So now they can make more money on breast reduction surgeries???
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295256
>>22295225
That's really not what it looks like from here. It looks like a lot of rhetoric that, if accepted, sabotages self worth. That may be the right path for some, but such messages can also cause significant harm to some who don't need them, yet can't see that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c9bb4 No.22295263
>>22295250
maybe seeweed farmer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c9bb4 No.22295265
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295266
Hey vati, who's yer daddy?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295267
>>22295223
wow. impressive and very dasting. reading that and how little I understand it…I realize I am probably like forest gump level intelligence.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fefd83 No.22295268
>>22295251
They search for what is already available. But conveniences.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fefd83 No.22295272
>>22295268
Did you hear that? Can you hear that? Would you delay? Would you make an excuse?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eabd6e No.22295274
>>22295272
Though shall not test The Lord Thy God. Is a partial equation.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22295276
>>22295105
>they feel it is rude to show their true emotions
>even among friends
actually smart. certainly lost the vast majority of true blood american friends over the last decade+ that I'd made since childhood. these are now example lessons for my children: fuck other people; family first.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eabd6e No.22295277
>>22295274
People are lazy, because it is convenient.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295278
>>22295271
lighten up francis
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5c87f No.22295279
The irony is that trump will have to sleep in the same bed that biden sharted in.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295280
If the foo shits swear it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eabd6e No.22295281
>>22295277
Then why not test yourself? Why search for what is readily available?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdcb89 No.22295282
>>22295281
Because no one wants to go get it, least pay for it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
669f8e No.22295283
>>22295266
vati was spawned from a disgusting sea-slug
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295284
>>22295230
The bitch of it is that if one truly wants lo live in the world, one must open themselves up to others. Such can cause conflicts of motivations which can be easily misinterpreted by one's self and observers.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
669f8e No.22295286
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295287
YouTube embed. Click thumbnail to play. >>22295229
https://youtu.be/77Cuu61Ci_o
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9a0e96 No.22295288
>>22295284
You can be concerned with others that are in a state of folly or know for yourself.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295289
>>22295284
would you describe yourself as good, or bad, at parties? we already know the answer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
980197 No.22295290
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295292
>>22295267
Start here
If you find it interesting enough, you will intuitively know the next step after learning this series
https://youtube.com/playlist?list=PL2jrku-ebl3H50FiEPr4erSJiJHURM9BX&si=vNDmG57Rx5geU8MQ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
669f8e No.22295293
>>22295279
kek
I bet the stank of the obamas still lingers
big mike's jockstrap somewhere still in the lincoln room
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9a0e96 No.22295295
>>22295288
Do not expect anyone to follow you, there are too many conveniences and excuses for them to store.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295296
>>22295288
You make it sound like not caring about others is some sort of higher calling.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295297
>>22295294
It’s not a video
It’s a series
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295298
>>22295060
>>22295060
baker, you can please add anon's comment to this notable? >>22294684
becomes:
>>22294684, >>22294831 New footage of Cybertruck explosion
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295299
So, would you describe yourself as a "power" bottom?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5c87f No.22295300
>>22295293
No new mattress is going to clean this shit up :D
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295301
>>22295296
>You make it sound like not caring about others is some sort of higher calling.
>>22295272 reread this, quite the opposite.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295302
>>22295292
many thanks fren.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295304
>>22295295
And so shall the blind eye and deaf, not see nor hear.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295305
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295306
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295307
>>22295304
Does anyone get The Greatest Value in Life, for nothing? Even gold is dross.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
980197 No.22295308
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295310
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295312
>>22295307
You can fool fools, but never God. He judges hearts.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295314
>>22295312
Down to the very soul.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295317
Poke the eye with a jagged, splintered, stick.
Now we twist.
Now we thrust into the eye.
See no more it will.
Stomped beneath my heel.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295320
>>22295310
ayyy! Timestamp for the WIN.
Nicely done
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295321
>>22295314
But time is short.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295322
>>22295312
It's certainly been enlightening, observing the difference between God's judgment and that of man.
Especially when men attempt to falsify god's judgment.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
297cb7 No.22295324
>>22295322
The Law is immutable.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295327
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295330
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295332
>>22295324
Words and Deeds are mutable, out of convenience. Except to those that know the Law.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295334
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295338
>>22295327
Our time is not His Time, unless we remember The Law.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295342
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295345
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295346
YouTube embed. Click thumbnail to play. >>22295229
~1
>>22295287
~2
https://youtu.be/f8bMV0g6Owk
~3
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295347
>>22295338
There always comes a time in everyone's life when nothing is funny. Then comes pure attention.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295348
>>22295347
Then comes your training.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295349
>>22295348
What you Mastered.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295351
>>22295306
yea all good
looking into those dna decryption tools posted the other night >>22288888
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295352
>>22295349
Were you ever truly a slave?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295358
>>22295353
>attention is neither retention, nor comprehension
What do you think I mean about pure attention?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db81b9 No.22295360
>>22295355
>we're ALL slaves
>can you ever stop wiping your ass?
