[ / / / / / / / / / / / / ] [ r8k / ck / wooo / fit / random / cuteboys / erp / furry / htg / join / k / tingles / warroom ]

/qnotables21/ - ===Q Notables 2021===

Anon Curated Notables 2021 Edition

Name
Email
Subject
REC
STOP
Comment *
File
Password (Randomized for file and post deletion; you may also set your own.)
Archive
* = required field[▶Show post options & limits]
Confused? See the FAQ.
Embed
(replaces files and can be used instead)
Options

Allowed file types:jpg, jpeg, gif, png, webp,webm, mp4, mov, pdf
Max filesize is16 MB.
Max image dimensions are15000 x15000.
You may upload5 per post.


| QNotables | QNotables 2026 | QNotables 2025 | QNotables 2023 | QNotables 2022 | QNotables 2021 | QNotables 2020 | QNotables 2019 | QNotables 2018 | CBTS-Archive |

File: 959aa48db85568a⋯.jpg (71.01 KB,800x442,400:221,Clipboard.jpg)

7dc76a No.97 [Last 50 Posts]

17JUN21 to 20JUN21

/qresearch/

Re-Posts of notables

Previous thread

>>96

>>96

Previous thread

Contained threads:

172108ZJUN21 >>>/qresearch/13925887 Q Research General #17628: To boldly Ebake, Scrape, Take Notes, and Bake A Fresh Edition

https://9ch.net/qresearch/res/13925887.html

172345ZJUN21 >>>/qresearch/13926817 Q Research General #17629: EBake when needed

https://9ch.net/qresearch/res/13926817.html

180137ZJUN21 >>>/qresearch/13927635 Q Research General #17630: Dan the Man Edition

https://9ch.net/qresearch/res/13927635.html

180323ZJUN21 >>>/qresearch/13928477 Q Research General #17631: FBI, Bloodclots, Audits, PANIC! Edition

https://9ch.net/qresearch/res/13928477.html

180554ZJUN21 >>>/qresearch/13929238 Q Research General #17632: The more people there are, the more power the people have! Edition

https://9ch.net/qresearch/res/13929238.html

181200ZJUN21 >>>/qresearch/13930086 Q Research General #17633: The JIDF Newsbot has self-doxxed Edition

https://9ch.net/qresearch/res/13930086.html

181432ZJUN21 >>>/qresearch/13930855 Q Research General #17634: Oy Vey, It's Friday! Edition

https://9ch.net/qresearch/res/13930855.html

181647ZJUN21 >>>/qresearch/13931600 Q Research General #17635: The 'Rent Free' Edition

https://9ch.net/qresearch/res/13931600.html

182001ZJUN21 >>>/qresearch/13932485 Q Research General #17636: EBake NCSWIC

https://9ch.net/qresearch/res/13932485.html

182215ZJUN21 >>>/qresearch/13933286 Q Research General #17637: The 'LEARN TO BAKE' Edition

https://9ch.net/qresearch/res/13933286.html

190038ZJUN21 >>>/qresearch/13934121 Q Research General #17638: EBake Wake up Neo!

https://9ch.net/qresearch/res/13934121.html

190246ZJUN21 >>>/qresearch/13934978 Q Research General #17639: Twin Bakers!

https://9ch.net/qresearch/res/13934978.html

190523ZJUN21 >>>/qresearch/13935715 Q Research General #17640: Muh Kunspiracy Theorists Are A Threat Now? After All These Years? Edition

https://9ch.net/qresearch/res/13935715.html

191035ZJUN21 >>>/qresearch/13936527 Q Research General #17641: Late Night Early Morning Edition

https://9ch.net/qresearch/res/13936527.html

191401ZJUN21 >>>/qresearch/13937480 Q Research General #17642: Watch The News Today Edition

https://9ch.net/qresearch/res/13937480.html

191558ZJUN21 >>>/qresearch/13938204 Q Research General #17643: Watching The News Today? Edition

https://9ch.net/qresearch/res/13938204.html

191843ZJUN21 >>>/qresearch/13939174 Q Research General #17644: Federal IntraInter-Agency Friction, Rallies, and Recalls Oh My! Edition

https://9ch.net/qresearch/res/13939174.html

192109ZJUN21 >>>/qresearch/13939977 Q Research General #17645: Storm Season Has Arrived Edition

https://9ch.net/qresearch/res/13939977.html

192345ZJUN21 >>>/qresearch/13940753 Q Research General #17646: "What a beautiful black sky." Edition

https://9ch.net/qresearch/res/13940753.html

200156ZJUN21 >>>/qresearch/13941714 Q Research General #17647: "Would you tell me to go straight to hell?" Edition

https://9ch.net/qresearch/res/13941714.html

200431ZJUN21 >>>/qresearch/13942508 Q Research General #17648: EBake cuz the night

https://9ch.net/qresearch/res/13942508.html

200907ZJUN21 >>>/qresearch/13943319 Q Research General #17649: EBake

https://9ch.net/qresearch/res/13943319.html

201054ZJUN21 >>>/qresearch/13943584 Q Research General #17650: Boom Week Edition

https://9ch.net/qresearch/res/13943584.html

____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
Post last edited at

7dc76a No.64858

File: 69f41d2512e8059⋯.png (302.37 KB,598x607,598:607,Clipboard.png)

Originally posted at >>>/qresearch/13926365 (172234ZJUN21) Notable: NKorea's Kim says must prepare for 'dialogue and confrontation' with US: KCNA

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NKorea's Kim says must prepare for 'dialogue and confrontation' with US: KCNA

https://twitter.com/AFP/status/1405641793530695688

'dialogue and confrontation'

'confrontation and dialogue'

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64859

File: 99fc027eea1220b⋯.png (99.02 KB,598x628,299:314,Clipboard.png)

Originally posted at >>>/qresearch/13926400 (172240ZJUN21) Notable: Swiss police reportedly evacuate train in Daeniken city due to 'situation that could pose threat'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Swiss police reportedly evacuate train in Daeniken city due to 'situation that could pose threat'

https://twitter.com/SputnikInt/status/1405627676375797767

Winning

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64860

File: 3f3c932bf876c28⋯.png (387.13 KB,598x577,598:577,Clipboard.png)

Originally posted at >>>/qresearch/13926408 (172241ZJUN21) Notable: 'Dawson's Creek' writer Heidi Ferrer dies by suicide after contracting COVID

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

'Dawson's Creek' writer Heidi Ferrer dies by suicide after contracting COVID

https://twitter.com/nypost/status/1405656087672627200

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64861

File: cd5d74ef6faa20e⋯.png (365.86 KB,585x480,39:32,Clipboard.png)

File: b38d94ae5384fa9⋯.png (586.08 KB,960x698,480:349,Clipboard.png)

File: 7c6ce6a36cbbaa7⋯.png (192.14 KB,478x500,239:250,Clipboard.png)

Originally posted at >>>/qresearch/13926423 (172245ZJUN21) Notable: Temp Firm Financed By Stacey Abrams Infiltrated All Levels Of GA Government, Including Governor’s Office

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Temp Firm Financed By Stacey Abrams Infiltrated All Levels Of GA Government, Including Governor’s Office

by CD Media StaffJune 17, 2021

CDMedia investigators have uncovered payments by a myriad of Georgia government agencies to the temp firm ‘Happy Faces Staffing’ financed by the firm ‘Now Account’ of which Stacey Abrams (former state rep and GA gubernatorial candidate) is an owner.

The payments show the firm was also compensated by the GA governor’s office in 2020, showing work done for GA Governor Brian Kemp.

A list of 2020 payments to Happy Faces Staffing is below by GA state entities. CDMedia will report more information as it becomes available.

https://creativedestructionmedia.com/news/politics/2021/06/17/temp-firm-financed-by-stacey-abrams-infiltrated-all-levels-of-ga-government-including-governors-office/

https://twitter.com/BernardKerik/status/1405499150209323009

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64862

File: 263290a2b62a898⋯.png (402.05 KB,526x673,526:673,Clipboard.png)

File: 0661eb8f7b86602⋯.png (267.83 KB,859x789,859:789,Clipboard.png)

File: e083126edc7759f⋯.png (548.74 KB,838x710,419:355,Clipboard.png)

File: d1e1096178d24cf⋯.png (400.96 KB,853x724,853:724,Clipboard.png)

File: 5c97e59a16eb08a⋯.png (650.43 KB,859x817,859:817,Clipboard.png)

Originally posted at >>>/qresearch/13926536 (172306ZJUN21) Notable: Michigan SOS Candidate Kristina Karamo Delivers +7,500 Affidavits Demanding Forensic Audit to Dishonest Jocelyn Benson – BUT HER OFFICE WON’T ACCEPT THEM!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Michigan SOS Candidate Kristina Karamo Delivers +7,500 Affidavits Demanding Forensic Audit to Dishonest Jocelyn Benson – BUT HER OFFICE WON’T ACCEPT THEM!

An exclusive report by 100 Percent Fed Up – Hundreds of patriots traveled from across the state of Michigan to participate in a historical delivery of an estimated 7,500 affidavits signed by Michigan residents demanding a forensic audit of the November election.

A woman we spoke with made t-shirts for the event that read: “Patriots Want A Forensic Audit!” The back of the t-shirt gave details about who citizens should call to demand a forensic audit. The names and numbers of Senate Majority Leader Mike Shirkey, Senate Oversight Committee Chair Ed McBroom, and House Oversight Committee Chair Steve Johnson, all Republicans in a Republican majority House and Senate, hold the key to ordering a forensic audit in a state where a majority of Republicans still believe that election fraud played a part in the outcome of the November 2020 election.

ana Kristal and another great patriot helped to wheel boxes of affidavits to the front steps of the Capitol building, where multiple clergy members prayed over the boxes.

Michigan’s first black Secretary of State candidate Kristina Karamo (R) delivered boxes of thousands of affidavits to Michigan’s dishonest Democrat Secretary of State Jocelyn Benson. After walking several blocks to arrive at SOS Benson’s office, we discovered a sign on the front of the building that read “ID Required To Enter Building.” Next to the sign on the SOS’s office was another sign that read “Valid Photo ID Is Required For Access.” Michigan’s most NON-transparent Sec of State Jocelyn Benson has been arguing with MI lawmakers that a valid photo ID is somehow racist. “Does this mean the Sec of State Benson is a racist?” Kristina Karamo asked, reminding everyone that they’re being “gaslighted” by the Democrats who use race as a tool to make cheating in elections easier.

https://www.thegatewaypundit.com/2021/06/watch-michigans-dishonest-sec-state-jocelyn-benson-refuses-sign-7500-affidavits-demanding-forensic-audit/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64863

Originally posted at >>>/qresearch/13926591 (172315ZJUN21) Notable: Criminal Charges Filed Against US Marshals For Refusing To Disclose Vaccination Status In Court.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Criminal Charges Filed Against US Marshals For Refusing To Disclose Vaccination Status In Court.

A federal judge filed criminal charges against senior officials from the U.S. Marshals Service in response to an incident where a subordinate refused to reveal their COVID-19 vaccination status in court.

South Dakota District Judge Charles Kornmann charged three marshals – Chief of Staff John Kilgallon, South Dakota Marshal Daniel C. Mosteller, and deputy South Dakota Marshal Stephen Houghtaling – with contempt of court and obstructing justice.

The charges follow an incident where Kornmann demanded a deputy marshal reveal whether or not she had been vaccinated while working in his courtroom. She refused to share the information, prompting Kornmann, a judicial nominee of former President Bill Clinton, to order her to leave.

“The marshals who were present then took three of the defendants scheduled for hearings that day out of the courthouse in what Kornmann described as a “kidnapping” that disrupted the court’s work,” reports note.

While announcing the charges, Kornmann criticized the U.S. Marshals Service for an hour, asserting “this was such an outrageous thing to do.” “Nothing like this that we could find has ever been done in this country. If it is the marshals’ position that they can override court orders, they are badly mistaken,” he added.

https://thenationalpulse.com/breaking/charges-filed-against-marshals-over-vaccine-status/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64864

File: c22385fc565b003⋯.png (3.61 MB,2672x1858,1336:929,Clipboard.png)

Originally posted at >>>/qresearch/13926592 (172315ZJUN21) Notable: USNG: "I don't think we can do this enough," Lt. Col. Roger Brooks said. "#Patriot21 prepares service members and civilian partners to respond to situations as in the case of a pandemic, earthquake, or overseas in a warfight.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/USNationalGuard/status/1405578525139259404

"I don't think we can do this enough," Lt. Col. Roger Brooks said. "#Patriot21 prepares service members and civilian partners to respond to situations as in the case of a pandemic, earthquake, or overseas in a warfight.

PATRIOT 21 exercise underway at Volk Field

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64865

File: fd8bf6990107b57⋯.png (128.96 KB,649x646,649:646,Clipboard.png)

Originally posted at >>>/qresearch/13926598 (172316ZJUN21) Notable: GOP lawmakers, led by ex-White House doc, ask Biden to take cognitive test

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

GOP lawmakers, led by ex-White House doc, ask Biden to take cognitive test

More than a dozen Republican House members, led by former White House doctor Ronny Jackson, asked President Biden Thursday to undergo a cognitive test and release the results “so the American people know the full mental and intellectual health of their President.”

“The American people should have absolute confidence in their President,” reads the letter to Biden in part. “They deserve to know that he or she can perform the duties of Head of State and Commander in Chief. They deserve full transparency on the mental capabilities of their highest elected leader.”

The letter, which is copied to chief White House medical adviser Dr. Anthony Fauci and current White House Physician Dr. Kevin O’Connor, claims that Biden’s “mental decline and forgetfulness have become more apparent over the past eighteen months.”

Examples Jackson (R-Texas) cites of Biden’s “mental decline and forgetfulness” include an incident from March when the president appeared to forget the name of Defense Secretary Lloyd Austin.

“I want to thank the sec — the, the, ah former general. I keep calling him general, but my, my — the guy who runs that outfit over there,” Biden said March 8 while announcing the nomination of two female generals to lead US military combatant commands.

The letter also cites remarks Biden gave in Texas this past February when he visited the state following a deadly winter storm. According to Jackson, Biden “misidentified the time of day and Senator John Cornyn’s title, and you mispronounced Congresswoman Shelia Jackson Lee’s first name and Congresswoman Lizzie Fletcher’s maiden name of Pannill. Then, apparently forgetting the purpose of your visit, you questioned, ‘what am I doing here?’

A third example given by Jackson recounts an abortive attempt by Biden to recite the first line of the Declaration of Independence in March 2020, during which he said: “We hold these truths to be self-evident. All men and women are created by the, you know, you know, the thing.”

https://nypost.com/2021/06/17/gop-reps-led-by-ex-white-house-doc-ask-biden-to-take-cognitive-test/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64866

Originally posted at >>>/qresearch/13926656 (172325ZJUN21) Notable: Child-care employee at Stepping Stones Daycare arrested on multiple charges of sex abuse

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Child-care employee at Stepping Stones Daycare arrested on multiple charges of sex abuse

SALISBURY, Md.— A child-care employee at Stepping Stones daycare has been arrested on multiple charges surrounding sexual abuse of minors under 4 years old.

Roseberline Turenne, an 18-year-old, stands to face six separate counts of sex abuse of a minor, six additional counts of possession of child pornography and six counts of child pornography, or engaging a minor as a visual subject engaged in sexual conduct.

Together the Salisbury woman was arrested on six misdemeanors and 12 felony counts.

Police say the alleged abuse was discovered late last week.

A Salisbury Police Department detective responded alongside a Child Advocacy Center representative to Stepping Stones Early Learning Center, upon receiving a report of sexual abuse at the South Schumaker Drive facility.

When they arrived, an office manager told authorities an employee on the premises had "numerous photographs" of children's vaginas, according to court documents. Det. Matthew Rockwell was told these photos were on her smartphone.

The manager told the detective she learned of the photos after a fellow employee saw them during their lunch break. The manager notified the Department of Social Services, according to court documents.

Rockwell met with Turenne in a private room at the daycare.

With her consent, court documents read, the detective reviewed the photos on her phone — confirming at least six images of different children. The children ranged from birth to 4 years old, according to the records, and the pictures were each taken on changing tables.

Turenne first told police she was sent the photos, documents show, citing the WhatsApp messaging platform as how she received them.

That changed after Rockwell started investigating.

The detective began viewing and photographing changing tables throughout the facility, until he came across a familiar red mat. The color matched one of the changing mats in the cellphone photos, documents stated.

https://www.delmarvanow.com/story/news/local/maryland/2021/06/17/salisbury-child-care-employee-arrested-multiple-sex-abuse-charges/7736588002/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64867

File: 4bff1e53420c0ca⋯.jpg (157.77 KB,1600x900,16:9,Clipboard.jpg)

Originally posted at >>>/qresearch/13926863 (172351ZJUN21) Notable: Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a 13 month battle with COVID-19

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a 13 month battle with COVID-19

https://nypost.com/2021/06/17/dawsons-creek-writer-heidi-ferrer-dies-by-suicide-after-getting-covid/

If you haven't figured it by now, Covid is code for serious mental problems.

https://www.lovewhatmatters.com/the-nurse-asked-my-husband-do-you-know-your-wife-is-an-alcoholic-he-knew-was-the-cop-there-for-me-i-thought-frozen-in-fear/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64868

File: 04dc7ef459b7380⋯.png (299.35 KB,598x675,598:675,Clipboard.png)

Originally posted at >>>/qresearch/13926874 (172353ZJUN21) Notable: Boston terror suspects uncle was married to CIA officer's daughter and even shared a home with the agent

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Boston terror suspects uncle was married to CIA officer's daughter and even shared a home with the agent

https://twitter.com/JackPosobiec/status/1405664336954134536

>>>/qresearch/13926864

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64869

File: d4b6a8ca3bca103⋯.png (481.71 KB,889x559,889:559,Clipboard.png)

Originally posted at >>>/qresearch/13926918 (172359ZJUN21) Notable: RSBN Dan The Man On!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.youtube.com/watch?v=g5vImR2GFjw

1 mike

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64870

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13926929 (180000ZJUN21) Notable: RSBN Dan The Man On!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dan The Man On!