You marvel over the wrong things.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295362
I was just thinking, I don't remember any world leader going to Delaware for dinner at Biden's house…Im just sayin, kek…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295366
You shouldn't have done the crimes.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ed661 No.22295367
>>22295352
Then you would have already found the Master.
Stores.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295375
>>22295351
happy hunting,
o7.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ed661 No.22295379
>>22295364
>what do you mean, what do i think?
The type of attention that I am talking about is not of the mind alone but from ever part of your Living Being not just your living being.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295383
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295386
>>22295383
slightly lower, kek.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ed661 No.22295387
>>22295376
>when the pupil is ready the master appears
>the master cannot be "found"
This is a cliche. I said before. Though shall not test the Lord Thy God, then test yourself.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295393
Ya'll understand "nobody gets a pass", right?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22295396
Blizzard, enemy of Iron Man
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295399
What's good for the Goose, is good for the Gander.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d8834f No.22295400
>>22295393
Walls of the mind are hard to create… with illusion.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ff20bd No.22295405
>>22295390
Remember, I said it cannot be begged for, borrowed, bought, nor stolen. In essence, it has to be earned. By all means, means work.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295406
>>22295322
Can you leave Heaven if you wanted to?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ff20bd No.22295411
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5c6953 No.22295413
8KUN HTTPS CERTIFICATE EXPIRES TOMORROW
PLEASE REPLACE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295416
>>22295413
will pass along, tx.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ff20bd No.22295417
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
20dedf No.22295423
>>22295378
Updated status on [44]?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295424
>>22295419
That's what I thought. Hell is a prison, Heaven is also a prison..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295425
>>22295351
looking over the trip_gen trying to understand.
I am not a smart anon. forest gump assessment was accurate.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ff20bd No.22295426
>>22295417
If by words alone, then everyone could achieve.
If by wealth, then everyone could buy.
If by favor, then everyone has nothing to do.
It has to be earned and that will cost you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295429
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295431
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22295433
>>22295396
>Blizzard, enemy of Iron Man
https://en.wikipedia.org/wiki/Blizzard_Entertainment
Originally founded in 1991, the company is best known for producing the highly influential massively multiplayer online role-playing game World of Warcraft (2004), as well as the multi-million selling video game franchises Diablo, StarCraft and Overwatch.
Founded as Silicon & Synapse, Inc. [SS]
Microsoft acquired Activision Blizzard in 2023, maintaining that the company will continue to operate as a separate business, while part of the larger Microsoft Gaming division; Blizzard Entertainment retains its function as the publisher of games developed by their studios.
A metric fuckton of data centers are in the path of this storm…is my best guess. Good time to make some changes.
https://www.datacentermap.com/usa/
As an aside, I was learning about Space Law, which is rooted in Maritime law. Lots of extraterritorial issues. Anyway, there are ships floating in US waters paying internationals to do American IT work but pay them jack shit. It's so fucked up.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295434
>>22295426
I thought the words were something like this…my bad, forgive please…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ab678 No.22295435
>>22295426
To find a well, you have to dig deep and work.
To find the Fountain of Life, you have to go where none are willing to go, except the one that God has already assigned you. The Spirit of Truth.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
281872 No.22295438
>>22295285
>think maybe you've gone too far the opposite direction there…
I think your posting too much.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ad086 No.22295441
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ab678 No.22295442
>>22295434
>I thought the words were something like this…my bad, forgive please…
Start from here >>22295347
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295444
>>22295437
I've heard of St Peters Gate, thats where you show your papers to get in but wheres the exit?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295446
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295447
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8da304 No.22295451
>>22295351
>>>22288888
here is a single file implementation built from the scripts in that repo from when the author first published the code… slightly cleaner https://gist.github.com/foldxy/b782b16dd205a212d65f0d5a13cfa348
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b9a9e3 No.22295456
>>22295435
>The Spirit of Truth.
Will lead you back to Christ.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
042c47 No.22295459
Usage
user$ python3 dna_encryption.py
Input: hello world
Encryption: ACTACAAGTAGTATGCTTGCGATGCACAGTAAT
user$ python3 dna_decryption.py
Input: ACTACAAGTAGTATGCTTGCGATGCACAGTAAT
Decryption: hello world
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b9a9e3 No.22295460
>>22295456
Then you will know the Father and the Son.
You will know and be known.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295461
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295462
>>22295449
Sounds like a nice place to visit but I wouldn't want to live there…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32d814 No.22295464
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295466
>>22295454
you need to care, you're over 10%
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b9a9e3 No.22295467
>>22295460
The information is in The Light.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8555eb No.22295470
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b9a9e3 No.22295473
>>22295467
Until then work.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
88fe5c No.22295475
YouTube embed. Click thumbnail to play. Live feed of blizzard closures
https://www.youtube.com/watch?v=3xxJXXqUrVg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
caeee8 No.22295478
>>22295466
Lol of what? Lol
1/10 of a 100 is only 10…
A lot by what standards…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295480
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295482
>>22295478
Its enough for me…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f98d44 No.22295483
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295487
>>22295424
cool, thank you
the dna i'm looking at has 'I's and '0's in some of the allele positions
when running the code i get an error since they're not mapped to any of the rulesets
was thinking of setting 'I' to '1' and '0' to '0' or ' '
maybe just them?
any recommendations?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
048962 No.22295489
>>22295473
There is no greater Teacher.
In the blink of an eye, you will understand.
Then you will be accountable, should you chose to be. For you will have a solid foundation that cannot be denied down to your soul, knowing no excuse or convenience.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c01fb6 No.22295490
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295491
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295492
>>22295487
**maybe just removing them?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295493
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295494
holy spam bots anons. never seen it this bad
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
048962 No.22295495
>>22295476
>riddle me this…
>what if you proselytizing actually turned more people AWAY from Christ than were drawn to Him?
>would you STFU?
>wouldn't your pontificating be doing Satan's work?
Judas was bound to go his own way.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dc6807 No.22295496
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295497
>>22295494
try mornings, kek.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295498
>>22295487
I am not the anon you were looking for but GM anyway.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5c6953 No.22295499
YouTube embed. Click thumbnail to play. >>22295491
The man on the moon, obviously.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295500
If I could go back in time, I'd bring Hitler a microwave!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295501
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1249db No.22295502
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
467c8b No.22295503
>>22295495
Those that tire, are already lazy.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295504
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
467c8b No.22295507
>>22295503
Milk for children, meat for adults, because some things are harder to digest.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295508
if the moon landings are real why aren't the moon landings real?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295510
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32d814 No.22295511
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a20789 No.22295513
https://t.me/prevent1984/3143
Biden Quietly Bans Most Gas-Powered Tankless Water Heaters
This is actually happening.
https://vigilantnews.com/post/biden-quietly-bans-most-gas-powered-tankless-water-heaters/
Follow @Vigilant_News 📱
X (https://x.com/VigilantNews) | Rumble (https://rumble.com/c/VigilantNewsNetwork) | IG (https://www.instagram.com/VigilantNewsUS/)
More Stories:
🌐 VigilantNews.com
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4dcc07 No.22295514
HRC is getting a medal of freedom???
benghazi is trending
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295518
>>22295513
Trump's going to have a lot of un-banning to do.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
78784f No.22295520
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295521
>>22295491
Looks a little grainy, maybe an Earth bound telescope?
>>22295514
I remember thinking if a video is all it took, we should all be making videos…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d8834f No.22295522
>>22295500
Things are not good ideas… you have remember to think before you speak.
It is shocking to me how some people do not know what something’s mean and only away of common versions that only exist because of function.
?
Not a fan of the statement but what does that matter…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8da304 No.22295529
>>22295487
So you are saying that there the letters "I" and "O" in the sequence you are exploring? not just the base ACGT?
You could expand the rulesets for those additional characters and then introduce additional binary conversions in the script.
ie: the first rule would become (A) 0000, (C) 0001, (G) 0010, (T) 0011, (I)0100, (O)0101
This will also require additional rulesets to cover all possible combinations of ACGTIO
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a81b9 No.22295535
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a7b673 No.22295539
>>22295523
Then your work is already accomplished. Then you have already seen the Truth. There are libraries upon libraires open and in secret, yet none can testify.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1398af No.22295542
>>22295500
Microwave cooking oven was patented on October 8, 1945 with the one of the first prototypes placed at a Boston restaurant for testing. The first public was in January 1947 in a Speedy Weeny vending machine in Grand Central Terminal which sold freshly cooked hot dogs.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295546
>>22295522
You're a right proper cunt aren't you? You don't speak American, do you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295547
>>22295487
was meant for >>22295451 kek
>>22295529
>So you are saying that there the letters "I" and "O" in the sequence you are exploring? not just the base ACGT?
"I" and "0"(zero)
thanks that makes sense
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295553
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295554
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295556
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295558
>>22295544
you sound like you're vaccinated
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a20789 No.22295559
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bfea1c No.22295561
>>22295546
American’s speak English…
They actually have a programed setting for (American English)
You may not understand this you never thought their maybe other versions that you can set your computer OS to. Maybe you should try I hear you can YouTube it.