Link: https://youtu.be/g5vImR2GFjw

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64871

File: 5d0938efd5e28b9⋯.jpeg (531.33 KB,640x945,128:189,Clipboard.jpeg)

Originally posted at >>>/qresearch/13926945 (180002ZJUN21) Notable: "Fraudits no place colorado" democrat colorado secretary state issues emergency rules prohibiting election audits

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/fraudits-no-place-colorado-democrat-colorado-secretary-state-issues-emergency-rules-prohibiting-election-audits/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64872

File: ecd2d2d9a9b6f07⋯.png (1.56 MB,1242x2688,207:448,Clipboard.png)

File: 67f73e91a01f354⋯.png (1.34 MB,1242x2688,207:448,Clipboard.png)

File: 87b9ff67eba5150⋯.png (1.52 MB,1242x2688,207:448,Clipboard.png)

Originally posted at >>>/qresearch/13926969 (180005ZJUN21) Notable: PF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Planefags

BUFFs up over Southern US 27000-28000 ft 564 knots one in Texas 434 one over Arkansas

Texas call sign 00000000

Arkansas 60-0058

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64873

File: a1817886f0b54e5⋯.jpg (176.42 KB,720x1134,40:63,Clipboard.jpg)

File: e6c9879c25736ed⋯.mp4 (3.19 MB,640x360,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13927111 (180030ZJUN21) Notable: @JSolomonReports says: GA Sec. of State Raffensperger sent a contractor to Fulton County, who found "twenty-nine pages of errors, mismanagement, mistakes, grotesque running of an election…"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

.@JSolomonReports says: GA Sec. of State Raffensperger sent a contractor to Fulton County, who found "twenty-nine pages of errors, mismanagement, mistakes, grotesque running of an election…"

#JustTheTruth @JennaEllisEsq https://t.co/afrDkvVK0i

https://twitter.com/RealAmVoice/status/1405683384911683584?s=19

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64874

File: c63eb1c00ab919f⋯.png (301.56 KB,509x481,509:481,Clipboard.png)

File: 95cf50e82d8ee34⋯.png (33.68 KB,616x243,616:243,Clipboard.png)

Originally posted at >>>/qresearch/13927162 (180038ZJUN21) Notable: "Fraudits no place colorado" democrat colorado secretary state issues emergency rules prohibiting election audits

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

“Fraudits Have No Place in Colorado” – Democrat Colorado Secretary of State Issues Emergency Rules Prohibiting Election Audits

Democrat Colorado Secretary of State Jena Griswold on Thursday announced her office issued emergency rules prohibiting election audits.

“My office just issued rules prohibiting sham election audits in the State of Colorado. We will not risk the state’s election security nor perpetuate The Big Lie. Fraudits have no place in Colorado,” Griswold announced, taking a swipe at the Arizona audit.

In Thursday’s press release, Griswold boasted that Colorado’s elections are considered the “safest in the nation.”

Full statement from Colorado Secretary of State’s office:

The Colorado Secretary of State’s Office today adopted emergency elections rules prohibiting third-parties from accessing voting equipment in the state of Colorado.

“Colorado’s elections are considered the safest in the nation, and we must remain steadfast in our dedication to security,” said Secretary of State Jena Griswold. “Along those lines, no third-party person or vendor will be permitted access to voting equipment in our state. We will not risk the state’s election security nor perpetuate The Big Lie. Sham audits have no place in Colorado.”

The new and amended rules, which have been implemented immediately, reinforce who can access state-certified voting systems. In order to access any component of a county’s voting system, a person must have passed a comprehensive criminal background check and be either an employee of the county clerk, an employee of the voting system provider, an employee of the Secretary of State’s Office, or an appointed election judge.

The rules further enable the Colorado Secretary of State’s Office to limit or prohibit the use of, as well as decertify, any voting systems component in the event of a break in its chain-of-custody or other hardware security compromises, such that its security and integrity can no longer be verified.

A third-party vendor with no election experience is currently performing a faulty, unsecure election audit in Arizona and calls for such sham audits have been spreading in other states. Several Colorado counties have been contacted by third parties offering to conduct audits. Colorado already administers post-election Risk Limiting Audits after every statewide election, which gives a statistical level of confidence that the outcome of an election is correct.

https://www.thegatewaypundit.com/2021/06/fraudits-no-place-colorado-democrat-colorado-secretary-state-issues-emergency-rules-prohibiting-election-audits/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64875

File: b735b235053f600⋯.png (385.76 KB,553x686,79:98,Clipboard.png)

Originally posted at >>>/qresearch/13927187 (180041ZJUN21) Notable: Fauci Denies Scientists 'Deliberately Suppressed' COVID Lab Theory

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13926973

>>>/qresearch/13926973

>>>/qresearch/13926937

THE ONLY NEWS STORY SO FAR IN THE NEWS ABOUT FAUCI (SO FAR) !!!

Fauci Denies Scientists 'Deliberately Suppressed' COVID Lab Theory

https://www.newsmax.com/newsfront/anthonyfauci-covid-19-origins/2021/06/17/id/1025505/

By Theodore Bunker | Thursday, 17 June 2021 05:50 PM

Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases, denied accusations that health officials had deliberately suppressed theories about COVID-19 originating in a laboratory.

If you go back then, even though you lean towards feeling this is more likely a natural occurrence, we always felt that you gotta keep an open mind — all of us, Fauci, President Joe Biden's chief medical adviser, told CBS This Morning on Wednesday.

We didn't get up and start announcing it, but what we said, 'Keep an open mind and continue to look.' So I think it's a bit of a distortion to say that we deliberately suppressed that, he said.

Fauci said earlier this month that he is not convinced that COVID-19 developed naturally while speaking to PolitiFact's Katie Sanders during an event for Poynter.

''I am not convinced about that. I think we should continue to investigate what went on in China until we continue to find out to the best of our ability what happened," he said.

"Certainly, the people who investigated it say it likely was the emergence from an animal reservoir that then infected individuals, but it could have been something else, and we need to find that out. So, you know, that's the reason why I said I'm perfectly in favor of any investigation that looks into the origin of the virus," the NIAID head added.

Fauci told National Geographic last year in May that If you look at the evolution of the virus in bats and what's out there now, [the scientific evidence] is very, very strongly leaning toward this could not have been artificially or deliberately manipulated.

He added, Everything about the stepwise evolution over time strongly indicates that [this virus] evolved in nature and then jumped species, and said he didn't believe in an alternate theory — that someone found the coronavirus in the wild, brought it to a lab, and then it accidentally escaped.

Fauci concluded, "If it isn't manipulated in the lab and you're trying to say it escaped from the lab, then how did it get in the lab? It got in the lab because somebody isolated it from the environment. That's why I don't spend a lot of time in that circular argument.''

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64876

Originally posted at >>>/qresearch/13927198 (180042ZJUN21) Notable: Crimes against children, Pedo Roundup News.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

U.S. Attorney’s Office

Central District of California

FOR IMMEDIATE RELEASE

Thursday, June 17, 2021

Inland Empire Attorney Faces Federal Charge of Producing Child Pornography for Enticing Minor to Send Sexually Explicit Images

RIVERSIDE, California – An attorney with a law practice in Ontario was taken into federal custody today on a charge of producing child pornography that alleges he paid a teenaged girl to send him sexually explicit images.

Sagi Schwartzberg, 38, of Fontana, was taken into custody by special agents with the FBI after the San Bernardino County District Attorney on Wednesday dismissed its child exploitation charges against him. Schwartzberg – who used the aliases “Jason D,” “drunkesq_o64” and “xocdrunkx” on social media platforms – is expected to be arraigned on the federal charge this afternoon in United States District Court in Riverside.

Schwartzberg is named in a federal criminal complaint, filed on April 27 and unsealed today, that charges him with production of child pornography, an offense that carries a mandatory minimum sentence of 15 years in federal prison.

Schwartzberg was arrested February 17 in the state case, approximately three months after the National Center for Missing and Exploited Children forwarded a tip from Kik, a mobile messaging application, to the Fontana Police Department. The tip indicated that a person later identified as Schwartzberg had uploaded suspected child pornography to Kik from two locations – later determined to be his residence and his law office – in October and November. The FBI later reviewed the videos, one of which depicts a girl who appears to be under the age of 10 being sexually assaulted, according to the affidavit in support of the complaint.

During a search on February 17, Fontana Police officers seized Schwartzberg’s mobile phone, which had a hidden vault containing file folders, labeled with girls’ names, one of which contained sexually explicit images and videos of a girl who is now 15 years old, the affidavit alleges.

During a subsequent interview with police officers outlined in the affidavit, the girl said she had been solicited by Schwartzberg to send sexually explicit images via SnapChat starting 2019 and that she had received electronic gift cards in exchange. The victim “reported that ‘Jason’ asked her to meet up with him for sex but she never agreed to it,” the affidavit states. “‘Jason’ also asked her to introduce him to her other friends but [the victim] claimed that she did not introduce him to any of her friends.”

Fontana Police also identified another victim, currently 17 years old, who had sent images to Schwartzberg via SnapChat when she was 16, sometimes in response to specific instructions, according to the affidavit, which notes authorities have identified at least two other minor victims who also sent images to Schwartzberg.

The FBI continues to work to identify other victims in this case. Anyone who may have information in this matter is encouraged to contact the FBI’s Los Angeles Field Office at 310-477-6565.

This matter is being investigating by the FBI in conjunction with Fontana Police Department, as part of Inland Regional Child Exploitation and Human Trafficking Task Force. The Task Force also includes the Upland Police Department, the Rialto Police Department, the San Bernardino County Sheriff's Department, the Riverside County District Attorney’s Office, the Riverside County Sheriff’s Department and the Riverside Police Department.

Assistant United States Attorney Sonah Lee of the Riverside Branch Office is prosecuting this case.

https://www.justice.gov/usao-cdca/pr/inland-empire-attorney-faces-federal-charge-producing-child-pornography-enticing-minor

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64877

File: a182b19104c0202⋯.png (342.14 KB,650x487,650:487,Clipboard.png)

File: 0f46e04393fc195⋯.png (400.02 KB,650x488,325:244,Clipboard.png)

File: 6d4a3b0d9a8a287⋯.png (201.12 KB,681x763,681:763,Clipboard.png)

File: f1c0d0faf3ec2ac⋯.png (541.6 KB,683x861,683:861,Clipboard.png)

File: b39ac66660d0013⋯.png (353.81 KB,702x856,351:428,Clipboard.png)

Originally posted at >>>/qresearch/13927211 (180043ZJUN21) Notable: Crime boss Bilal Hamze shot dead in Sydney’s CBD

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Crime boss Bilal Hamze shot dead in Sydney’s CBD

A member of a notorious Sydney crime family has been shot dead in the city’s CBD overnight as a gangland feud escalates.

Notorious crime figure Bilal Hamze has been shot dead in the heart of Sydney’s CBD overnight in what is believed to be an escalation of a deadly underworld feud.

NSW Police have confirmed the cousin of Brothers 4 Life founder Bassam Hamzy was gunned down in an alleyway off Bridge Street about 10.25pm on Thursday night.

Emergency services arrived at the scene near Circular Quay and rushed Hamze to St Vincent’s Hospital, where he was pronounced dead.

Police believe the gunman escaped in an Audi and the killer remains on the run. A vehicle was later found burnt out at Northwood on Sydney’s north shore.

A strike force has been established and detectives remained at the closed-off section of Bridge Street between George and Pitt streets on Friday morning canvassing the scene.

Hamze was fatally wounded while walking near popular Sydney restaurant Mr Wong.

NSW Police said on Friday morning that Hamze, 34, was reportedly shot by an unknown person in a black car.

“A crime scene was established and forensically examined by specialist police,” police said in a statement.

“A short time later, police located a burnt-out vehicle at Fleming Street, Northwood, and a second crime scene was established.

“Detectives from the State Crime Command’s Homicide Squad have established Strike Force Englorie to investigate the circumstances surrounding the incident.

https://www.news.com.au/national/nsw-act/crime/crime-boss-bilal-hamze-shot-dead-in-sydneys-cbd/news-story/3defb14896747054479f1ef1e12530fd

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64878

File: 5764b759a728815⋯.png (348.26 KB,618x410,309:205,Clipboard.png)

Originally posted at >>>/qresearch/13927215 (180044ZJUN21) Notable: Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a 13 month battle with COVID-19

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a yearlong battle with COVID-19, her husband said. She was 50.

Her spouse, screenwriter, director and producer Nick Guthe, told Deadline she took her own life May 26. She had contracted COVID-19 in April 2020 and was still fighting the virus over a year later. Ferrer was “bedridden and in constant physical pain” in May due to long-term symptoms of the virus, including severe neurological tremors.

“My beautiful angel, Heidi, passed over tonight after a 13 month battle with Long Haul Covid,” Guthe wrote on Twitter. “She was an amazing mother. She fought this insidious disease with the same ferocity she lived with. I love you forever and I’ll see you down the road.”

As reported by TMZ, Ferrer wrote about her battle with the virus, detailing her symptoms in a September post.

“In my darkest moments, I told my husband that if I didn’t get better, I did not want to live like this. I wasn’t suicidal, I just couldn’t see any quality of life long term and there was no end in sight,” she wrote at the time on her blog GirlToMom, which she started in 2008 to write about raising a child with progressive infantile scoliosis.

Born in Kansas, Ferrer moved to Los Angeles in the 1980s to pursue acting and wound up studying at the American Academy of Dramatic Arts. Eventually, she moved onto screenwriting after selling her first spec, “The C Word,” to Academy Award-winning producer Arnold Kopelson, Deadline reported.

Ferrer went on to write episodes of “Dawson’s Creek” and “Wasteland.”

She is survived by her husband; 13-year-old son, Bexon; her mother, Nancy Gilmore; and sisters Laura Frerer-Schmidt and Sierra Summerville.

https://nypost.com/2021/06/17/dawsons-creek-writer-heidi-ferrer-dies-by-suicide-after-getting-covid/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64879

File: 40d40ef55574b71⋯.png (390.71 KB,674x904,337:452,Clipboard.png)

Originally posted at >>>/qresearch/13927227 (180045ZJUN21) Notable: Army Battalion Commander Under Inquiry After Allegedly Telling Soldiers ‘White People Are the Problem’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Army Battalion Commander Under Inquiry After Allegedly Telling Soldiers ‘White People Are the Problem’

Army Lieutenant Col. Andrew Rhodes, the commander of the 1st Battalion, 8th Infantry Regiment, 3rd Regimental Combat Team, 4th Infantry Division at Fort Carson, is under preliminary inquiry after allegedly telling troops that “white people are the problem,” according to an Army spokesperson.

“The command is aware of an event involving one of our battalion commanders, we are conducting a preliminary inquiry to gather more information,” a spokesperson told Breitbart News in an email on Wednesday, adding “It would be inappropriate to provide any further details in order to protect the integrity of the inquiry.”

According to an eyewitness source, after soldiers in the battalion received a quarterly Equal Opportunity (EO) brief by an EO representative, Rhodes made additional remarks.

Rhodes allegedly told soldiers that EO and SHARP (Sexual Harassment/Assault Response and Prevention) were very important to him, that he would take every accusation very seriously, and that he believed there was only a .01% false accusation rate.

He then allegedly said “white people are the problem” and that white people correcting white people is the way to fix the culture in the military, and that soldiers could not depend on minorities to correct the majority.

The source told Breitbart News: “I agree with some of the statements but I believe it sets a dangerous standard for abusing the already broken Army programs,” adding:

I agreed that some of the culture in the Army needs to change, [but I] didn’t agree with how he singled out that white people are the issue and need to fix ourselves. [It] sounds like he’s only going after one group of people. And saying you will believe everyone sets a dangerous standard. For example, if I don’t like Sgt. Joe, I can just go make a report against him. It may come out with no results but that guy is still known for my complaint against him, and the battalion commander will back him/her all the way.

The source clarified the broken Army programs are SHARP and EO programs: “They have their need in the Army of course — just abused sometimes.”

The source also said others thought Rhodes’ statements were “a bit much and a blanket statement for a very broad subject.”

The source said Rhodes spoke to small groups at a time and that he made similar remarks to other groups throughout the day.

Rhodes’s alleged remarks first came to light after Instagram account TerminalCWO highlighted them on June 8, and then Human Events’s Jack Posobiec reported on them.

TerminalCWO posted a private message from someone attempting to explain Rhodes’s remarks. It said:

https://www.breitbart.com/politics/2021/06/17/army-battalion-commander-inquiry-allegedly-telling-soldiers-white-people-are-problem/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64880

File: 04efabe03207e9f⋯.png (217.58 KB,556x459,556:459,Clipboard.png)

File: d75e020693d81e2⋯.png (32.86 KB,689x644,689:644,Clipboard.png)

Originally posted at >>>/qresearch/13927240 (180047ZJUN21) Notable: Ted Cruz Slams the Democrat Election Takeover Bill: ‘Single Most Dangerous Piece of Legislation’ in Congress

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Ted Cruz Slams the Democrat Election Takeover Bill: ‘Single Most Dangerous Piece of Legislation’ in Congress

Sen. Ted Cruz (R-TX) slammed the Democrats’ election takeover bill, known as the For the People Act, which he called the “single most dangerous piece of legislation” in Congress during the Senate Republican press conference on elections and voting rights legislation.

The Democrats’ election take-over bill has been dubbed the Corrupt Politicians Act by some Republicans, including Cruz, due to the “brazen power grab” Democrats are trying to have on the voting rights of Americans. Cruz went as far as to say it is the “single most dangerous piece of legislation pending in the United States Congress,” since the Democrats are looking to “federalize elections and to ensure that Democrats cannot lose for the next 100 years.”

Cruz said further that, by doing this, the Democrats are “taking away the right to vote from the citizens and giving it instead to the corrupt politicians in Washington.” He continued to say the legislation would ultimately “strike down virtually every common-sense voter integrity law adopted by the states across the country.”