Just a thought?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
354947 No.22295562
>>22295539
How is it that those that say: The master will appear when the student is ready or something similar, cannot teach about God's Law?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2a988 No.22295565
https://x.com/TrackAIPAC/status/1875813461692985450
Scott Pressler… AIPAC boy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295566
>>22295556
Russian Skinheads in Our American Congress?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8c81f No.22295567
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
628faf No.22295568
>>22295121
Wait until they get to the entangled gravitons, let you get past some of the peskier limits with enough energy.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295571
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8c81f No.22295577
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7846c6 No.22295578
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295583
what an absolute bastard
>>22295513
New Biden water heater ban will drive up energy prices for poor, seniors: expert
The Department of Energy is banning non-condensing water heaters
Biden ‘doubling down’ in the face of ‘absurdity’ with latest climate push, expert says
Climate Depot Executive Editor Marc Morano reacts to comments from a Senate hearing on climate concerns and sounds off on the Biden administration's latest climate push on ‘The Bottom Line.’
The Biden administration is banning certain natural gas water heaters from the market as part of its climate change agenda,a move critics say will jack up energy costs for low-income and senior households.
The move in the final days of the administration will take non-condensing, natural gas-fired water heaters off the shelves by 2029 in a bid to reduce carbon dioxide emissions, which climate change advocates and President Biden say cause global warming.
The new rules will require new tankless gas water heaters to use about 13% less energy than today’s least efficient tankless models. ….
https://www.foxbusiness.com/energy/new-biden-water-heater-ban-drive-up-energy-prices-poor-senior-expert
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5536a1 No.22295588
>>22295550
>we are all works in progress
Correct, most make claims, only a remote few can ever testify. Their testimony would teach you about what they learned, and they would tell you what I tell you, it has to be earned, and it will cost you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
caeee8 No.22295589
>>22295562
Lol
You seem mixed up about things. Your you the master or the student. You see one must always be willing to learn from all experiences not really setting expectations of being anything but open minded.
There is no real “God’s Law” there are the 10 commandments id that what you are trying to say. This is more like guidance because how do you not kill someone trying to kill you…
Reasonable men have reasonable mines
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295593
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2a988 No.22295595
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295597
You ip hopped fur dat?
>>22295561
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
caeee8 No.22295599
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
067373 No.22295600
>>22295585
>maybe bcs rote memorization of dogma authored by men is the antithesis of learning?
This is a world of actions until you can prove that prayers work. How many times have you heard the so called pious say, I am praying for you but other than that, they require no work?
It has to be earned, and it will cost you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295601
Notables @ ~510
#27271 >>22294671
>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81
>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center
>>22294684, >>22294831 New footage of Cybertruck explosion
>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia
>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads
>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE
>>22294749 Anons discuss purpose of /qresearch
>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL
>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery
>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders
>>22295101 Hawaii fireworks explosion update
>>22295475 LIVE FEED: Blizzard Highway Closures
>>22295513, 22295583 Biden Quietly Bans Most Gas-Powered Tankless Water Heaters
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06e9d No.22295602
>>22295590
>>22295591
>>22295592
>>22295594
>>22295596
>>22295598
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
99bd00 No.22295604
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06e9d No.22295605
>>22295601
>>22295603
notable
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295606
>>22295601
tyb
black linky at the end, kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06e9d No.22295607
JUDGEMENT DAY OF RECKONING - THE DECODE THAT DOES NOT NEED DECODED
Feb18, 2018 8:41:03 PM EST 790
Q !UW.yye1fxo ID: 000000 No. 104
@SNOWDEN
WHERE ARE YOU?
NOT RUSSIA.
[EYES ON]
YOU ARE NOW A LIABILITY.
HELPING @JACK?
PROJECT DEEPDREAMv2[A]].
WE WILL NEVER FORGET.
ES FAILED.
WHERE IS ES?
JOHN PERRY BARLOW.
DEFINE THE END?
THE DAY OF RECKONING IS UPON US.
JOHN3:16
Q
Feb22, 2019 6:03:30 PM EST 2876
Q !!mG7VJxZNCI ID: 592cf1 No. 5333408
https://twitter.com/HillaryClinton/status/1098294023738064898
For those who think this war is fake, or we are not a considered a major threat, this is a direct attack by Hillary Clinton on 'Q' & 'PRO POTUS' PATRIOTS.
The article referenced has an embedded link that literally TARGETS PRO POTUS/Q Twitter accounts that have been IDENTIFIED by CLINTON/DS as serious threats (ability to shift the narrative).
Twitter has already begun to remove targeted accounts (stages) under false pretenses.
The war is real.
The threat is real.
CLINTON PANIC.
CLINTON FEAR.
JUDGEMENT DAY COMING.
Q
Apr02, 2018 11:47:24 PM EDT 989
Q !xowAT4Z3VQ ID: 491f56 No. 875289
Apr 02, 2018 11:45:09 PM EDT
Q !xowAT4Z3VQ ID: 491f56 No. 875265
April [A].
IG report.
Sessions public attack.
RR problems.
Seals broken.
[A]rrests.
Why was Huber made public?
Why now?
Everything has meaning.
[A]wan.
Tarmac.
Iran.
NK.
U1.
FBI.
DOJ.
Mueller.
Election Integrity.
Immigration Bill.
Border.
Wall.
Military start.
BIG month.
Q
>>875265
Facebook.
Amazon.
Twitter.
GOOG.
………..
BIG problems.
Q
Apr03, 2018 12:03:57 AM EDT 991
Q !xowAT4Z3VQ ID: 491f56 No. 875587
Apr 02, 2018 11:58:41 PM EDT
Anonymous ID: 015520 No. 875485
Apr 02, 2018 11:45:09 PM EDT
Q !xowAT4Z3VQ ID: 491f56 No. 875265
April [A].
IG report.
Sessions public attack.
RR problems.
Seals broken.
[A]rrests.
Why was Huber made public?
Why now?
Everything has meaning.
[A]wan.
Tarmac.
Iran.
NK.
U1.
FBI.
DOJ.
Mueller.
Election Integrity.
Immigration Bill.
Border.
Wall.
Military start.
BIG month.
Q
>>875265
Tip Top Tippy Top Shape
>>875485
It was requested.
Did you listen today?
Q
Apr03, 2018 8:42:09 PM EDT 995
Q !xowAT4Z3VQ ID: 463ae0 No. 884736
Future proves past.
Several today.
[1 day]
RR.
Military.
Border.
Keep watching the news.
[A]pril.
MOAB.
Q
Apr03, 2018 8:43:55 PM EDT 996
Q !xowAT4Z3VQ ID: 463ae0 No. 884763
Apr 03, 2018 8:42:09 PM EDT
Q !xowAT4Z3VQ ID: 463ae0 No. 884736
Future proves past.
Several today.
[1 day]
RR.
Military.
Border.
Keep watching the news.
[A]pril.
MOAB.
Q
>>884736
Coincidence another MSM narrative change upon release of damaging news?
People are waking up.
Trace the background of the shooter.
Focus on Father.
20 years.
Q
Apr03, 2018 8:45:50 PM EDT 997
Q !xowAT4Z3VQ ID: 463ae0 No. 884799
Apr 03, 2018 8:43:05 PM EDT
Anonymous ID: dd4e73 No. 884748
Apr 03, 2018 8:42:09 PM EDT
Q !xowAT4Z3VQ ID: 463ae0 No. 884736
Future proves past.
Several today.
[1 day]
RR.
Military.
Border.
Keep watching the news.
[A]pril.
MOAB.
Q
>>884736
P = pope?
>>884748
[Pope]will be having a terrible May.
Those who backed him will be pushed into the LIGHT>
Dark to LIGHT.
TRUTH.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06e9d No.22295608
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06e9d No.22295609
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295610
>>22295604
>>22295606
fixed, gonna be looking for a handoff next bread kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06e9d No.22295611
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295614
>>22295488
acting like a jerk, anon.
57 posts.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdcb89 No.22295615
>>22295589
Men do not have reason, they have a multitude of excuses out of conveniences. I told you before God's Law is immutable, for it is He Himself, and His Law is His Word, and He is His Word; unlike men that use excuses as reasons.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295618
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
580551 No.22295623
YouTube embed. Click thumbnail to play. i was only able to make it to 37 minutes
either she's dumb and being played
or she is acting dumb trying to play her audience
i can't listen to her any more
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295628
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c97d1f No.22295629
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295631
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295632
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7c84ba No.22295633
>>22295600
For those that find my words obnoxious to them, there is a reason that they are. This is not to make you feel guilty, but to tell you of the path, should you travel down that lonesome road. This is where you will find the one that God has designated to you; and only if you do these things for God's Kingdom come, and not out of vanity.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c01fb6 No.22295636
>>22295600
Praying is much like setting an intention and the will to practice it though your walk of live that day or for a time.
As far as the pray it only will work if the resolve you place to bring it about is there… however there is extra elements out there I believe. The universe will conspire to help you as long as your intention is pure I believe. Being Gods will.
As far as praying working it has mult means as if you speak a pray it has and holds more power, to lay hands is another act of agreement, one of which allows people to interact with in your personal space in agreement, and last and most important speaking that prayer and others in agreement their God himself is said to be there.
I like to think this is because of the action taken a force be it of the words and sound… after all this intention can become much stronger if other share the path to the goal.