The Texan also pointed out that 29 states have already adopted voter ID laws. This legislation would repeal the “reasonable, common-sense steps to protect the integrity of elections,” Cruz said. Additionally, the law would strike down the laws that 31 states have to prohibit ballot harvesting, the “corrupt practice of paying political operatives to collect other people’s ballots that invite voter fraud.” The law would mandate ballot harvesting nationwide.

https://www.breitbart.com/politics/2021/06/17/ted-cruz-slams-the-democrat-election-takeover-bill-single-most-dangerous-piece-of-legislation-in-congress/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64881

Originally posted at >>>/qresearch/13927253 (180049ZJUN21) Notable: Crimes against children, Pedo Roundup News.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64876

>Inland Empire Attorney Faces Federal Charge of Producing Child Pornography for Enticing Minor to Send Sexually Explicit Images

June 17, 2021

Man Pleads Guilty to Child Pornography Charge

A Tulsa man pleaded guilty today to receipt of child pornography after his state conviction was vacated due … Steven Janson, 37, knowingly used the internet to receive child pornography from April 18, 2016 to May 25, 2016. … Janson admitted to possessing at least 600 images of child sexual abuse including the abuse of prepubescent minors …

https://www.justice.gov/usao-ndok/pr/man-pleads-guilty-child-pornography-charge-0

Tulsa Man Sentenced for Abusive Sexual Contact with a Minor

… January 2011 through August 2020, he sexually abused a child. The victim disclosed the abuse to a parent out of … Department of Justice to combat the growing epidemic of child sexual exploitation and abuse. Led by the United States Attorneys’ Offices and the Criminal Division’s Child Exploitation and Obscenity Section, Project Safe …

https://www.justice.gov/usao-ndok/pr/tulsa-man-sentenced-abusive-sexual-contact-minor

Informational: Federal Court arraignments

… of Lodge Grass, on charges of aggravated sexual abuse of a child and abusive sexual contact. If convicted of the most …

https://www.justice.gov/usao-mt/pr/informational-federal-court-arraignments-130

Todd County Man Indicted for Aggravated Sexual Abuse of a Child

… by a federal grand jury for Aggravated Sexual Abuse of a Child. Conrad Good Voice, Jr., age 26, was indicted on June …

https://www.justice.gov/usao-sd/pr/todd-county-man-indicted-aggravated-sexual-abuse-child

Pittsford Man Going To Prison For 18 Years For Production Of Child Pornography

… 21, of Pittsford, NY, who was convicted of production of child pornography, was sentenced to serve 18 years in prison …

https://www.justice.gov/usao-wdny/pr/pittsford-man-going-prison-18-years-production-child-pornography

Ohio man sentenced for soliciting minor for child pornography

… was sentenced today to 60 months of incarceration for a child pornography charge, Acting U.S. Attorney Randolph J. … guilty in December 2020 to one count of “Solicitation of Child Pornography.” Dorst admitted to asking a minor in … was sentenced today to 60 months of incarceration for a child pornography charge, Acting U.S. Attorney Randolph J. …

https://www.justice.gov/usao-ndwv/pr/ohio-man-sentenced-soliciting-minor-child-pornography

Behavioral Health Specialist Sentenced to 15 Years in Federal Prison for Enticing A Minor Hopsital Patient for Sex, and Attempting to Obstruct His Prosecution

… Department of Justice to combat the growing epidemic of child sexual exploitation and abuse. Led by the United States Attorneys’ Offices and the Criminal Division’s Child Exploitation and Obscenity Section, Project Safe …

https://www.justice.gov/usao-sdil/pr/behavioral-health-specialist-sentenced-15-years-federal-prison-enticing-minor-hopsital

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64882

File: d7bddb364157e6c⋯.png (304.93 KB,598x573,598:573,Clipboard.png)

Originally posted at >>>/qresearch/13927256 (180049ZJUN21) Notable: Kushner snags book deal with Harper Collins; no deal yet for Trump

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Kushner snags book deal with Harper Collins; no deal yet for Trump

https://twitter.com/nypost/status/1405681286010884097

Oouch!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64883

Originally posted at >>>/qresearch/13927289 (180054ZJUN21) Notable: Crimes against children, Pedo Roundup News.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64881

June 16, 2021

Rochester Man Indicted for Possession of Child Pornography

https://www.justice.gov/usao-nh/pr/rochester-man-indicted-possession-child-pornography

Arkansas Man Pleads Guilty To Soliciting And Paying For The Production Of A Video Depicting A 9-Year-Old Child Being Molested

https://www.justice.gov/usao-mdfl/pr/arkansas-man-pleads-guilty-soliciting-and-paying-production-video-depicting-9-year-old

June 14, 2021

Chemung County Man Pleads Guilty To Receiving Images Of Child Pornography

https://www.justice.gov/usao-wdny/pr/chemung-county-man-pleads-guilty-receiving-images-child-pornography

Baltimore Man Pleads Guilty to Distribution of Child Pornography

https://www.justice.gov/usao-md/pr/baltimore-man-pleads-guilty-distribution-child-pornography

Jupiter Man Pleads Guilty to Child Pornography Charges

https://www.justice.gov/usao-sdfl/pr/jupiter-man-pleads-guilty-child-pornography-charges

June 11, 2021

Federal Grand Jury A Indictments Announced – June

https://www.justice.gov/usao-ndok/pr/federal-grand-jury-indictments-announced-june

Former Youth Pastor and Scout Volunteer Charged with Sexually Abusing Five Children

https://www.justice.gov/usao-ndok/pr/former-youth-pastor-and-scout-volunteer-charged-sexually-abusing-five-children

Jefferson County Man Pleads Guilty to Failing to Register as a Sex Offender

https://www.justice.gov/usao-ndny/pr/jefferson-county-man-pleads-guilty-failing-register-sex-offender

Sioux Falls Man Indicted for Failure to Register as a Sex Offender

https://www.justice.gov/usao-sd/pr/sioux-falls-man-indicted-failure-register-sex-offender-3

Rochester Man Pleads Guilty To Production Of Child Pornography

https://www.justice.gov/usao-wdny/pr/rochester-man-pleads-guilty-production-child-pornography-0

Mosher Man Charged with Failure to Register as a Sex Offender

https://www.justice.gov/usao-sd/pr/mosher-man-charged-failure-register-sex-offender

Venice Man Sentenced To 15 Years In Federal Prison For Distributing, Receiving And Possessing Child Sexual Abuse Images And Videos

https://www.justice.gov/usao-mdfl/pr/venice-man-sentenced-15-years-federal-prison-distributing-receiving-and-possessing

Man Sentenced for Production of Child Pornography

https://www.justice.gov/opa/pr/man-sentenced-production-child-pornography

Tampa Man Sentenced To Five Years In Federal Prison For Uploading And Possessing Child Sexual Abuse Images And Videos

https://www.justice.gov/usao-mdfl/pr/tampa-man-sentenced-five-years-federal-prison-uploading-and-possessing-child-sexual

Upshur County Man Convicted of Sex Offense Against Minor

https://www.justice.gov/usao-sdwv/pr/upshur-county-man-convicted-sex-offense-against-minor

Jacksonville Man Pleads Guilty To Using The Internet In Attempt To Entice And Meet A 12-Year-Old Child For Sex

https://www.justice.gov/usao-mdfl/pr/jacksonville-man-pleads-guilty-using-internet-attempt-entice-and-meet-12-year-old-child

Man who volunteered as church bus driver sentenced to 30 years in prison for sexually abusing a minor

https://www.justice.gov/usao-sdoh/pr/man-who-volunteered-church-bus-driver-sentenced-30-years-prison-sexually-abusing-minor

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64884

File: 35d590ab8ce981b⋯.jpg (181.01 KB,720x1029,240:343,Clipboard.jpg)

Originally posted at >>>/qresearch/13927324 (180059ZJUN21) Notable: Portland's entire riot squad resigns in protest after a colleague is indicted for striking a rioter/activist/photographer.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/RitaPanahi/status/1405691134668541955?s=19

Portland's entire riot squad resigns in protest after a colleague is indicted for striking a rioter/activist/photographer.

https://t.co/KyiThD6e3u

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64885

File: 00a587f435ea17d⋯.jpg (137.55 KB,720x694,360:347,Clipboard.jpg)

File: 44574d1f4105887⋯.jpg (57.38 KB,660x373,660:373,Clipboard.jpg)

Originally posted at >>>/qresearch/13927379 (180107ZJUN21) Notable: M Pompeo: "Never give an inch. Period."

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/mikepompeo/status/1405690517816496140?s=19

Never give an inch. Period.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64886

File: 39efbeb010c8645⋯.png (4.81 KB,466x148,233:74,Clipboard.png)

Originally posted at >>>/qresearch/13927510 (180124ZJUN21) Notable: CM: Colorado Secretary of State just banned election audits.Why is she scared of an election audit? Surely unrelated: Dominion has (had?) offices in Colorado.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CodeMonkeyZ, [17.06.21 20:16]

Colorado Secretary of State just banned election audits.

Why is she scared of an election audit?

Surely unrelated: Dominion has (had?) offices in Colorado.

https://t.me/CodeMonkeyZ/504

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64887

File: 1fe21c9485f6c87⋯.png (3.81 KB,442x107,442:107,Clipboard.png)

Originally posted at >>>/qresearch/13927512 (180124ZJUN21) Notable: CM: Soros’ biggest mistake this last election was not buying a majority on all the state legislatures.He won’t make the same mistake twice.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CodeMonkeyZ, [17.06.21 20:24]

Soros’ biggest mistake this last election was not buying a majority on all the state legislatures.

He won’t make the same mistake twice.

https://t.me/CodeMonkeyZ/505

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64888

File: 553d9553d520d15⋯.png (3.8 KB,466x116,233:58,Clipboard.png)

File: 8b62be2537ca2fb⋯.png (90.55 KB,651x576,217:192,Clipboard.png)

Originally posted at >>>/qresearch/13927526 (180125ZJUN21) Notable: CM: A “conspiracy theory” that is proven is called a fact.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CodeMonkeyZ, [17.06.21 20:36]

A “conspiracy theory” that is proven is called a fact.

https://t.me/CodeMonkeyZ/507

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64889

File: be109eb10d42866⋯.png (8.88 KB,459x358,459:358,Clipboard.png)

Originally posted at >>>/qresearch/13927538 (180126ZJUN21) Notable: Lin Wood: President Trump won re-election by a historic landslide. Just sayin.’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [17.06.21 20:06]

The Georgia November 2020 was unlawful and fraudulent. So was the Senate runoff in January 2021.

Oh no! Now the propaganda media will brand me a delusional conspiracy theorist and the State Bar of Georgia will try to discipline me.

I better learn to keep my mouth shut to prevent TRUTH from coming out of it or I am going to get in trouble!

Nah! I prefer to be fearless and keep speaking TRUTH.

Is that okay with you?

P.S. President Trump won re-election by a historic landslide. Just sayin.’

https://t.me/linwoodspeakstruth/3241

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64890

File: 068bc3271f1d9bb⋯.png (34.97 KB,442x560,221:280,Clipboard.png)

Originally posted at >>>/qresearch/13927600 (180133ZJUN21) Notable: @RealGenFlynn: Fernando Mateo Receives Matching Funds For His Campaign Creating An Even Clearer Path To Victory in November

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

@RealGenFlynn, [17.06.21 20:33]

FOR IMMEDIATE RELEASE:

Thursday, June 17th, 2021

Contact: press@mateothemayor.com

PRESS ADVISORY

Fernando Mateo Receives Matching Funds For His Campaign Creating An Even Clearer Path To Victory in November

WASHINGTON HEIGHTS, NY – Republican Mayoral Candidate Fernando Mateo announced today that he has received matching funds for his campaign that will carry him to victory on June 22nd and in November’s general election.

"Today the Campaign Finance Board awarded my campaign over $2 million in matching funds because of the work I have been putting in to fix New York City. It comes as no surprise that my opponent Curtis Sliwa was unable to receive the same amount of funds because he is incapable of doing the work it takes to win an election. It is clear I have a great depth of support and my message is resonating with New Yorkers who want their City to be thriving once again. We also made history today as I am the first Hispanic immigrant Mayoral candidate to meet matching funds. This is a great achievement for my campaign that will give me an even greater ability to win in the general election,” says Fernando Mateo.

https://t.me/RealGenFlynn/197

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64891

Originally posted at >>>/qresearch/13927622 (180136ZJUN21) Notable: #17629

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NOTABLES @700

FINAL

#17629

>>64867,>>64878 Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a 13 month battle with COVID-19

>>64868 Boston terror suspects uncle was married to CIA officer's daughter and even shared a home with the agent

>>64869, >>64870 RSBN Dan The Man On!

>>64871, >>64874 "Fraudits no place colorado" democrat colorado secretary state issues emergency rules prohibiting election audits

>>64872 PF

>>64873 @JSolomonReports says: GA Sec. of State Raffensperger sent a contractor to Fulton County, who found "twenty-nine pages of errors, mismanagement, mistakes, grotesque running of an election…"

>>64875 Fauci Denies Scientists 'Deliberately Suppressed' COVID Lab Theory

>>64876, >>64881, >>64883 Crimes against children, Pedo Roundup News.

>>64877 Crime boss Bilal Hamze shot dead in Sydney’s CBD

>>64879 Army Battalion Commander Under Inquiry After Allegedly Telling Soldiers ‘White People Are the Problem’

>>64880 Ted Cruz Slams the Democrat Election Takeover Bill: ‘Single Most Dangerous Piece of Legislation’ in Congress

>>64882 Kushner snags book deal with Harper Collins; no deal yet for Trump

>>64884 Portland's entire riot squad resigns in protest after a colleague is indicted for striking a rioter/activist/photographer.

>>64885 M Pompeo: "Never give an inch. Period."

>>64886 CM: Colorado Secretary of State just banned election audits.Why is she scared of an election audit? Surely unrelated: Dominion has (had?) offices in Colorado.

>>64887 CM: Soros’ biggest mistake this last election was not buying a majority on all the state legislatures.He won’t make the same mistake twice.

>>64888 CM: A “conspiracy theory” that is proven is called a fact.

>>64889 Lin Wood: President Trump won re-election by a historic landslide. Just sayin.’

>>64890 @RealGenFlynn: Fernando Mateo Receives Matching Funds For His Campaign Creating An Even Clearer Path To Victory in November

#17629

Baking

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64892

Originally posted at >>>/qresearch/13927671 (180142ZJUN21)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

DOUGH

https://controlc.com/74403a62

https://controlc.com/74403a62

https://controlc.com/74403a62

Kitchen still open

Godspeed

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64893

Originally posted at >>>/qresearch/13927710 (180147ZJUN21) Notable: , U.S. Attorney’s Office

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

U.S. Attorney’s Office

Eastern District of Texas

FOR IMMEDIATE RELEASE

Thursday, June 17, 2021

Costa Rican National Extradited to Eastern District of Texas and Sentenced for Conspiracy to Import Cocaine into the United States

Defendant Apprehended and Prosecuted as Part of “Operation Black Sails,” a Wide-Ranging International Drug Investigation

PLANO, Texas – A Costa Rican man was sentenced to federal prison for drug trafficking violations in the Eastern District of Texas, announced Acting U.S. Attorney Nicholas J. Ganjei today.

Felipe Espinoza-Cruz, 49, pleaded guilty on Feb. 3, 2021, to conspiracy to manufacture and distribute 5 kilograms or more of cocaine for distribution into the United States and was sentenced to 135 months in federal prison today by U.S. District Judge Sean D. Jordan.

“As this case demonstrates, drug smugglers will use any transportation method they can to bring their deadly wares to our shores,” said Acting U.S. Attorney Nicholas J. Ganjei. “Although the transportation network these traffickers devised and implemented was extraordinarily vast and complex, our law enforcement partners were able to identify and disrupt it, and ultimately bring the perpetrators to justice in United States courts. This case is nothing less than a tremendous win for the American people.”

“Drug trafficking, whether on one of our local street corners or on the open sea 1500 nautical miles away still impacts the safety and security of all of our lives,” said Eduardo A. Chávez, Special Agent in Charge of the DEA Dallas Field Division. “This sentence reflects our continued resolve to partner with our international law-enforcement counterparts to fight greed, violence, and drug addiction as we continue to combat the crises we face daily.”

According to information presented in court, from at least 2005 and continuing up until his indictment, Espinoza-Cruz, a resident and national of Costa Rica, was a member of a drug trafficking organization responsible for multi-ton cocaine shipments originating in Colombia and then shipped to Costa Rica, Guatemala, and Mexico for further distribution to the United States. Airplanes, go-fast boats, semi-tractor trailer trucks, and passenger vehicles were used to transport most of the cocaine shipments. A federal grand jury returned an indictment charging Espinoza-Cruz with federal drug trafficking violations on Nov. 10, 2016.

This effort is part of an Organized Crime Drug Enforcement Task Forces (OCDETF) operation. OCDETF identifies, disrupts, and dismantles the highest-level criminal organizations that threaten the United States using a prosecutor-led, intelligence-driven, multi-agency approach. Additional information about the OCDETF Program can be found at https://www.justice.gov/OCDETF.

This case was investigated by the U.S. Drug Enforcement Administration and prosecuted by Assistant U.S. Attorney Colleen Bloss.

https://www.justice.gov/usao-edtx/pr/costa-rican-national-extradited-eastern-district-texas-and-sentenced-conspiracy-import

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64894

File: 814a1bfea6bce93⋯.mp4 (2.6 MB,1280x720,16:9,Clipboard.mp4)

File: 60eccef70b97c0d⋯.jpg (126.32 KB,720x1019,720:1019,Clipboard.jpg)

Originally posted at >>>/qresearch/13927717 (180148ZJUN21) Notable: We love you Dan 🇺🇸🦅 @DanScavino

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

It's time

https://twitter.com/mentalbrethmint/status/1405685222520365064?s=19

‘They poked the bear’ 😎

We love you Dan 🇺🇸🦅 @DanScavino tell the boss we can’t wait https://t.co/cVAbvUoSnf

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64895

Originally posted at >>>/qresearch/13927719 (180148ZJUN21) Notable: , U.S. Attorney’s Office

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64893

U.S. Attorney’s Office

Eastern District of Texas

FOR IMMEDIATE RELEASE

Thursday, June 17, 2021

Final Defendant Sentenced in Anderson County Drug Trafficking Conspiracy

TYLER, Texas – The final defendant has been sentenced to federal prison in a drug trafficking conspiracy in the Eastern District of Texas, announced Acting U.S. Attorney Nicholas J. Ganjei today.