Perhaps people may not like my view but I see nothing wrong with this…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295637
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8c81f No.22295639
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295640
>>22295610
there's often a gap around now
it'll get picked up at some point
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295641
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295642
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295644
>>22295002
Never miss an opportunity to point out that Jumpin Jack Flash couldn't get what he wanted but will get exactly what he needs…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295647
>>22295638
one whom Q has broken
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c9e005 No.22295649
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295650
YouTube embed. Click thumbnail to play. >>22295643
I see you, bitch.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295652
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c9e005 No.22295653
Fucking homes. Pick your banknotes, faggots
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe401 No.22295654
>>22295617
Yes, sorry, I actually meant to say, your prayers work not prayers themself. For example, would you want someone to say when your in dire straits, I am praying for that God helps you and leaves you there? Or would you rather have someone taking action to help you? Unless that person's prayers actually work, it is just vanity, laziness, and really not helpful at all.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295655
>>22295646
have 30 posts - notes, digs, BV.
you now have none.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2646d No.22295656
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295657
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a81b9 No.22295658
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295660
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c9e005 No.22295661
Eh, homos!
2724
Feb 14, 2019 11:42:27 PM EST
Q !!mG7VJxZNCI
A Traitor’s Justice.
Phase III
Panic in DC.
RATS EVERYWHERE.
For those who decide to save the taxpayers some money - There is no escaping God.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a5e4da No.22295662
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295664
YouTube embed. Click thumbnail to play. >>22295659
No bitch, you're fucked.
Eat it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6edd12 No.22295665
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295668
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df8815 No.22295670
YouTube embed. Click thumbnail to play. Ive been doing a ton of digging and I think I found a way out of Hell…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295671
>>22295610
>>22295610
taking out quite a bit, heavy shilling slows the bread down quite a bit
if you prefer, you can bake before 751 - 600 is often a good target - and i will lock
let me know
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2646d No.22295672
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c9e005 No.22295673
YouTube embed. Click thumbnail to play. You fucking homo ass traitors
Go be a statistic
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c2450 No.22295674
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a5e4da No.22295676
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295677
>>22295654
i get your point and i'm usually the one arguing it
i agree with "the Lord helps those who help themselves"
i'm being devil's advocate because your posts are not unambiguously clear
and there are always occasions when people are helpless and the only action available is prayer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295678
>>22295654
i get your point and i'm usually the one arguing it
i agree with "the Lord helps those who help themselves"
i'm being devil's advocate because your posts are not unambiguously clear
and there are always occasions when people are helpless and the only action available is prayer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2646d No.22295679
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295682
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295684
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3015ea No.22295685
>>22295636
Prayers are easy, miracles are hard, you must have down the work beforehand.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2646d No.22295686
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2646d No.22295690
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a81b9 No.22295692
the answer is within you..but it's the wrong one
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5591b1 No.22295693
>>22294748
Exceptionally attractive female model that does not have either of the atypical spirits found typically within QR. That is not a threat or a thread yet.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2646d No.22295697
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a5e4da No.22295699
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c61f7f No.22295701
>>22295678
>the Lord helps those who help themselves
Even better yet, those that help others. Those that hearken will be rewarded, should they persist in their intention and actions. They develop the True Spirit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295709
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295711
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a6d25 No.22295714
>>22295701
It is not an easy path, and it may require everything that you have including your life. But I tell you Elijah already came, and they did not recognize him but di whatever that they wanted with him. They will have their excuses, and at the end of the day, it will cost nothing of them, and they will surely miss Elijah. John Baptized with Mercy, watch the water.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295715
>>22295677
It's a big problem with communication online. Far too many ways to read even simple messages. That's why I harp on the importance of speaking with people face to face for anything important. Tremendous errors have been made with confidence because people have been far to certain that their interpretation of online information is correct.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295718
>>22295693
alrighty, around 600 ill start bake
so this is aLAST CALLsince nothing else been added
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b110e3 No.22295719
>>22295692
Who is to say what is wrong or right? I can respect others believes… why not do the same.
I remember a line out of a movie I liked… it was advice from a father to a son.
It went something like this…
“Who ever told you that you should be happy? Happiness is note here nor their… you can’t hold you can’t take it with you.”
Perhaps even if sad there is happiness in the mind set that exist know that it is just as above, an emotion.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c814bc No.22295721
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295722
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295724
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295725
>>22295701
true that
but that concept is exactly echoed in The Dao
and it was not necessary to invoke a supernatural being to arrive at the same conclusion
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cb3dcb No.22295727
>>22295719
Life has a funny way of smiling on people… you really think life being easy is a true test of anything.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
71134b No.22295729
>>22294609 lb
Airway Heights, WA is just a mile or so east of Fairchild AFB. Fairchild used to be a B-52 bomber base with a nuke weapon storage area. The B-52's and presumably, the nukes, were moved out years ago and today Fairchild is primarily an aerial refueling base.