Amber Nicole Priehs, 30, pleaded guilty on Dec. 12, 2019, to conspiracy to distribute cocaine, methamphetamine, and heroin, and was sentenced to 80 months in federal prison today by U.S. District Judge Jeremy D. Kernodle. Priehs was the sixth and final Palestine, Texas resident to be sentenced in the drug trafficking conspiracy.

“The imprisonment of this drug trafficking organization is a significant victory for the citizens of Palestine and the rest of East Texas,” said Acting U.S. Attorney Nicholas J. Ganjei. “Our office will continue to pursue those who pump poison and misery into our communities. These defendants showed an utter lack of regard for their fellow citizens by lining their own pockets off of addiction and the decay of their own community.”

According to information presented in court, Byron Bernard Billups, Brandon Williams, and Priehs distributed large amounts of methamphetamine, cocaine, and heroin in Palestine and surrounding areas. Billups served as the leader and primary source of supply and worked with Priehs and others to acquire kilos of methamphetamine and other drugs from sources of supply across Texas and brought them back to East Texas for distribution. Brandon Williams distributed bulk methamphetamine, cocaine, and ecstasy to wholesale and retail customers from his home in Palestine, which he shared with his uncle, Larry Williams, who also assisted with handling customers in the drug deals. Priehs distributed bulk methamphetamine, cocaine, and heroin directly to customers and through Marcos Navarro, who reported to Priehs. Priehs also recruited Steve Foster to store bulk drugs at his house, which he also permitted Priehs to use to meet customers. A federal grand jury returned an indictment charging the defendants with federal drug trafficking violations on Feb. 20, 2019.

Brandon Kione Williams, 37, pleaded guilty on Sep. 21, 2020, to conspiracy to distribute drugs and was sentenced to 216 months in federal prison on March 25, 2021. Larry Joe Williams, 65, pleaded guilty on March 9, 2020, to misprision of a felony and was sentenced to 36 months in federal prison on Oct. 13, 2020. Byron Bernard Billups, 36, pleaded guilty on July 14, 2020, to conspiracy to distribute drugs and was sentenced to 120 months in federal prison on Dec. 17, 2020.

Marcos Antonio Navarro, 35, pleaded guilty on March 12, 2020, to conspiracy to distribute drugs and was sentenced to 60 months in federal prison on August 11, 2020. Steve Allen Foster, 33, pleaded guilty on March 16, 2020, to conspiracy to distribute drugs and was sentenced to 78 months in federal prison on Sep. 15, 2020.

This effort is part of an Organized Crime Drug Enforcement Task Forces (OCDETF) operation. OCDETF identifies, disrupts, and dismantles the highest-level criminal organizations that threaten the United States using a prosecutor-led, intelligence-driven, multi-agency approach. Additional information about the OCDETF Program can be found at https://www.justice.gov/OCDETF.

This case was investigated by the U.S. Drug Enforcement Administration, Texas Department of Public Safety-CID, and the Palestine Police Department. These defendants were prosecuted by Assistant U.S. Attorneys Ryan Locker, Colleen Bloss, and Heather H. Rattan.

https://www.justice.gov/usao-edtx/pr/final-defendant-sentenced-anderson-county-drug-trafficking-conspiracy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64896

File: 0b4594ba4c8d550⋯.jpg (33.5 KB,945x591,315:197,Clipboard.jpg)

Originally posted at >>>/qresearch/13927730 (180149ZJUN21)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64892

TYB

I suppose we couldhandoff?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64897

Originally posted at >>>/qresearch/13927735 (180150ZJUN21) Notable: , U.S. Attorney’s Office

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64895

U.S. Attorney’s Office

Western District of Pennsylvania

FOR IMMEDIATE RELEASE

Thursday, June 17, 2021

25 Indicted for Drug Trafficking in Western PA and Beyond

PITTSBURGH - Twenty-five individuals have been named in two separate, but related, Indictments for trafficking multiple drugs, including heroin, fentanyl, methamphetamine, cocaine and cocaine base, Acting United States Attorney Stephen R. Kaufman announced today. The defendants were arrested today following a year-long investigation into drug trafficking in Mercer and Lawrence Counties and beyond.

The first indictment names the following individuals as defendants:

London Pinkins, age 26, of Sharon, Pennsylvania;

Jimmy Gadson, age 34, of Sharon, Pennsylvania;

Harold Hooten, age 44, of Hermitage, Pennsylvania;

Torlando Hopson, age 32, of Farrell, Pennsylvania;

Alphonse Johnson, age 39, currently incarcerated;

Amanda Karwowski, age 29, of Grove City, Pennsylvania, currently incarcerated;

Michael Love, age 43, of Jackson Center, Pennsylvania;

Katlyn McGirr, age 29, of Hermitage, Pennsylvania;

Kenneth Miller, age 59, of Farrell, Pennsylvania;

Nicholas Ostheimer, age 23, of Sharon, Pennsylvania;

Eugene Phillips, age 29, of Farrell, Pennsylvania, currently incarcerated;

Quinton Pinkins, age 36, of Farrell, Pennsylvania;

Joseph Pumphrey, age 62, of Hermitage, Pennsylvania;

Courtney Purdy, age 30, of Mercer, Pennsylvania;

Jeronte Robinson, age 26, of Hermitage, Pennsylvania;

Jammar Shelton, age 42, of Masury, Ohio;

James West, age 45, of Brackenridge, Pennsylvania;

Khiry Whiteside, age 30, of Farrell, Pennsylvania;

Denzel Williams, age 27, of Farrell, Pennsylvania;

Jermall Johnson, age 24, of Erie, Pennsylvania;

Jackie Bell, age 29, of Columbus, Ohio; and

Albert Cummings, age 41, of Cleveland, Ohio.

All of the 22 defendants are charged in Count 1 with conspiring to distribute and possess with intent to distribute 40 grams or more of fentanyl, 100 grams or more of heroin, 28 grams or more of cocaine base, a quantity of cocaine, and a quantity of methamphetamine from June 2020 to June 2021. Count 2 charges London Pinkins and Phillips with conspiring to launder drug trafficking proceeds from February 2021 to June 2021. Counts 3 (Williams), 17 (Alphonse Johnson), 23 (Karwowski), and 24 (London Pinkins) charge several defendants with possession with intent to distribute and/or distribution of 28 grams or more of cocaine base, a quantity of cocaine, and/or a quantity of methamphetamine.

Counts 4 (Ostheimer), 6-8 (Ostheimer and Gadson), 14 (Cummings), 15 (Gadson), 19-22 (West, Gadson, Shelton, and London Pinkins), and 25-28 (Purdy and Quinton Pinkins) charge several defendants with possession with intent to distribute and/or distribution of a quantity of fentanyl, heroin, cocaine base, and/or cocaine within 1,000 feet of a playground, school, and public housing. Counts 5 (Ostheimer), 9-13 (London Pinkins, Gadson, Bell, McGirr), 16 (Gadson), and 18 (Williams) charge several defendants with possession with intent to distribute and/or distribution of a quantity of fentanyl, heroin, cocaine base, cocaine, and/or methamphetamine.

The law provides for a maximum total sentence of at least five years and up to 40 years in prison and a fine of up to $5,000,000 for each of the crimes charged in Counts 1, 3, 17, 23, and 24. The law provides for a maximum total sentence for Count 2 of up to 20 years in prison and a fine of up to $500,000 (or twice the value of the property involved in the transaction, whichever is greater).

The law provides for a maximum total sentence for each of Counts 4, 6-8, 14, 15, 19-22, and 25- 28 of at least one year and up to 40 years in prison and a fine of up to $2,000,000. The maximum sentence for Counts 5, 9-13, 16, and 18 is up to 20 years in prison and a fine of up to $1,000,000. Under the Federal Sentencing Guidelines, the actual sentences imposed would be based upon the seriousness of the offenses and the prior criminal histories of the defendants.

The second indictment names the following individuals as defendants:

Forrest Gilmore, age 25, of New Castle, Pennsylvania;

Melvin Dorsey-Pace, age 28, of New Castle, Pennsylvania; and

Rayjzon Sams, 28, age of Farrell, Pennsylvania.

The seven-count Indictment charges the defendants in Count 1 with conspiring to distribute 28 grams or more of cocaine base and a quantity of cocaine from June 2020 to June 2021. Counts 2 (Gilmore), 4 (Dorsey-Pace), 5 (Sams), and 7 (Sams) charge possession with intent to distribute and distribution of a quantity of cocaine base within 1,000 feet of a playground, school, and public housing. Count 3 charges Gilmore with possessing with intent to distribute and distribution of 28 grams or more of cocaine base on September 17, 2020. Count 6 charges Sams with possessing with intent to distribute and distribution of a quantity of cocaine on April 18, 2021.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64898

File: 792ffaac4153818⋯.jpg (37.59 KB,526x526,1:1,Clipboard.jpg)

Originally posted at >>>/qresearch/13927741 (180150ZJUN21) Notable: Wannabe Vax Mandates RE: Pop Music

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Ricky Schroder protests Foo Fighters show over vaccine mandate

'The Foo Fighters required attendees to show proof they received a COVID-19 vaccine in order to purchase tickets, which were only sold in person last weekend.'

'Dave Grohl is an ignorant punk'

https://www.yahoo.com/entertainment/ricky-schroder-protests-foo-fighters-show-over-vaccine-mandate-180546608.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64899

File: 5f180da17134a59⋯.jpg (299.12 KB,2048x1536,4:3,Clipboard.jpg)

Originally posted at >>>/qresearch/13927757 (180153ZJUN21)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64896

HANDOFF CONFIRM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64900

File: ce58b3217595e23⋯.png (171.35 KB,681x383,681:383,Clipboard.png)

Originally posted at >>>/qresearch/13927777 (180157ZJUN21) Notable: Wannabe Vax Mandates RE: Pop Music

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

=="Springsteen On Broadway" is Off Limits For Fans Vaccinated With AstraZeneca

==

https://deadline.com/2021/06/springsteen-on-broadway-astrazeneca-covid-vaccine-audience-members-1234777046/

In what could be a harbinger for Broadway’s post-Covid protocol, Springsteen on Broadway has announced that audience members must be vaccinated with an FDA-authorized vaccine, a policy no doubt disappointing to the many Canadians and Europeans who have received the AstraZeneca vaccine. Producers of Springsteen on Broadway announced Tuesday night that the show, which will begin performances on June 26 to become Broadway’s first post-shutdown arrival, will require the FDA-authorized vaccines. To date, the FDA has authorized vaccines by Moderna, Pfizer-BioNTech and Johnson & Johnson.

The news hasn’t gone over particularly well in the countries where AstraZeneca is in use. The Toronto Star headlined its Wednesday report “Burn in the U.S.A.”

The Springsteen on Broadway website, which lists the Covid protocols for the production at the St. James Theatre, states that audience members over 16 must be fully vaccinated and 14 days out from the final dose of the Pfizer-BioNtech, Moderna or Johnson & Johnson vaccine. Children under 16 must be accompanied by a vaccinated adult and also must provide proof of a negative antigen Covid-19 test taken within 6 hours of the performance start time or negative PCR Covid-19 test taken within 72 hours of the performance start time.

The website further indicates that the vaccine requirements are being made “at the direction of New York State.”

Other Broadway shows that have announced openings or returns, largely beginning in September, have indicated that they will follow Covid protocols current at the time of performances. For example, Pass Over, beginning performances Aug. 4, and Hadestown, on Sept. 2 – both shows at venues owned, like Springsteen‘s St. James, by Jujamcyn Theaters – have not yet specified vaccination policies regarding audience members.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64901

File: 2c64ab53e598597⋯.png (203.07 KB,781x905,781:905,Clipboard.png)

File: bdaec5a1d6672f1⋯.png (37.37 KB,748x871,748:871,Clipboard.png)

File: 2d488b90506c2dc⋯.png (17.06 KB,721x396,721:396,Clipboard.png)

File: db7ccdd82520c09⋯.png (210.01 KB,564x713,564:713,Clipboard.png)

File: 48b31c97c6f9542⋯.png (187.25 KB,559x701,559:701,Clipboard.png)

Originally posted at >>>/qresearch/13927798 (180200ZJUN21) Notable: FBI Ignored Its Own Warrant And Search Policies To Seize Millions From People's Safety Deposit Boxes

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

FBI Ignored Its Own Warrant And Search Policies To Seize Millions From People's Safety Deposit Boxes

In March of this year, the US Attorney in Los Angeles, California secured an indictment against a secure vault company, alleging the company was engaged in money laundering, drug trafficking, and hiding taxable assets. None of the company's employees or owners were indicted.

FBI agents spent five days turning US Private Vaults upside down. Agents apparently emptied every safety deposit box housed by the business. They did this in complete contradiction of the limits imposed on them by the FBI's own warrant affidavit. Here's Eric Boehm of Reason with some background:

[T]he unsealed warrant authorizing the raid of U.S. Private Vaults granted the FBI permission to seize only the business's computers, money counters, security cameras, and large steel frames that effectively act as bookshelves for the boxes themselves. Per FBI rules, however, the boxes could not be left unsecured in the vault after the raid had been completed, so agents had to take them into custody too.

The FBI could have taken custody of the boxes without opening them and sought warrants for those implicated by the investigation. Instead, the FBI agents emptied the boxes while still on the premises, engaging in dozens of searches not authorized by any warrant.

Here's what the FBI said it would do in its warrant request:

https://www.techdirt.com/articles/20210613/16341146984/fbi-ignored-own-warrant-search-policies-to-seize-millions-peoples-safety-deposit-boxes.shtml

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64902

File: 67899261019aab3⋯.png (790.59 KB,1478x1484,739:742,Clipboard.png)

Originally posted at >>>/qresearch/13927820 (180202ZJUN21) Notable: NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

HUGE DEVELOPMENT: NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

Tonight we obtained a bombshell.

This started this morning with our post related to Ty Clevenger and how the FBI responded to his FOIA request and basically said that they would only provide the documents Clevenger requested at a certain pace and based on Clevenger’s calculation based on the number of documents, this exercise will take decades for the FBI to provide him all the documents he requested:

After we posted this, this afternoon Clevenger received a letter from the National Security Agency (NSA). In the letter the NSA promised to provide records related to the FBI’s illegal spying on Americans:

Buckle up, kids. The National Security Agency has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans, according to a letter that I received from the NSA this afternoon, and that suggests a political fight between the two agencies.

The NSA replied to the exact same request Clevenger provided to the FBI where he received the response it would take the FBI decades to respond. Below is the NSA’s letter:

(see screenshot)

Clevenger believes there may be some friction between the FBI and NSA:

As you may recall, Admiral Mike Rogers tried to shut down FBI access to the NSA database in 2016 (while he was serving as NSA director) after learning that FBI contractors were illegally searching the database. Over at The Conservative Treehouse, Sundance has built a solid case that FBI contractors were exploiting the NSA database for opposition research on political enemies (also see here and here and here). One of the contractors with access to the NSA database, for example, appears to be Fusion GPS, which helped Christopher Steele’s produce the infamous “Russian collusion” dossier. In fact, it appears that one of the mistakes in Steele’s report, i.e., that President Trump’s personnel attorney Michael Cohen made a trip to Prague, was the result of an illegal search of the NSA database (which produced travel records for the wrong “Michael Cohen”).

iven the history of animosity between the FBI and NSA over misuse of the database, I cannot help but wonder whether the NSA is taking a shot at the FBI by preemptively producing the records that the FBI refused to produce, i.e., records of the FBI’s ongoing illegal surveillance of U.S. citizens. The FBI is downright dangerous, and perhaps some patriots at the NSA recognize that. Consider, for example, the growing evidence that the FBI not only infiltrated but helped orchestrate the January 6, 2021 “insurrection” at the U.S. Capitol.

Now we know without a doubt that the FBI is spying on thousands of Americans and is infiltrating various entities in America and setting people up for crimes.

One has to wonder if there are any political hit jobs on any conservatives in the US that are not set ups by the FBI.

https://www.thegatewaypundit.com/2021/06/huge-development-nsa-reveals-foia-response-fbi-involved-improper-surveillance-16000-americans/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64903

File: fd6188a337848d5⋯.png (397.4 KB,750x1334,375:667,Clipboard.png)

File: 7bbde116d87c9c6⋯.png (193.31 KB,750x1334,375:667,Clipboard.png)

File: 45010e2793a14b6⋯.png (410.2 KB,750x1334,375:667,Clipboard.png)

Originally posted at >>>/qresearch/13927840 (180205ZJUN21) Notable: Former Army Major Apache Pilot Convicted for Murder

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.dailymail.co.uk/news/article-9697399/Airline-pilot-guilty-killing-three-neighbors-Kentucky.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64904

File: 2951ff646cf48b9⋯.png (364.01 KB,598x684,299:342,Clipboard.png)

Originally posted at >>>/qresearch/13927848 (180206ZJUN21) Notable: US Space Force operations chief: reveals DEWs to the public

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

US Space Force operations chief confirms working on space-based directed-energy weapons

https://twitter.com/SputnikInt/status/1405698275836051456

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64905

File: 41cc64d0c728964⋯.png (1.02 MB,1918x905,1918:905,Clipboard.png)

Originally posted at >>>/qresearch/13927861 (180208ZJUN21) Notable: Potential Q Proof Incoming

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Some Background

Throughout 2020 the Black Lives Matter terrorist group was linked to conservatively 91% of the riots that resulted in the most expensive property damage in US insurance history

Advertisement - story continues below

There were zero Trump rallies that turned violent during that same time period.

Then on January 6, after one million Trump supporters rallied with President Trump at the Ellipse outside the White House, some 900 individuals went inside the US Capitol. Over 400 have since been arrested, including those who were waved into the US Capitol by the police standing at the exits.

TRENDING: BREAKING EXCLUSIVE: Did Opportunists In the US Cede to China Crypto-currency Like Others Did Biowarfare Technology?

Since January, the Deep State and Democrats will not release videotapes to Republican lawmakers from January 6th inside or outside the US Capitol.

Earlier this week Revolver News published an important piece on the “unindicted co-conspirators” in the Jan. 6 attack who were never charged by the DOJ or FBI for their part in the violence on Jan. 6.

Advertisement - story continues below

The “unindicted co-conspirators” were frequently the most violent and leaders of the assault on the US Capitol. They are also likely FBI informants.

We also reported earlier this week that we have proof that the FBI was actively recruiting military members to infiltrate and spy on the Oath Keepers and Proud Boys before the Jan. 6 protests.

On March 23rd, The Gateway Pundit posted this article on former Green Beret Jeremy Brown – in this report, Brown provides evidence that he was recruited by the FBI:

Advertisement - story continues below

(** You can support Jeremy Brown’s fundraising effort here.)

Tonight we obtained a bombshell

Advertisement - story continues below

This started this morning with our post related to Ty Clevenger and how the FBI responded to his FOIA request and basically said that they would only provide the documents Clevenger requested at a certain pace and based on Clevenger’s calculation based on the number of documents, this exercise will take decades for the FBI to provide him all the documents he requested:

After we posted this, this afternoon Clevenger received a letter from the National Security Agency (NSA). In the letter the NSA promised to provide records related to the FBI’s illegal spying on Americans:

Buckle up, kids. The National Security Agency has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans, according to a letter that I received from the NSA this afternoon, and that suggests a political fight between the two agencies.

Advertisement - story continues below

The NSA replied to the exact same request Clevenger provided to the FBI where he received the response it would take the FBI decades to respond. Below is the NSA’s letter:

https://www.thegatewaypundit.com/2021/06/huge-development-nsa-reveals-foia-response-fbi-involved-improper-surveillance-16000-americans/

cont

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64906

Originally posted at >>>/qresearch/13927864 (180209ZJUN21) Notable: Potential Q Proof Incoming

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64905

2

Clevenger believes there may be some friction between the FBI and NSA:

As you may recall, Admiral Mike Rogers tried to shut down FBI access to the NSA database in 2016 (while he was serving as NSA director) after learning that FBI contractors were illegally searching the database. Over at The Conservative Treehouse, Sundance has built a solid case that FBI contractors were exploiting the NSA database for opposition research on political enemies (also see here and here and here). One of the contractors with access to the NSA database, for example, appears to be Fusion GPS, which helped Christopher Steele’s produce the infamous “Russian collusion” dossier. In fact, it appears that one of the mistakes in Steele’s report, i.e., that President Trump’s personnel attorney Michael Cohen made a trip to Prague, was the result of an illegal search of the NSA database (which produced travel records for the wrong “Michael Cohen”).

Advertisement - story continues below

Given the history of animosity between the FBI and NSA over misuse of the database, I cannot help but wonder whether the NSA is taking a shot at the FBI by preemptively producing the records that the FBI refused to produce, i.e., records of the FBI’s ongoing illegal surveillance of U.S. citizens. The FBI is downright dangerous, and perhaps some patriots at the NSA recognize that. Consider, for example, the growing evidence that the FBI not only infiltrated but helped orchestrate the January 6, 2021 “insurrection” at the U.S. Capitol…

…Speaking of FBI chicanery, read today’s post in The Gateway Pundit about the FBI’s attempts to hide documents related to the Wikileaks fiasco. And consider this recent court filing about the FBI’s ongoing attempts to hide records about murdered DNC employee Seth Rich (the FBI has gone so far as to lie to federal courts). Tucker Carlson is right about the FBI: it’s dirty, dirty, dirty, and it may be the single greatest threat to our individual liberties.

Now we know without a doubt that the FBI is spying on thousands of Americans and is infiltrating various entities in America and setting people up for crimes.

One has to wonder if there are any political hit jobs on any conservatives in the US that are not set ups by the FBI.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64907

File: c5f69ec70cc466e⋯.png (140.03 KB,836x797,836:797,Clipboard.png)

File: aab937878414fac⋯.png (110.37 KB,856x390,428:195,Clipboard.png)

File: 8e08f6e7efc0228⋯.png (138.54 KB,860x561,860:561,Clipboard.png)

Originally posted at >>>/qresearch/13927871 (180210ZJUN21) Notable: NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

Some Background

Throughout 2020 the Black Lives Matter terrorist group was linked to conservatively 91% of the riots that resulted in the most expensive property damage in US insurance history

There were zero Trump rallies that turned violent during that same time period.

Then on January 6, after one million Trump supporters rallied with President Trump at the Ellipse outside the White House, some 900 individuals went inside the US Capitol. Over 400 have since been arrested, including those who were waved into the US Capitol by the police standing at the exits.

Since January, the Deep State and Democrats will not release videotapes to Republican lawmakers from January 6th inside or outside the US Capitol.

Earlier this week Revolver News published an important piece on the “unindicted co-conspirators” in the Jan. 6 attack who were never charged by the DOJ or FBI for their part in the violence on Jan. 6.

The “unindicted co-conspirators” were frequently the most violent and leaders of the assault on the US Capitol. They are also likely FBI informants.

We also reported earlier this week that we have proof that the FBI was actively recruiting military members to infiltrate and spy on the Oath Keepers and Proud Boys before the Jan. 6 protests.

On March 23rd, The Gateway Pundit posted this article on former Green Beret Jeremy Brown – in this report, Brown provides evidence that he was recruited by the FBI:

This started this morning with our post related to Ty Clevenger and how the FBI responded to his FOIA request and basically said that they would only provide the documents Clevenger requested at a certain pace and based on Clevenger’s calculation based on the number of documents, this exercise will take decades for the FBI to provide him all the documents he requested:

After we posted this, this afternoon Clevenger received a letter from the National Security Agency (NSA). In the letter the NSA promised to provide records related to the FBI’s illegal spying on Americans:

Buckle up, kids. The National Security Agency has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans, according to a letter that I received from the NSA this afternoon, and that suggests a political fight between the two agencies.

https://www.thegatewaypundit.com/2021/06/huge-development-nsa-reveals-foia-response-fbi-involved-improper-surveillance-16000-americans/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64908

File: 920f84825096974⋯.jpg (73.74 KB,836x797,836:797,Clipboard.jpg)

Originally posted at >>>/qresearch/13927895 (180213ZJUN21) Notable: Potential Q Proof Incoming

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64906

>>64905

>>64905

>https://www.thegatewaypundit.com/2021/06/huge-development-nsa-reveals-foia-response-fbi-involved-improper-surveillance-16000-americans/

potential Q proof incoming

NSA is going to release the FOIA request the FBI refuses to

Clevenger believes there may be some friction between the FBI and NSA

As you may recall, Admiral Mike Rogers tried to shut down FBI access to the NSA database in 2016 (while he was serving as NSA director) after learning that FBI contractors were illegally searching the database. Over at The Conservative Treehouse, Sundance has built a solid case that FBI contractors were exploiting the NSA database for opposition research on political enemies (also see here and here and here). One of the contractors with access to the NSA database, for example, appears to be Fusion GPS, which helped Christopher Steele’s produce the infamous “Russian collusion” dossier. In fact, it appears that one of the mistakes in Steele’s report, i.e., that President Trump’s personnel attorney Michael Cohen made a trip to Prague, was the result of an illegal search of the NSA database (which produced travel records for the wrong “Michael Cohen”).

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64909

File: 836de378234ef81⋯.png (208.1 KB,856x715,856:715,Clipboard.png)

File: f8bcfa4c32dabe8⋯.png (138.8 KB,863x816,863:816,Clipboard.png)

File: 7dda8690d2359c4⋯.png (69.83 KB,859x327,859:327,Clipboard.png)

File: 1090e5d2be91838⋯.png (303.14 KB,859x806,859:806,Clipboard.png)

File: efaab6087a2522d⋯.png (117.58 KB,850x601,850:601,Clipboard.png)

Originally posted at >>>/qresearch/13927906 (180214ZJUN21) Notable: Top Doctor Issues Warning: COVID Vaccine ‘Spike Protein Shedding’ Damages Placenta, ‘We Are Being Experimented On’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Top Doctor Issues Warning: COVID Vaccine ‘Spike Protein Shedding’ Damages Placenta, ‘We Are Being Experimented On’

Powerful interests are invested in compromising our immune systems and human fertility with coercion and mandates of experimental vaccines that are only in investigative states.

Even those who refrain from getting vaccinated are in peril, warns the medical director of a team of physicians under fire for exposing propaganda surrounding the coronavirus pandemic.

Recipients of the vaccines, which have yet to be approved by the Food and Drug Administration, are shedding the vaccine’s transmissible and dangerous spike protein.

Dr. Shelley Cole, a board-certified OBGYN and Medical Director for America’s Front Line Doctors explained in an exclusive interview with The Gateway Pundit, “Concern started when we saw that individuals who were not vaccinated, who were around vaccinated individuals started having abnormal bleeding. Their periods would be disrupted, or they had a passage of large clots or heavy bleeding or pre-term deliveries, miscarriages even.”

Thousands of women have reported disrupted menstrual cycles, hemorrhaging, miscarriages and stillbirth after receiving injections of the vaccines.

These effects are attributed to receptors in the contagious spike proteins that attach to the placenta and uterus and “cross the blood, brain barrier within 15 minutes of the vaccine injection,” Cole explains.

“There are similarities to one of the receptors in the spike protein to a protein that is in placentas [which] allows the placenta to stick to the wall of the uterus,” Cole said. “These are highly specialized proteins that humans make. The spike protein – the ‘syncytio protein,’ is very similar to the syncytiotrophoblastic cells in the placenta. So, yes, we are very concerned.

“I had one woman come up to me and she said that she had actually just touched the arm of someone –of course we don’t know 100 percent sure if she got the spike proteins from this individual – but she kind of rubbed the arm and patted the individual and subsequently she begins bleeding. She had not had periods for 25 years, but now she’s bleeding,” she continued. “It’s ironic that the vaccinated tend to be more fearful of the unvaccinated, but in truth, it really is unvaccinated that are at greater risk from being exposed from the vaccinated.”

https://www.thegatewaypundit.com/2021/06/top-doctor-issues-warning-covid-vaccine-spike-protein-shedding-damages-placenta-experimented/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64910

Originally posted at >>>/qresearch/13927918 (180215ZJUN21) Notable: PREPARATION FOR WAR GAMES (FT. GENERAL MICHAEL FLYNN & ADMIRAL ROGERS)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.bitchute.com/video/6bQtfTdeSFvi/

-PREPARATION FOR WAR GAMES (FT. GENERAL MICHAEL FLYNN & ADMIRAL ROGERS)-

GOD BLESS

o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64911

File: d9e26ef82ab084b⋯.jpg (889.92 KB,1528x926,764:463,Clipboard.jpg)

File: 815942412fb05e3⋯.pdf (8.33 MB,Clipboard.pdf)

Originally posted at >>>/qresearch/13928029 (180228ZJUN21) Notable: Vampires Exist

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64892

If you truly want to understand what is, has, and will be going on… Literally everything, from time, space, conspiracies, censorship, Nazis, Jews, Cabals, Child Crimes, etc was covered by H.P. Blavatsky in 1877, ISIS UNVEILED. Screenshot from pg 508. It's a quick 1400+ page tome…

NOTHING CAN STOP WHAT IS COMING

DARK TO LIGHT

FUTURE PROVES PAST

ENJOY THE SHOW

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64912

File: da1bd5a38c2636f⋯.png (1.56 MB,3814x1869,3814:1869,Clipboard.png)

Originally posted at >>>/qresearch/13928095 (180236ZJUN21) Notable: Cyber Polygon Exercise

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928002

JULY 9, 2021

Cyber Polygon

9 July 2021

The international capacity building initiative aimed at raising the global cyber resilience and the expansion of intersectoral cooperation against cyberthreats.

https://cyberpolygon.com/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64913

File: 9bf071aa07115e6⋯.png (78.04 KB,1617x795,539:265,Clipboard.png)

File: 142bac78ee316c3⋯.png (1.46 MB,3814x1869,3814:1869,Clipboard.png)

Originally posted at >>>/qresearch/13928120 (180239ZJUN21) Notable: Cyber Polygon Exercise

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64912

==HEADS UP WE HAVE ANOTHER FUCKING exercise

ON A GLOBAL SCALE==

https://cyberpolygon.com/

What Is Cyber Polygon

Cyber Polygon is a unique cybersecurity event that combines the world’s largest technical training for corporate teams and an online conference featuring senior officials from international organisations and leading corporations.

Every year, the training brings together a wide range of global businesses and government structures while the live stream gathers millions of spectators from across the world.

Strategic Goals

The annual training enables organisations to assess their cyber resilience, exchange best practices and bring tangible results to the global community:

- develop the teams’ skills in repelling cyberattacks

- expand the practical knowledge of technical specialists

- engage the management of international organisations and corporations in the cybersecurity dialogue

- raise public awareness of cybersecurity

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64914

File: 82cb1d439d6e1f8⋯.png (481.81 KB,680x511,680:511,Clipboard.png)

Originally posted at >>>/qresearch/13928145 (180242ZJUN21) Notable: FOUR BA Pilots Dead, Potentially From Vaxx Complications

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Now, FOUR BA Pilots dead due "to the Maxine" (see pic)

But BA denies that any 'crisis talks' are underway between Airline and Pilots about grounding ALL vaccinated pilots which is approximately 80% of all BA pilots.

Watch as this crisis begins to sweep the ENTIRE Airline Industry.

RIP the pilots and their families but at least NOW my Daughter's college will BACK OFF their forced vaxxcination policy prior to beginning fall classes.

https://www.reuters.com/article/factcheck-coronavirus-aviation/fact-check-british-airways-is-not-in-crisis-talks-with-the-government-over-vaccinated-pilots-idUSL2N2NZ1ZO

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64915

Originally posted at >>>/qresearch/13928158 (180244ZJUN21) Notable: Farmers vs Feds. The “Government Stole Our Water!”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Farmers Blame The Feds: The “Government Stole Our Water!”

Farmers in the United States have reached a breaking point. They now say that what the government has done has been so disastrous that they are willing to stand off with the Feds.

Farmers in Oregon are protesting because they own the water in the Upper Klamath Lake, farmer Dan Nielsen told RT’s Ruptly video agency. He stood outside an American flag-colored tent that was set up next to the canal headgates, which control the flow of irrigation water from the lake. “It’s ours and the federal government actually just stole it. No due process of law, no compensation,” Nielsen said, adding that federal officials had violated the locals’ property rights guaranteed by the US Constitution.

Are people really just now figuring out that the government, doesn’t care about the Constitution?

“But whether the Constitution really be one thing or another, this much is certain – that it has either authorized such a government as we have had or has been powerless to prevent it. In either case, it is unfit to exist.” ― Lysander Spooner, No Treason: The Constitution of No Authority

The rulers do not care. They do not care about the rules they use force and violence to make the rest of us obey. Government is slavery it always has been and it always will be.

The US Bureau of Reclamation closed the canal last month, saying that due to the extreme drought there was not enough water left for it to operate properly. The bureau also said that releasing the water will threaten the endangered species of salmon that inhabit the lake. The fish have agricultural and spiritual significance to the Native American tribes who live upstream, according to a report by RT.

According to local media, thousands of farmers on the Oregon-California border were left without a steady water supply after the closure of the canal. Klamath Irrigation District president Ty Kliewer said that “the impacts to our family farms and these rural communities will be off the scale.”

The farmers are now in such a dire situation and with a food supply already on a razor’s edge of disaster, they say they will release the water themselves.

They spoke about releasing the water themselves if the government does not back down. “If [the Feds] don’t budge… I think we’re just going to end up taking it,” Nielsen said. “It’s the only way the government gets it.” In order to avoid confrontation, officials must let farmers use the water for their crops or purchase the land from the farmers, he said.

They showed JPR a text conversation with Bundy and said the militiamen will get a heads-up when the farmers make their move. “I’m planning on getting DC’s attention,” another outraged farmer, Grant Knoll told Jefferson Publis Radio this month. “We’re going to turn on the water and have a standoff.”

“Everything the State says is a lie, and everything it has it has stolen.”― Friedrich Nietzsche

https://patriotrising.com/farmers-blame-the-feds-the-government-stole-our-water/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64916

File: 89d0f1786807d86⋯.png (209.84 KB,478x588,239:294,Clipboard.png)

Originally posted at >>>/qresearch/13928299 (180301ZJUN21) Notable: @DARPA high-res multi-waveform implantable stimulator chip and multi-scale electrodes for providing high-res therapy

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Through DARPA's Small Business Innovation Research program, scientists at Micro-Leads have developed a high-res multi-waveform implantable stimulator chip and multi-scale electrodes for providing high-res therapy for the nerves and spinal cord.

https://twitter.com/DARPA/status/1405540026184650766

>>>/qresearch/13927858

>Yeah we've had that for about 15 years.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64917

File: 0eb3675a64c104f⋯.jpg (27.93 KB,600x400,3:2,Clipboard.jpg)

Originally posted at >>>/qresearch/13928308 (180303ZJUN21) Notable: CDC is holding an(other?) “emergency meeting” RE: Bloodclots

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

And let the 'vaccine truth commissions' begin… /s

https://www.naturalnews.com/2021-06-17-cdc-emergency-meeting-worldwide-epidemic-blood-clots-covid-vaccines.html

How will the insidious vaccine industrial complex “stop the bleeding” from this already epidemic-sized atrocity of mRNA technology in inoculations that’s proving to cause human blood to clot in the brain and lungs? The mass media (fake news) that’s been teamed up with Big Pharma for decades, is playing “catch and release” with the blood clot epidemic, covering the carnage with a very light, informative tone and then reiterating the LIE that catching Covid is “much more dangerous” and has a higher likelihood of death than getting the vaccines. Sure.