A B-52 famously crashed there in 1994 as the pilot, Bud Holland, attempted to avoid an illegal overflight of the nuke storage area while practicing for an air show.
https://en.wikipedia.org/wiki/1994_Fairchild_Air_Force_Base_B-52_crash
Yeah that image is the B-52 on edge just 50ft above the ground. One crewman has ejected but descended into the fireball.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a81b9 No.22295731
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf4d2b No.22295732
>>22295714
>John Baptized with Mercy, watch the water.
The Living Waters was eventually revealed to him.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a20789 No.22295734
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295736
>>22295718
ok, will stick with you til 600 and lock after you bake
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295740
>>22295718
>so this is aLAST CALLsince nothing else been added
СЛАВА БОГУ
let's wrap this puppy up so i can get some sleep
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf4d2b No.22295742
>>22295732
First comes the one who baptizes with water, then comes the one who baptizes with fire. This fire is the Living Waters.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d8834f No.22295747
>>22295737
God loves all his people rather they acknowledge them or not. That is what I believe anyways… a head extended is better then one that is not reached.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295749
>>22295718
last call for boobs too fugit
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c5d6d1 No.22295750
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295752
>>22295692
>the answer is within you..but it's the wrong one
the wrong is within you, final answer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
da99b8 No.22295753
>>22295725
The information is in The Light of Living Waters.
Then you will know the Father and the Son.
All will be revealed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295754
>>22295741
Suck your own dick if JFK Jr is still alive.
Pics or it didn't happen.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c814bc No.22295755
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
893eeb No.22295757
>>22295747
Hand extended… not head… this maybe the auto correct os bs… going on often.
Lol
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d89154 No.22295760
>>22295754
Not sure why this is necessary rather he is alive or not? Lol
However you do as you like…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a20789 No.22295761
https://x.com/LauraLoomer/status/1875693124586275200
Laura Loomer
@LauraLoomer
THREAD:
🚨ATTENTION MAGA🚨
I am as hard headed as they come. But, sometimes you need time swallow your own pride and agree to disagree on issues for the sake of preventing an implosion.
I thought a lot about this week and I would really like to see all of this division end.
12:57 PM · Jan 4, 2025
·
67.3K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bebdaa No.22295763
>>22295753
The harvest is now, but the Laborers, workers, are few. It requires work.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295766
>>22295760
Rope store, faggot.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f152ee No.22295768
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295769
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295771
>>22294671
>>22295722
need to tag the dough:
baker is baking @600
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1e1fb3 No.22295774
>>22295763
Those that have ears and eyes that grow dull, will never work for the see nothing has to done nor hear about anything that has to be done.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295775
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a81b9 No.22295777
shouldn't run out of carrots … should know
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c97d1f No.22295779
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
654e4f No.22295780
>>22295749
would
imagine the tittyfuck
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295781
>>22295773
Suicide isn't forbidden in the Torah.
DO IT.
FUCKING DO IT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c82a8 No.22295784
>>22295769
Confucius was a philosopher not a worker.
If by words alone, then all would achieve.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295786
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a5e4da No.22295787
>>22295761
She showed everyone exactly who she is without a doubt. There's no going back now.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295789
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295790
>>22295763
>>22295784
fuck off, IP hopping shill
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a81b9 No.22295792
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ef41a6 No.22295794
>>22295787
She showed everyone her benis?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295796
>>22295771
bread is past 1000 a while back
DO IT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
79b4e0 No.22295799
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6c291e No.22295801
>>22295784
His Ways are not our ways. His ways as if one is traveling to their own destruction, as if one has no counsel. But they never counted on the recompense of Holiness, and that was their downfall.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295803
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295807
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295811
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295814
>>22295761
>swallow your own pride
what guy hasn't wished he could do THAT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295815
this is why we can't have nice things
>>22295809
>1029 replies
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
79b4e0 No.22295816
>>22295799
[AS]
what happened at the hotel, negger?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f1a9c No.22295822
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
654e4f No.22295824
>>22295811
BROKEN ARROW
BROKEN ARROW
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295825
YouTube embed. Click thumbnail to play. >>22295784
>If by words alone, then all would achieve.
By words alone.
Get out of our fucking way.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295826
>>22295761
"loomer apologizes"
that's something
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295827
>>22295811
what fucking difference does it make?
bread is FIVE HOURS old
how long is baker supposed to hang around in the kitchen?
undelete some damned posts….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295830
>>22295826
>"loomer apologizes"
>that's something
Bitched out and groveled.
Insta-mute from me personally.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295831
>>22295827
it's all good im chillin
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295832
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
693470 No.22295835
>>22293183 pb
Looks like a combo between Lincoln and Tesla with Laser Eyes.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295837
>>22295833
You already lost faggot.
PREPARE.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295838
>>22295831
that guy's not trying to help, kek….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295839
YouTube embed. Click thumbnail to play. what's in those catechism crackers?
You gotta tell EM, anon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
654e4f No.22295841
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d7743d No.22295843
>>22295825
>Get out of our fucking way.
When the time comes, I will go before you, with more than words, but with The Law.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295846
>>22295835
i woulda guessed john mcafee
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295848
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295849
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
79b4e0 No.22295850
>>22295799
>>22295816
you better put this bitch back in the shoe box
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
72bd54 No.22295853
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
654e4f No.22295854
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295856
>>22295851
Welcome to the bunker, bitch.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295858
>>22295841
no wonder they have to beg people to baker
absolutely ZERO respect for peoples' time
guess that never crosses their self-righteous minds
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a20789 No.22295860
https://x.com/ChanelRion/status/1875562480455295121
Chanel Rion OAN
@ChanelRion
While no one was looking…
Why did Biden REMOVE this clause from Policy Directive 28?:
“THE UNITED STATES SHALL NOT COLLECT SIGNALS INTELLIGENCE FOR THE PURPOSE OF SUPPRESSING OR BURDENING CRITICISM OR DISSENT.”
@ChadRobo
reminds us… Biden ALSO quietly lifted DoD Directive 5240, a 40 yr rule, preventing the military from collecting on US Citizens… just before the election.
4:18 AM · Jan 4, 2025
·
128.9K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a5e4da No.22295863
"We're going to stop these Jew-Haters!" Trump
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295865
>>22295859
Some dogs are brown.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
79b4e0 No.22295867
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295869
>>22295838
yeah…
and we got self-appointed hall monitors in here bitching about post counts….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
654e4f No.22295872
>>22295858
forget about having bakers
should just do back to back auto e-bakes
don't worry about notables, most never read them or they are shit anyway
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295875
>>22295866
>IT IS ALWAYS LISTENING
These are my balls and this is their skin.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
79b4e0 No.22295876
>>22295867
say my name, bitch
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295878
YouTube embed. Click thumbnail to play. >>22295839
>You gotta tell EM, anon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
306260 No.22295880
7 boxxies 'elon'. Time to go home to mommy and send out your good twin you half breed dumb alien motherfucker.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8bc44 No.22295881
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3a9d37 No.22295882
>>22295701
Saw an interesting philosophy in a frivolous bit of fiction. The idea is that "luck" is a function of how much you consider others, and how far into the future you consider them. Thus someone who considered all people, for all time, would have fortune unsurpassed by any other living soul, appearing as divinity in the flesh to outside observers.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a20789 No.22295883
>>22295877
https://x.com/bobscartoons/status/1875863193786212829
Bob Moran
@bobscartoons
12:13 AM · Jan 5, 2025
·
1,125
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
351c61 No.22295885
>>22295845
A symbol is an expression of one thing for a more complete definition of another.
A character is an identifier of a certain value.
Some values change, others are immutable.
Resolve.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295886
YouTube embed. Click thumbnail to play. >>22295877
>GUISE!!!
>>22295878
>>22295839
>>You gotta tell EM, anon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
79b4e0 No.22295887
>>22295876
[HASHTAG]FUCKTHEPOLICE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
19b838 No.22295888
>>22295843
>When the time comes, I will go before you, with more than words, but with The Law.
You're in for a surprise.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295889
FINAL Notables @ ~605
#27271 >>22294671
>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81
>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center
>>22294684, >>22294831 New footage of Cybertruck explosion
>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia
>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads
>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE
>>22294749 Anons discuss purpose of /qresearch
>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL
>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery
>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders
>>22295101 Hawaii fireworks explosion update
>>22295475 LIVE FEED: Blizzard Highway Closures
>>22295413 8kun HTTPS certificate expires tomorrow
>>22295513, >>22295583 Biden Quietly Bans Most Gas-Powered Tankless Water Heaters
>>22295860 @ChanelRion: Why did Biden REMOVE this clause from Policy Directive 28?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
872283 No.22295892
>>22294724
Notice there's no before pics- even of her in just everyday life.(At home, out with friends, at the beach, birthday party)
Sounds a bit off.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
654e4f No.22295894
>>22295880
elon is a narcissistic faggot
thinks he is king of the world
dumbass sth african mutt
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a20789 No.22295895
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7e3c58 No.22295896
>>22295882
Interesting. There are treasures and Treasures.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295897
>>22295872
>don't worry about notables, most never read them or they are shit anyway
IDK…
i watched this bread from the top
didn't seeing anything worthwhile that was NOT notabled
some stupid bloatable shit was included
but that's easy to ignore
i collect the good ones and distribute them to normies afraid to venture here
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.22295900
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb789f No.22295901
>>22295894
ya left out CCP lackey
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
53e118 No.22295902
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
654e4f No.22295903
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a0090f No.22295904
>>22295902
Migrate to fresh Locking
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d7743d No.22295905
>>22295888
>You're in for a surprise.
Kek, that wouldn't surprise me. There is a difference between I am The Law and with The Law.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.