The only problem with that pre-scripted propaganda is that science has already proven them all wrong. Covid only has a .04 death factor on average, and for people under 25 it’s about 0.00. So the CDC is holding an “emergency meeting” to figure out the best ways to script this “catch and release” public disinformation campaign, which is actually their forte.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64918

Originally posted at >>>/qresearch/13928319 (180304ZJUN21) Notable: Biden Attacks Voting Integrity Laws at Juneteenth Federal Holiday Signing Ceremony

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Biden Attacks Voting Integrity Laws at Juneteenth Federal Holiday Signing Ceremony

President Joe Biden signed the Juneteenth federal holiday bill into law on Thursday, using the occasion to criticize Republican voting integrity laws.

Biden said the holiday reminded Americans of the “promise of equality” that was made at the end of slavery but that failed to find fulfillment in the current systemically racist society of the United States.

“It’s not going to be fulfilled so long as the sacred right to vote remains under attack,” Biden said, earning applause from the audience at the White House.

“We see this assault from restrictive laws, threats of intimidation, voter purges, and more,” Biden said. “An assault that offends the very democracy, our very democracy.”

Biden vowed to continue fighting for equality throughout society for every American.

“We cannot rest until the promise of equality is fulfilled for every one of us in every corner of this nation,” he said. “That to me is the meaning of Juneteenth.”

Biden described signing the law as “one of the greatest honors” of his presidency.

The president called the new holiday “a day we remember the moral stain, the terrible toll that slavery took on the country and continues to take, what I’ve long called as America’s original sin.”

Biden said Juneteenth had to enter into the catalog of national holidays along with days to celebrate the military, the workers, previous presidents, and Dr. Martin Luther King Jr. Day.

“This is a really, really, really important day in our history,” Biden said.

He said the day would allow Americans to celebrate the progress they had made with race relations and “grapple” with the history of racism in America.

“Great nations don’t ignore the most painful moments … they embrace them. Great nations don’t walk away,” Biden said.

https://www.breitbart.com/politics/2021/06/17/biden-attacks-voting-integrity-laws-at-juneteenth-federal-holiday-signing-ceremony/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64919

File: d3a7e674fea84d5⋯.jpeg (10.35 KB,255x186,85:62,Clipboard.jpeg)

Originally posted at >>>/qresearch/13928366 (180310ZJUN21) Notable: Remember Anons, just filter, do not reply!!!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Remember Anons, just filter, do not reply!!!

For me personally,

Gore - filtered

porn - filtered

namefags - filtered

animefags - automatically fucking filtered

and any repetitive shit that gets posted bread after bread after bread, you're getting filtered as fuck!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64920

File: 4439b6d1d991a69⋯.png (1.02 MB,693x3269,99:467,Clipboard.png)

Originally posted at >>>/qresearch/13928375 (180310ZJUN21) Notable: CDC is holding an(other?) “emergency meeting” RE: Bloodclots

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64917

>https://www.naturalnews.com/2021-06-17-cdc-emergency-meeting-worldwide-epidemic-blood-clots-covid-vaccines.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64921

Originally posted at >>>/qresearch/13928470 (180322ZJUN21) Notable: #17630, #17631, #17632

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NOTABLES Are NOT Endorsements

Final

>>64892, >>64896, >>64899

#17630

>>64894 We love you Dan 🇺🇸🦅 @DanScavino

>>64893, >>64895, >>64897, U.S. Attorney’s Office

>>64898, >>64900 Wannabe Vax Mandates RE: Pop Music

>>64901 FBI Ignored Its Own Warrant And Search Policies To Seize Millions From People's Safety Deposit Boxes

>>64902, >>64907 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>64903 Former Army Major Apache Pilot Convicted for Murder

>>64904 US Space Force operations chief: reveals DEWs to the public

>>64905, >>64906, >>64908 Potential Q Proof Incoming

>>64909 Top Doctor Issues Warning: COVID Vaccine ‘Spike Protein Shedding’ Damages Placenta, ‘We Are Being Experimented On’

>>64910 PREPARATION FOR WAR GAMES (FT. GENERAL MICHAEL FLYNN & ADMIRAL ROGERS)

>>64911 Vampires Exist

>>64913, >>64912 Cyber Polygon Exercise

>>64914 FOUR BA Pilots Dead, Potentially From Vaxx Complications

>>64915 Farmers vs Feds. The “Government Stole Our Water!”

>>64916 @DARPA high-res multi-waveform implantable stimulator chip and multi-scale electrodes for providing high-res therapy

>>64917, >>64920 CDC is holding an(other?) “emergency meeting” RE: Bloodclots

>>64918 Biden Attacks Voting Integrity Laws at Juneteenth Federal Holiday Signing Ceremony

>>64919 Remember Anons, just filter, do not reply!!!

#17630

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64922

File: de7e41f695c9743⋯.png (26.19 KB,589x306,589:306,Clipboard.png)

Originally posted at >>>/qresearch/13928542 (180334ZJUN21) Notable: Literally shaking

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/RichardGrenell/status/1405729403603091458

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64923

Originally posted at >>>/qresearch/13928546 (180336ZJUN21) Notable: RE: MAGNETIZING THE MASSES

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928509 pb

Multiple reasons. First I will speculate in the negative.

1. Allows easier EMF radiation to enter the body at a higher rate.

2. Negative and 4glte/5g Signals can be easier read by our bodies.

3. Negative and 4glte/5g Signals can be easier sent to our bodies.

4. Mind Control/Body control/Molecular Cell function control.

Positive

1. Possibility of immunity from something bigger coming.

2. More in tune with our mother nature and the Schuman resonance.

3. Be able to receive cosmic/healing rays in a greater degree.

How would they be healed?

Possibility of new technology that has been withheld/or given to us by either positive E.T's or negative E.T's depending on whos in real control of this lab experiment we call humans.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64924

File: c27f1f31a8ce497⋯.jpeg (836.24 KB,2048x1021,2048:1021,Clipboard.jpeg)

Originally posted at >>>/qresearch/13928553 (180338ZJUN21) Notable: Chinese government now admits damage to fuel rods at the Taishan nuclear plant but said the problem is “common”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

China's Nuclear Problem

June 17, 2021

The Chinese government now admits damage to fuel rods at the Taishan nuclear plant but said the problem is “common” and there’s no need for concern. Since the CCP has been so open and forthright about the origin of SARS-2… SkyWatchTV has been banned by YouTube! Please follow SkyWatchTV on Rumble: www.rumble.com/skywatchtv. 5) IDF strikes Hamas targets in Gaza, retaliation for arson balloons; 4) Hunter Biden apparently owns stake in troubled Chinese nuclear plant; 3) Another Canadian pastor arrested for holding outdoor church service; 2) Wholesale prices jump 6.6% in fastest rise on record; 1) Queen Elizabeth proves her mettle by cutting cake with a sword. https://www.skywatchtv.com/skywatchtv-program-archive/?sapurl=LytmM2M2L2xiL21pLytrNzJ0ZHg2P2JyYW5kaW5nPXRydWUmZW1iZWQ9dHJ1ZQ==

Video link below……..sorry couldn’t embed.

https://subspla.sh/k72tdx6

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64925

File: 118fa29cc672fa5⋯.png (48.56 KB,669x890,669:890,Clipboard.png)

File: 16c1b36e59e0504⋯.png (9.03 KB,649x172,649:172,Clipboard.png)

Originally posted at >>>/qresearch/13928557 (180339ZJUN21) Notable: Joe Biden’s Brother Frank Caught Violating Florida Traffic Law, Case Dismissed Due to Police Officer Out for ‘Training’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Documents Show Joe Biden’s Brother Frank Caught Violating Florida Traffic Law, Case Dismissed Due to Police Officer Out for ‘Training’

Public documents show President Joe Biden’s brother, Frank Biden, was caught speeding in Florida and received no punishment in another example of how the Biden family lives above the law.

Court video reveals the case was dismissed June 16, 2021, because the ticketing police officer was absent from the hearing attending police “training” instead, which began May 15 and ended June 17, one day after the hearing. The traffic stop occurred in January of 2021 in Palm Beach County, Florida.

An attorney told Breitbart News under anonymity that many times a police officer will notify the court for the reason of his absence. Documents show this procedure was performed by the officer but the document shows no timestamp or date of submission to the court.

Nevertheless, a police chase video and corresponding documents show Frank Biden was driving his 2014 white Range Rover, the same car he faced losing in a wrongful death lawsuit more than 20 years ago.

Court documents also indicate Frank Biden hired attorney Joel Mumford, who is a former county chief public defender in Broward County and current lead trial counsel of The Ticket Clinic in Palm Beach County, specializing in DUIs, traffic, and drug cases.

When the case was dismissed due to Officer Gray’s absence, the video of the virtual court proceeding depicts neither Mumford nor Frank Biden present at the June 16 hearing.

The video of the proceeding additionally shows the presiding judge, Robert Gershman, joking with attorney Roger Gottfried about Joe and Frank Biden.

“Joe got a ticket – no, that’s not Joe,” Gottfried said while he continued his paperwork on video, presumably seeing Frank Biden’s name on his documents.

Robert Gershman responded, “Yeah no, no. Although he was on TV this morning in Geneva.”

“He drives fast,” Gottfried shot back.

After another short chat about the cars the Russians drove to the meeting with Biden at the summit in Geneva, Gottfried asked if Officer Gray was attending the preceding.

The video shows the judge granting the motion to dismiss without Officer Gray present.

A search of Palm Beach County records also reveals Frank Biden already had over 15 traffic infractions in Palm Beach County. For instance, Frank Biden was previously caught driving his wife’s Range Rover on January 4, 2020, despite his license having being suspended in Florida on December 23, 2019.

https://www.breitbart.com/politics/2021/06/17/documents-show-joe-biden-brother-frank-caught-violating-florida-traffic-law-case-dismissed/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64926

File: 42a1b6a0d4ddf42⋯.png (139.84 KB,461x447,461:447,Clipboard.png)

File: 73b492e865c05d9⋯.png (12.73 KB,397x162,397:162,Clipboard.png)

Originally posted at >>>/qresearch/13928574 (180343ZJUN21) Notable: @Dan Scavino @Lin Wood @Russ_Warrior

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

There's our favorite # from Dan The Man!

Timestamp 9:35 pm 9+3+5 = 17

Also notice the Q in the shortened link that shows up on qagg for this tweet.

Dan Scavino🇺🇸🦅

@DanScavino

9:35 PM · Jun 17, 2021·Twitter for iPhone

https://twitter.com/DanScavino/status/1405700720456785920

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64927

File: 9ab9af7be53f00d⋯.jpeg (915.88 KB,2048x709,2048:709,Clipboard.jpeg)

File: 729ca44a8777f2a⋯.jpeg (1.27 MB,2048x1379,2048:1379,Clipboard.jpeg)

Originally posted at >>>/qresearch/13928582 (180344ZJUN21) Notable: “Silent Cry: The Darker Side of Trafficking” as we uncover the SATANIC RITUAL ABUSE happening not only under our very noses but in our OWN HOMES!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Join us for our fourth investigation in “Silent Cry: The Darker Side of Trafficking” as we uncover the SATANIC RITUAL ABUSE happening not only under our very noses but in our OWN HOMES!

https://www.skywatchtv.com/videos/silent4/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64928

File: 39adf20efa28026⋯.png (50.27 KB,471x410,471:410,Clipboard.png)

Originally posted at >>>/qresearch/13928611 (180351ZJUN21) Notable: @Dan Scavino @Lin Wood @Russ_Warrior

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://t.me/s/linwoodspeakstruth/3246

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64929

Originally posted at >>>/qresearch/13928620 (180352ZJUN21) Notable: #17628 (anon bun)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928538

Baker

#17628

>>64842 CLIMATE LOCKDOWN?: Globalist Elite Call For Extreme Measures To Tackle ‘Climate Change’

>>64843 Rep Jackson: When I was Physician to President Trump, the media relentlessly pushed a narrative that he needed a cognitive test.

>>64844 USPacificFleet: #USNavy's Carrier Strike Group One arrives in Hawaiian Islands Operating Area: #CVN70 #US3rdFleet #NavyReadiness

>>64845 What If the Media Had Told the Truth? Five MSM Lies for Which Trump Has Been Vindicated, and the Damage They Caused

>>64846 Watch this parent absolutely obliterate Critical Race Theory at an Illinois school board meeting:

>>64847 Massive 700-pound George Floyd statue erected at Newark City Hall

>>64848 Ghislaine Maxwell is awarded just $13.70 compensation after pursuing 'child sex abuse victim' who sued her then dropped case to join Jeffrey Epstein compensation fund instead

>>64849 JUST IN - Mayor Lori Lightfoot officially declared racism a "public health emergency" today. Chicago to divert nearly $10 million in COVID funds to address the issue.

>>64850 Louisiana to offer cash prizes, scholarships for vaccinations

>>64851 Entire Portland Police Riot Squad Quits En Masse, As DA Begins Criminal Investigations Into Officers’ Conduct

>>64852 Dr. Kelli Ward: Arizona Case on Democrat Ballot Harvesting Will Be Decided by Supreme Court this Month – “We Are Hoping for a Victory”

>>64853 PEDO BUN 17June 21

>>64854 IDF Chief of Staff Lt.-Gen. Aviv Kohavi will fly to #Washington on Sunday to discuss a range of regional challenges with his #US counterparts, more than a month after he was set to go to discuss #Iran and other challenges.

>>64855 Hunter Biden was "BLACKLISTED" from Chateau Marmont, a swanky hotel and celebrity hangout in Los Angeles.

>>64856 HSBC to announce sale of French retail banking operations on Friday

>>64857 Revolver's Darren Beattie called out Chris Cuomo for smearing him as a "dirtbag" in relation to Revolver News's groundbreaking story about the FBI's involvement in January 6.

>>64858 NKorea's Kim says must prepare for 'dialogue and confrontation' with US: KCNA

>>64859 Swiss police reportedly evacuate train in Daeniken city due to 'situation that could pose threat'

>>64860 'Dawson's Creek' writer Heidi Ferrer dies by suicide after contracting COVID

>>64861 Temp Firm Financed By Stacey Abrams Infiltrated All Levels Of GA Government, Including Governor’s Office

>>64862 Michigan SOS Candidate Kristina Karamo Delivers +7,500 Affidavits Demanding Forensic Audit to Dishonest Jocelyn Benson – BUT HER OFFICE WON’T ACCEPT THEM!

>>64863 Criminal Charges Filed Against US Marshals For Refusing To Disclose Vaccination Status In Court.

>>64864 USNG: "I don't think we can do this enough," Lt. Col. Roger Brooks said. "#Patriot21 prepares service members and civilian partners to respond to situations as in the case of a pandemic, earthquake, or overseas in a warfight.

>>64865 GOP lawmakers, led by ex-White House doc, ask Biden to take cognitive test

>>64866 Child-care employee at Stepping Stones Daycare arrested on multiple charges of sex abuse

#17628

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64930

File: c3c6d73b26da2e9⋯.png (57.6 KB,598x449,598:449,Clipboard.png)

Originally posted at >>>/qresearch/13928626 (180353ZJUN21) Notable: @Dan Scavino @Lin Wood @Russ_Warrior

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/Russ_Warrior/status/1405600056691073024

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64931

File: 9c3939600bc788d⋯.png (140.03 KB,836x797,836:797,Clipboard.png)

Originally posted at >>>/qresearch/13928639 (180356ZJUN21) Notable: "Buckle up, kids!" The NSA has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/huge-development-nsa-reveals-foia-response-fbi-involved-improper-surveillance-16000-americans/

>Buckle up, kids. The National Security Agency has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans, according to a letter that I received from the NSA this afternoon, and that suggests a political fight between the two agencies.

In picrel, the letter is signed by Linda M. Kiyosaki.

I've read books on real estate by Robert Kiyosaki.

Have tried to find a relation, but so far found nothing. Anons?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64932

File: f2dafd65b00e1f8⋯.png (265.58 KB,1447x756,1447:756,Clipboard.png)

Originally posted at >>>/qresearch/13928661 (180401ZJUN21) Notable: Literally shaking

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928649

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64933

File: d5b51deaa625bda⋯.png (328.54 KB,598x601,598:601,Clipboard.png)

File: 86b73eadc78fceb⋯.png (372.68 KB,598x606,299:303,Clipboard.png)

Originally posted at >>>/qresearch/13928676 (180404ZJUN21) Notable: Anti-Israel protests habbening

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Top Kek

https://twitter.com/KatieDaviscourt/status/1405696338365353985

https://twitter.com/JackPosobiec/status/1405731818591162373

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64934

Originally posted at >>>/qresearch/13928701 (180408ZJUN21) Notable: Literally shaking

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Indiana 3.8 quake today.

2.9 miles NE of Montezuma, IN

6.5 miles N of Mecca, IN

3.8 miles N of Arabia, IN

20 mile N of Markle Mill

"Markle Mill was the longest operating gristmill east of the Mississippi, and is rumored to have been part of the Underground Railroad, but all that remains of the original 1816 structure are the dam and parts of the foundation. The ghost girl who has been seen here is believed to have been someone who passed away while using the now-closed underground tunnels."

https://www.hauntedplaces.org/item/markle-mill-old-mill-dam/

Arabia, IN is nothing but woods surrounded by farmland. Wikipedia is the only thing I find on the 'net, and they show the following detailed history-

"Arabia was probably founded in the 1820s."

https://en.m.wikipedia.org/wiki/Arabia,_Indiana

Draw a line straight north 118 miles and you're at Hobart, IN

On the way you pass by towns named Tangier, Lebanon, and Hebron.

"The small town of Hobart became home to an infamous mobster tied to Al Capone, Michael Carrozzo. This small town, then only home to less than 6,000 Hoosiers, offered safe haven for the mobster and his mafia allies, away from the action of Chicago, and was rumored to draw many of his friends, including Capone himself."

https://www.onlyinyourstate.com/indiana/quiet-indiana-town-mafia-mecca/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64935

File: e6558895d143721⋯.png (690.39 KB,960x698,480:349,Clipboard.png)

Originally posted at >>>/qresearch/13928702 (180408ZJUN21) Notable: Do not try to shrink me, [Gyp]sy

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928650

We understand... It is never your fault.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64936

File: 6e9a4ff288ca666⋯.png (236.75 KB,611x685,611:685,Clipboard.png)

File: 589cc11face85de⋯.png (103 KB,704x617,704:617,Clipboard.png)

Originally posted at >>>/qresearch/13928733 (180412ZJUN21) Notable: HRC Body Double Chronological Comparison Chart

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.washingtonpost.com/lifestyle/style/is-hillary-clinton-getting-taller-or-is-the-internet-getting-dumber/2015/09/24/58af4dfa-5e33-11e5-9757-e49273f05f65_story.html

Style

Is Hillary Clinton getting taller? Or is the Internet getting dumber?

By Jay Mathews

I used to be the only person writing about this. But lately several publications, perhaps influenced by my work, have begun to seek the same data. You can find their height reports all over the Internet.

They all say that Clinton is 5 feet 7 inches tall.

This is thrilling news.

When the then-senator first ran for president in 2008, she was only 5-foot-5. I got this official height report from the Clinton campaign and published it in my 2008 Style story “Is Voting a Measured Decision?,” in which I expressed disappointment that Clinton had been defeated in the primaries by the 6-foot-1 Barack Obama.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64937

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13928746 (180414ZJUN21) Notable: Tucker takes aim at military's newest required reading

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Tucker takes aim at military's newest required reading

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64938

File: 0eb2585b2fb7633⋯.png (903.85 KB,1170x2532,195:422,Clipboard.png)

File: cce9a94660025cf⋯.png (162.55 KB,788x596,197:149,Clipboard.png)

Originally posted at >>>/qresearch/13928780 (180422ZJUN21) Notable: Do not try to shrink me, [Gyp]sy

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64935

The gypsies get bounced at the same times. Here’s their flag.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64939

File: ed7d762d14e7284⋯.png (1.53 MB,828x1000,207:250,Clipboard.png)

Originally posted at >>>/qresearch/13928804 (180426ZJUN21) Notable: SKY KING ACTIVE

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

I don't know why.

I felt like posting this image.

Wish we had the full skivvy on the "Sky King" incident instead of speculation.

I guess this is my own personal theory:

1. CABAL was using Ketron Island as a secret nuclear sub base

2. CABAL obtained the USS Richard B Russell and saved it from (but still reported it as) being "scrapped"

3. CABAL uses [DARK SUB] USS Richard B Russell to fire missile at POTUS AF1

4. CABAL failed in attack

5. POTUS/WHITE HATS come up with plan to obtain evidence for attack

6. White Hats construct identity "Richard BEEBO Russell" who steals an Alaskan Airlines [Q 400] airplane

7. White Hats fly plane around remotely and does fantastic barrel rolls

8. Crash Q400 into Ketron Island to mobilize an IMMEDIATE UNFETTERED INVESTIGATION on the island

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64940

Originally posted at >>>/qresearch/13928810 (180428ZJUN21) Notable: Do not try to shrink me, [Gyp]sy

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64938

>gypsies

What is it about that word's spelling that had me thinking it was more related to Egypt then?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64941

File: 84edee9ffe62cd1⋯.png (224.16 KB,598x695,598:695,Clipboard.png)

Originally posted at >>>/qresearch/13928867 (180437ZJUN21) Notable: New: An Army judge has been named the new chief of the Guantanamo war court judiciary!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

New: An Army judge has been named the new chief of the Guantanamo war court judiciary. Col. Lanny Acosta is presiding in the capital case against a Saudi man who is accused of plotting Al Qaeda's bombing of the USS Cole in 2000. The last chief is retiring.

https://twitter.com/carolrosenberg/status/1405608596189192199

>>>/qresearch/13928854

Sweet dreams anon

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64942

File: dec3d89bbb214c0⋯.png (103.67 KB,844x267,844:267,Clipboard.png)

File: bcf5031b1b2ee3c⋯.png (74.4 KB,853x232,853:232,Clipboard.png)

Originally posted at >>>/qresearch/13928909 (180444ZJUN21) Notable: Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928889Tranime Tantrum Is About Doge Baker Confirmed

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64943

Originally posted at >>>/qresearch/13928930 (180447ZJUN21) Notable: Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64942

Why?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64944

Originally posted at >>>/qresearch/13928933 (180448ZJUN21) Notable: Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64943

I tookit'sjob

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64945

File: 8083525ca4e5862⋯.png (316.08 KB,1028x445,1028:445,Clipboard.png)

Originally posted at >>>/qresearch/13929008 (180504ZJUN21) Notable: SKY KING ACTIVE

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928998

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64946

File: 7fef21ac3e9bf1b⋯.jpeg (995.83 KB,1534x2048,767:1024,Clipboard.jpeg)

File: b85984e339ec8fd⋯.png (346.99 KB,484x571,484:571,Clipboard.png)

File: 292c46ecd544326⋯.gif (1.26 MB,350x262,175:131,Clipboard.gif)

Originally posted at >>>/qresearch/13929026 (180507ZJUN21) Notable: Day of the slave 1776 [Learn].

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929013

Tip of the spear.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64947

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13929042 (180512ZJUN21) Notable: Day of the slave 1776 [Learn].

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64946

Day of the slave 1776

[Learn]. >>>/qresearch/13430951 (OP)

: SINKING-SHIPPING-WAR &: RISE OF THE SOVEREIGN.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64948

File: 3fc559c54650972⋯.jpg (47.95 KB,600x314,300:157,Clipboard.jpg)

Originally posted at >>>/qresearch/13929086 (180523ZJUN21) Notable: Chinese head of Intelligence defects to US with Intel on covid

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Gonna share, dont know if it was already shared

https://twitter.com/JackPosobiec/status/1405751369642889224

[body of text incoming]

Chinese-language anti-communist media and Twitter are abuzz this week with rumors that a vice minister of State Security, Dong Jingwei (董经纬) defected in mid-February, flying from Hong Kong to the United States with his daughter, Dong Yang.

Dong is, or was, a longtime official in China’s Ministry of State Security (MSS), also known as the Guoanbu. His publicly available background indicates that he was responsible for the Ministry’s counterintelligence efforts in China, i.e., spy-catching, since being promoted to vice minister in April 2018. If the stories are true, Dong would be the highest-level defector in the history of the People’s Republic of China.

RedState’s sources confirmed that the defector is, in fact, Dong, that he was in charge of counterintelligence efforts in China, and that he flew to the United States in mid-February, allegedly to visit his daughter at a university in California. When Dong landed in California he contacted DIA officials and told them about his plans to defect and the information he’d brought with him. Dong then “hid in plain sight” for about two weeks before disappearing into DIA custody.

According to Spy Talk, Dong’s name came up during the Sino-American Summit held in Alaska in March 2021: this is probably why the lab leak theory was allowed to be talked about and why China is threatening war and is doing sorties into Taiwanese airspace

Their cover is being blown

Hundreds of Chinese nationals are the subject of a federal probe after law enforcement officials flagged their travel at the start of the COVID-19 pandemic. The Chinese nationals returned to the United States earlier than expected in January 2020, often having modified their travel plans.

The episode is recounted in an internal report that circulated among various national security and law enforcement agencies on June 3. That report surmises that the Chinese students returned to the United States earlier than expected in order to avoid future travel restrictions caused by the COVID-19 pandemic.

“The team examined 58,000 inbound Chinese F/J visa holders in the [Passenger Name Record] database and identified 396 individuals whose return travel was [scheduled] after January 2020 but had returned in January 2020,” the report reads.

In addition, Dong has provided DIA with the following information:

Early pathogenic studies of the virus we now know as SARS-CoV-2

Models of predicted COVID-19 spread and damage to the US and the world

Financial records detailing which exact organizations and governments funded the research on SARS-CoV-2 and other biological warfare research

Names of US citizens who provide intel to China

Names of Chinese spies working in the US or attending US universities

Financial records showing US businessmen and public officials who’ve received money from the Chinese government

Details of meetings US government officials had (perhaps unwittingly) with Chinese spies and members of Russia’s SVR

How the Chinese government gained access to a CIA communications system, leading to the death of dozens of Chinese people who were working with the CIA

Dong also has provided DIA with copies of the contents of the hard drive on Hunter Biden’s laptop, showing the information the Chinese government has about Hunter’s pornography problem and about his (and Joe’s) business dealings with Chinese entities. Some of the files on Dong has provided shine a light on just how it was that the sale of Henniges Automotive (and their stealth technology) to Chinese military manufacturer AVIC Auto was approved.

Again, according to sources, Dong told DIA debriefers that at least a third of Chinese students attending US universities are PLA assets or part of the Thousand Talents Plan and that many of the students are here under pseudonyms. One reason for using pseudonyms is that many of these students are the children of high-ranking military and party leaders.

As we initially reported, DIA has high confidence in the veracity of Dong’s claims. The fact that since our original report, which was pooh-poohed by Langley apologists, the New York Times published a rare interview with Dr. Shi Zhengli (the WIV “Bat Woman”), ABC News has started an “investigation” into COVID-19 origins, and now the actual name of the defector has been published in an anti-Trump, CIA-friendly blog, demonstrates what sources told RedState today: “This defector has the rest of the intelligence community and the LEO community scared sh**less.”

tl;dr - can we nuke china now?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64949

File: 8b5f130579b990d⋯.png (13.45 KB,891x132,27:4,Clipboard.png)

Originally posted at >>>/qresearch/13929087 (180523ZJUN21) Notable: 時間です, it is time

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929082

Shit's going down tonight on one of 8kuns many non-QR ghost towns.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64950

File: 0f203c59c7907ce⋯.png (136.31 KB,659x423,659:423,Clipboard.png)

File: de5787ae829187f⋯.png (2.52 MB,1532x1070,766:535,Clipboard.png)

File: 93f25a5fa11a97c⋯.png (305.59 KB,656x834,328:417,Clipboard.png)

File: eb350e363c4e7e7⋯.png (563.69 KB,1100x553,1100:553,Clipboard.png)

File: 18096a9eee06937⋯.png (485.4 KB,835x470,167:94,Clipboard.png)

Originally posted at >>>/qresearch/13929110 (180527ZJUN21) Notable: Noteworthy Images

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64951

File: d005a02f922e87f⋯.png (372.96 KB,756x900,21:25,Clipboard.png)

File: 803c01e20676f40⋯.png (134.65 KB,844x974,422:487,Clipboard.png)

File: e2e1cb9a153a31f⋯.png (401.17 KB,821x1135,821:1135,Clipboard.png)

File: 99fb1211b778c21⋯.png (103.68 KB,659x793,659:793,Clipboard.png)

File: 12cf07718ac8ced⋯.png (1.9 MB,1514x1082,757:541,Clipboard.png)

Originally posted at >>>/qresearch/13929117 (180528ZJUN21) Notable: Noteworthy Images

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64952

File: 45ad1ecaaf24cca⋯.png (516.53 KB,686x1100,343:550,Clipboard.png)

File: 25818561532a163⋯.png (134.06 KB,652x477,652:477,Clipboard.png)

File: 41b298bcbc33b22⋯.png (523.48 KB,678x1100,339:550,Clipboard.png)

File: 7ddb034f1664cce⋯.png (437.4 KB,657x542,657:542,Clipboard.png)

File: f9b1e5b39e5dc7f⋯.png (533.83 KB,704x1100,16:25,Clipboard.png)

Originally posted at >>>/qresearch/13929133 (180531ZJUN21) Notable: Noteworthy Images

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64953

File: ffa0aff669ee1eb⋯.png (176.49 KB,1169x667,1169:667,Clipboard.png)

Originally posted at >>>/qresearch/13929182 (180541ZJUN21) Notable: IRS Denies Tax Exemption to Christian Group, Associates Bible With GOP

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

IRS Denies Tax Exemption to Christian Group, Associates Bible With GOP

A top Internal Revenue Service official told a Christian group that “Bible teachings are typically affiliated” with the Republican Party as a rationale for denying its application for tax-exempt status. 

The Texas-based Christians Engaged filed an appeal on Wednesday to the IRS’ denial, objecting to the tax agency’s assertion that it is partisan. 

In a May 18 denial letter, IRS Exempt Organizations Director Stephen A. Martin said Christians Engaged is involved in “prohibited political campaign intervention” and “operate[s] for a substantial non-exempt private purpose and for the private interests of the [Republican Party].”

A “legend” at the top of the letter shows nine letters of the alphabet being used as shorthand to represent something. In this letter’s example, oddly, “D” represented “Republican.” 

“Specifically, you educate Christians on what the Bible says in areas where they can be instrumental, including the areas of sanctity of life, the definition of marriage, biblical justice, freedom of speech, defense, and borders and immigration, U.S. and Israel relations,” Martin wrote. “The Bible teachings are typically affiliated with the D party and candidates. This disqualifies you from exemption under lRS Section 50I(c)(3).” 

Christians Engaged first applied for tax-exempt status in late 2019. First Liberty Institute, a religious freedom public interest law firm, is representing the Christian group in its appeal. 

“We just want to encourage more people to vote and participate in the political process,” Christians Engaged President Bunni Pounds said in a statement. “How can anyone be against that?”

The IRS’ characterization of the Bible might be inconsistent with that of Democratic President Joe Biden, said Lea Patterson, counsel for First Liberty Institute. 

“The IRS states in an official letter that Biblical values are exclusively Republican. That might be news to President Biden, who is often described as basing his political ideology on his religious beliefs,” Patterson said in a statement. 

Patterson appeared to make a vague reference to the tax-exempt unit that was at the center of the IRS targeting scandal during the Obama administration. The ruling also comes amid Biden’s push for an $80 billion expansion of the IRS over 10 years, and the latter could be complicated if the tax agency appears to be more politicized. 

“Only a politicized IRS could see Americans who pray for their nation, vote in every election, and work to engage others in the political process as a threat,” Patterson said. “The IRS violated its own regulations in denying tax-exempt status because Christians Engaged teaches biblical values.”

In its administrative appeal, Patterson contends the IRS made three legal errors: 

By finding that Christians Engaged does not meet the operational test, Director Martin errs in three ways: 1) he invents a nonexistent requirement that exempt organizations be neutral on public policy issues; 2) he incorrectly concludes that Christians Engaged primarily serves private, nonexempt purposes, rather than public, exempt purposes because he thinks its beliefs overlap with the Republican Party’s policy positions; and 3) he violates the First Amendment’s Free Speech, and Free Exercise, and Establishment clauses by engaging in both viewpoint discrimination and religious discrimination.

https://www.dailysignal.com/2021/06/17/irs-denies-tax-exemption-to-christian-group-associates-bible-with-gop/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64954

File: debe0b84604be37⋯.png (4.48 MB,3600x2700,4:3,Clipboard.png)

Originally posted at >>>/qresearch/13929192 (180543ZJUN21) Notable: RE: The 246th anniversary of Bunker Hill

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13928400 lb

>>>/qresearch/13924845 pb (#17626)

The 246th anniversary of Bunker Hill was already noted by these 2 anons, but here's a 3rd take cuz the coincidences seemed worth mentioning.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64955

Originally posted at >>>/qresearch/13929223 (180551ZJUN21) Notable: Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929221

it's a team who target people.

there is too much content for it to be a person.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64956

Originally posted at >>>/qresearch/13929232 (180553ZJUN21) Notable: #17631

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NOTABLES Are NOT Endorsements

Final

#17631

>>64939, >>64945 SKY KING ACTIVE

>>64946, >>64947 Day of the slave 1776 [Learn].

>>64922, >>64932, >>64934 Literally shaking

>>64923 RE: MAGNETIZING THE MASSES

>>64924 Chinese government now admits damage to fuel rods at the Taishan nuclear plant but said the problem is “common”

>>64925 Joe Biden’s Brother Frank Caught Violating Florida Traffic Law, Case Dismissed Due to Police Officer Out for ‘Training’

>>64927 “Silent Cry: The Darker Side of Trafficking” as we uncover the SATANIC RITUAL ABUSE happening not only under our very noses but in our OWN HOMES!

>>64926 @Dan Scavino >>64928 @Lin Wood >>64930 @Russ_Warrior

>>64931 "Buckle up, kids!" The NSA has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans

>>64933 Anti-Israel protests habbening

>>64936 HRC Body Double Chronological Comparison Chart

>>64937 Tucker takes aim at military's newest required reading

>>64935, >>64938, >>64940 Do not try to shrink me, [Gyp]sy

>>64941 New: An Army judge has been named the new chief of the Guantanamo war court judiciary!

>>64948 Chinese head of Intelligence defects to US with Intel on covid

>>64949 時間です, it is time

>>64950, >>64951, >>64952 Noteworthy Images

>>64953 IRS Denies Tax Exemption to Christian Group, Associates Bible With GOP

>>64954 RE: The 246th anniversary of Bunker Hill

>>64942, >>64943, >>64944, >>64955 Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

#17631

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64957

File: 7cc5964e71eaba7⋯.png (501.89 KB,744x675,248:225,Clipboard.png)

Originally posted at >>>/qresearch/13929325 (180619ZJUN21) Notable: HUUUUGE. Chinese defector held at DIA is fount of intel

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

THIS IS HUUUUGE. Chinese defector held at DIA is fount of intel

Dong has provided DIA with the following information:

Early pathogenic studies of the virus we now know as SARS-CoV-2

Models of predicted COVID-19 spread and damage to the US and the world

Financial records detailing which exact organizations and governments funded the research on SARS-CoV-2 and other biological warfare research

Names of US citizens who provide intel to China

Names of Chinese spies working in the US or attending US universities

Financial records showing US businessmen and public officials who’ve received money from the Chinese government

Details of meetings US government officials had (perhaps unwittingly) with Chinese spies and members of Russia’s SVR

How the Chinese government gained access to a CIA communications system, leading to the death of dozens of Chinese people who were working with the CIA

Dong also has provided DIA with copies of the contents of the hard drive on Hunter Biden’s laptop, showing the information the Chinese government has about Hunter’s pornography problem and about his (and Joe’s) business dealings with Chinese entities. Some of the files on Dong has provided shine a light on just how it was that the sale of Henniges Automotive (and their stealth technology) to Chinese military manufacturer AVIC Auto was approved.

https://redstate.com/jenvanlaar/2021/06/17/breaking-chinese-defector-confirmed-as-top-counterintelligence-official-n398374

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64958

File: a6c4d88b2975c16⋯.png (165.35 KB,565x416,565:416,Clipboard.png)

File: da2402332ffea5b⋯.png (160.44 KB,606x340,303:170,Clipboard.png)

Originally posted at >>>/qresearch/13929332 (180622ZJUN21) Notable: DIG INTO MUSIC AND THE CONNECTIONS TO THE CULT - POSTED OR ARCHIVE

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929260

TYB

----------—-

Strong recommendation to watch this video by ipot (take a small pot, but you will not need one) i did and it helped, Bitchute link only.

-----------------------–

IPOT (IN PURSUIT OF TRUTH AKA SIR PATRICK MACK) IS BACK WITH A 2 HOURS DIG INTO MUSIC AND THE CONNECTIONS TO THE CULT - POSTED FOR ARCHIVE.

Summary: Just finished watching this first part of ipots dig, It is truly amazing, and loads of new stuff to research. definitely worth a watch when you are alone and cannot be disturbed. just wow!!!

--------------—

Note: Great researcher and decoder, video content producer and all round great anon. pleased he is back in the groove !!!

===========

POP (SEX, SATAN, AND BABYLON'S BOULE) - EPISODE I (BEGUILING BEGINNINGS) - IPOT PRESENTS - 6.17.21

https://www.bitchute.com/video/XT2R663ZlPQ5/

=======

Kaep/Kneeling/Masonic 3rd Degreehttps://hiddeninthecrag.com/2017/09/29/september-23rd-masonic-ritual-and-crk/

Sports/Masonshttps://mindcontrolblackassassins.com/2014/09/18/lift-the-veil-of-satan-ray-rice-false-flags-nfl-illuminati/

Klein/Sam Cooke

https://medium.com/@injudiciouslex/allen-klein-sam-cookes-intestacy-d6ded2b27502

Barry Chamish/Illuminatihttps://freemasonrywatch.org/polaropposite.html

Otis Reddinghttps://madison.com/wsj/news/local/doug_moe/doug-moe-45-years-later-questions-still-remain-over-otis-reddings-plane-crash/article_c4101fa0-4236-11e2-b870-0019bb2963f4.html

HL Hunthttps://gaylenixjackson.com/jfk-assassination/top-10-questionable-actions-by-h-l-hunt-and-the-jfk-assassination/

BR Taylor Youtubehttps://www.youtube.com/channel/UC6Ic7_8H0JGdrDhpQWuvfBQ

Atlantean Gardens/Robert

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64959

Originally posted at >>>/qresearch/13929361 (180638ZJUN21) Notable: Something is in the food, water and air that's holding everyone in a trance

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929314

These fucking retards won't even suggest it. Sorry to hear that. I know a man in his 80s who was scared to death to go outside for an entire year. Him and his wife did the whole grocery delivery thing wouldn't open his door he was so terrified. He was so excited to get the vax, to rejoin society and a week later he has the worst pneumonia possible and died in a hospital bed. He was joking on his deathbed, 'Well I should have been going outside the whole time if it was gonna get me'…… Dude you're the one who put it in your arm!!! No words from family, no one would even consider it was the vax….

Something is in the food supply and water that's holding everyone in a trance. It can't just be the mockingbird media, something is wrong with these people in their brains.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64960

Originally posted at >>>/qresearch/13929411 (180654ZJUN21) Notable: Witnessed

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929397

Yep. Pretty much.

>>>/qresearch/13929395

This.

Democracy was for retards the whole time.

How do you destroy a Democracy? You retard the citizens and pit them against each other with emotional bait or tribal appeals and then keep raising taxes and inflating their currency to the point where they don't even have time to think about how retarded everything really is so that you're able to do something about it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64961

File: c7cdc563174c6f0⋯.png (250.63 KB,504x646,252:323,Clipboard.png)

Originally posted at >>>/qresearch/13929433 (180659ZJUN21) Notable: Witnessed

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64960

dubs chek'd

they call it the slow burn or the frog in the boiling pot

They know the public have short memories and ever shorter attention spans, probably why they have now speeded up, cos of a real threat to their power.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64962

File: e593bc8bdd6acf7⋯.png (300.31 KB,514x652,257:326,Clipboard.png)

File: 8f3d733655e293e⋯.png (311.6 KB,493x351,493:351,Clipboard.png)

File: a323490b0895aaf⋯.png (460.45 KB,606x678,101:113,Clipboard.png)

File: 72a178e2b328026⋯.png (372.6 KB,606x452,303:226,Clipboard.png)

Originally posted at >>>/qresearch/13929455 (180709ZJUN21) Notable: Witnessed

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64960

>>>/qresearch/13929444

>>64961

TRIPS CHEK'ED PROCEEDED BY DUBS AND DUBS-THE SIGNS ARE GOOD

you know what to do, share some hopium,

we need some wins, before things get worse, which they will, we are only on the 4th tier level boss, those you can see,

1) Top will be the elite families not known, (Denmark, royalty)

2) The Holy See (pope)

3) Banksters B.I.S (Bank of international settlements, Blackrock, Vanguard, state street) Umbrella corporations.

4) Big Pharma ←we are here

LETS HOPE WE CAN STOP IT FROM HABBENING

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64963

File: 0b8bdd86e90312f⋯.png (914.68 KB,1628x722,814:361,Clipboard.png)

File: d53183108e1d037⋯.png (106.73 KB,555x382,555:382,Clipboard.png)

Originally posted at >>>/qresearch/13929525 (180735ZJUN21) Notable: Qclockwork?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lara: "Well, we'll wait what to see what's on the 'Horizon' on a lot of fronts…"

https://youtu.be/g5vImR2GFjw?t=1376

New platform coming.

Be ready.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64964

File: 1d353819dbbbc48⋯.png (229.29 KB,535x679,535:679,Clipboard.png)

Originally posted at >>>/qresearch/13929535 (180740ZJUN21) Notable: Biden gave Vladimir Putin A pair of Randolph Aviator Sunglasses, in the Concord style

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

For his first meeting with Vladimir Putin in Geneva this week, Joe Biden gave his Russian counterpart a pair of American-made sunglasses in the US leader's signature aviator style

A pair of Randolph Aviator Sunglasses, in the Concord style

https://twitter.com/AFP/status/1405731183527219205

"Concord"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64965

File: f03c266bd55f9d8⋯.png (266.83 KB,747x825,249:275,Clipboard.png)

Originally posted at >>>/qresearch/13929546 (180747ZJUN21) Notable: Qclockwork?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64963

Q told us when 3 years ago.

Happy Father's Day.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64966

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13929556 (180752ZJUN21) Notable: Live Bats in Wuhan Lab & “Intense Clashes” Between China & France

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Live Bats in Wuhan Lab video - Full 11 minute video with English subtitles.

Bombshell Evidence: Live Bats in Wuhan Lab & “Intense Clashes” Between China & France

Inconvenient Truths by Jennifer Zeng

18 June 2021

Today I will first of all show you a bombshell video, which shows that the P4 lab in Wuhan did keep live bats in it. Sky News showed a little bit of it several days ago. I found the entire, 11 minute video and translated it into English. So this is the exclusive world premiere of it.

After we watch the video, I will talk about my takeaways of it, and what we should do based on what this video tells us. I hope you can also share your thoughts about this video in the live chat area, or leave us some comments if you are watching after the live stream.

https://www.youtube.com/watch?v=k3OxEmAkTpc

http://zmkxj.cas.cn/zpzs/whfy/201710/t20171025_4532133.html

https://archive.is/QuIMJ

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64967

Originally posted at >>>/qresearch/13929628 (180828ZJUN21) Notable: Recap of last weeks covert wins

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

This weeks WINS, every week the list is getting longer, buckle up! Week, June 16, 2021:

1. President Trump is holding rallies again! The first one will be Saturday, June 26th, in Cleveland. He will be throwing his support behind former White House aide Max Miller who is seeking to primary RINO Congressman Anthony Gonzalez. Gonzalez was one of ten GOP House members who voted for impeachment in January.

2. President Trump will join Texas Governor Greg Abbott on an official visit to the Southern Border June 30th. He hopes his visit will “shine a spotlight on these crimes against our Nation – and show the incredible people of ICE and Border Patrol that they have our unshakeable support.”

3. The truth continues to come out about January 6th. Senator Ron Johnson (R-WI) and his staff have reviewed surveillance footage and found 38% of the approximately 800 people who entered the Capitol walked peacefully through an opened doorway in front of five officers. Senator Johnson is pushing to interview those officers.

4. Rep. Paul Gosar (R-AZ) grilled FBI Director Wray about January 6th and entered the Revolver News article into the record with unanimous consent. This article lays out the case that federal officials infiltrated and incited January 6th protests.

5. Congressman Matt Gaetz (R-FL) called on FBI Director Wray to fully disclose the role and involvement of FBI operatives on January 6th.

6. Brave people continue to expose MSM corruption. During a live segment, Fox reporter Ivory Hecker accused Fox News of censoring her. She had secretly recorded her bosses at Fox directing her to squelch her stories, including one about the effectiveness of HCQ in treating COVID-19. In an interview with Project Veritas, she accused Fox of caring more about their corporate sponsors than about telling people the truth.

7. A Fulton County, GA, election official admitted that ballot drop box transfer forms are missing for almost 19,000 absentee ballots. There is no record of how these ballots got from point A to point B. Fulton is now the fourth county in Georgia under investigation for failing to produce chain of custody documentation.

8. The Biden administration announced an investigation into NIH grants, including the funding Dr. Fauci approved for the Wuhan lab.

9. Arizona Governor Doug Ducey issued an Executive Order that protects the rights of public college and university students. Under the EO, students cannot be mandated to get the jab, show a “vaccine passport,” wear a mask or be tested for COVID-19 in order to attend classes.

10. A Florida appeals court has ruled that bodily autonomy is a fundamental right and that all mask mandates, past and present, are unconstitutional. According to this ruling, any mask mandate targeting the unvaccinated would also violate the Constitution. This ruling is expected to reverberate throughout the country.

11. Mike Pompeo launched a political action committee called Champion American Values PAC to help conservatives win in 2022. His goal is to elect the most conservative electable candidate at all levels, “whether it’s school board, city council, or a United States Senate seat.”

12. Less than a third of voters believe Biden’s claim that global warming is America’s “greatest threat,” and few are willing to pay more taxes in order to fight it.

13. A federal judge has blocked Biden’s race-based loan forgiveness program that excluded white farmers. The judge cited a previous court ruling that stated “government policies that classify people by race are presumptively invalid.”

14. Comedian Jon Stewart went on Colbert’s “Late Show” Monday night and used his entire time to insist that COVID-19 originated in the Wuhan lab and to mock claims that it originated naturally.

15. The best news is that we are invited to “approach God’s throne of grace with confidence, so that we may receive mercy and find grace to help us in our time of need.” Hebrews 4:16

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64968

File: e1e01e9ea88ca28⋯.png (402.95 KB,1920x1080,16:9,Clipboard.png)

Originally posted at >>>/qresearch/13929658 (180843ZJUN21) Notable: (?) Newsbot self-doxxes + an explanation why this is of importance,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929650

https://twitter.com/BrebDaily/status/1405473568096358413?s=19

Mike Pompeo's response

Mike Pompeo

@mikepompeo

·

7h

Never give an inch. Period.

https://twitter.com/mikepompeo/status/1405690517816496140

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64969

Originally posted at >>>/qresearch/13929690 (180904ZJUN21) Notable: More about Richard BEEBO Russell

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64939 - Richard BEEBO Russell (previous notable)

Found some other links

The SoundCloud Counting Mixdown is kind of interesting – numbers listed below

Beebo Russell – LinkedIn

Operations Agent for Horizon Air

Sumner, Washington, United States

https://www.linkedin.com/in/beebo-russell-544730158/

SoundCloud

GSA Interview

Airplane Interior Ambience

EdMurrowInterview

>Counting Mixdown – 26 10 5381 749

https://soundcloud.com/beebo-russell

PMC5381749 ?

Ordered Mullite Nanowhisker Array

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5381749/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64970

Originally posted at >>>/qresearch/13929726 (180918ZJUN21) Notable: Predictive programming? Large swarts of the American Watersupply is a security disaster waiting to happen.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.nbcnews.com/tech/security/50000-security-disasters-waiting-happen-problem-americas-water-supplie-rcna1206

SECURITY

50,000 security disasters waiting to happen: The problem of America's water supplies

"If you could imagine a community center run by two old guys who are plumbers, that's your average water plant," one cybersecurity consultant said.

WATCH THE WATER….literally…while anons keep trying to decode…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64971

File: 7e64a18f45b675a⋯.png (2.06 MB,1100x1498,550:749,Clipboard.png)

File: 70aa17ecfe0e563⋯.png (1.21 MB,1100x1353,100:123,Clipboard.png)

Originally posted at >>>/qresearch/13929807 (181005ZJUN21) Notable: Voice of Reason: Greenwich parents protest child-masking, 'critical race theory' & the school curriculum.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Greenwich parents protest masks, critical race theory, school curriculum : 'Hear what we have to say'

GREENWICH — Many parents upset with the school district for a variety of reasons — including its alleged teaching of critical race theory and its enforcement of a state COVID-19 requirement that students continue to wear masks — arrived at Central Middle School on Thursday evening as police and security stood nearby ahead of a meeting of the Board of Education.

“The goal for today is, one, we want to get the language and the highly sexualized content out of the curriculum,” said Jackie Homan, a leader of a group called the Greenwich Patriots that protested on those issues at Town Hall earlier this week. “There’s no reason for unapproved items to be given to our children. It should go through the proper process. … Second, we want some transparency around the curriculum. We want the chance to opt out of things that we deem too offensive.”

https://www.greenwichtime.com/news/article/Greenwich-parents-protest-masks-critical-race-16256368.php

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64972

File: c0e1f38aef59563⋯.jpg (49.89 KB,755x422,755:422,Clipboard.jpg)

File: 2a574f8819b65b4⋯.jpg (66.07 KB,1240x535,248:107,Clipboard.jpg)

File: 925e648cb5edbe0⋯.jpg (43.46 KB,377x507,29:39,Clipboard.jpg)

Originally posted at >>>/qresearch/13929848 (181048ZJUN21) Notable: The 'maybe' line: US-produced make-up sold in Canada, found high level of a marker for toxic PFAS substances.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The "No PFAS in Cosmetics Act" is scheduled to be introduced in the U.S. House and Senate on Tuesday, following the release of a new study that found high levels of a marker for toxic PFAS substances in 52% of 231 makeup products purchased in the United States and Canada.

Some of the highest levels were found in foundations (63%), waterproof mascara (82%) and long-lasting lipstick (62%), according to the study published Tuesday in the journal Environmental Science & Technology Letters.

In addition, the study found some 88% of the tested products failed to disclose on their labels any ingredients that would explain those chemical markers, even though that is a requirement of the U.S. Food and Drug Administration.

"It's a little shocking and hopefully a wake-up call for the cosmetics industry in terms of how widespread the PFAS contamination is across types of makeup products," said David Andrews, a senior scientist for the Environmental Working Group, or EWG, a consumer organization that maintains a database on personal care products which contain toxins.

"The most common PFAS is polytetrafluoroethylene, the ingredient most commonly known as Teflon, or the coating on pans. But all in all, we have identified 13 different PFAS chemicals in more than 600 products from 80 brands," said Andrews, who was not involved in the study.

The bill will be introduced in the U.S. Senate on Tuesday by Republican Sen. Susan Collins of Maine and Democratic Sen. Richard Blumenthal of Connecticut and in the House by Democratic Rep. Debbie Dingell of Michigan.

"Americans should be able to trust that the products they are applying to their hair or skin are safe. To help protect people from further exposure to PFAS, our bill would require the FDA to ban the addition of PFAS to cosmetics products," said Collins in a statement.

"Per- and polyfluoroalkyl substances (PFAS) are a class of man-made chemicals, which includes PFOA, PFOS, and GenX. These chemicals can bioaccumulate in bodies over time and have been linked to cancer, thyroid disease, liver damage, decreased fertility, and hormone disruption," the statement said.

more:

https://www.ctvnews.ca/health/makeup-sold-in-canada-u-s-may-contain-potentially-toxic-chemicals-called-pfas-study-1.5470803

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64973

File: b017650308278e2⋯.png (20.73 KB,459x281,459:281,Clipboard.png)

Originally posted at >>>/qresearch/13929857 (181055ZJUN21) Notable: Gen. Flynn calls Georgian citizens to demand a resignation of their Senator

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

@RealGenFlynn, [18.06.21 06:53]

Every citizen from the great state of Georgia should demand that Governor Kemp resign immediately and the Georgia state legislature should call for a full forensic audit of their elections as well as an investigation by the State’s AG of the GOV and all his actions surrounding election fraud. This is so outrageous…the nation’s presidential election was stolen and every citizen (Republican or Democrat) knows it and all those millions of votes have been disenfranchised!!! The American people are tired of the corruption 🙏🏻🇺🇸

https://t.me/RealGenFlynn/200

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64974

File: bda50225788859f⋯.png (523.86 KB,654x1065,218:355,Clipboard.png)

Originally posted at >>>/qresearch/13929861 (181056ZJUN21) Notable: CDC wiping Vaccine Deaths from their databases?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://gab.com/Annaeva/posts/106423397354840645

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64975

Originally posted at >>>/qresearch/13929940 (181126ZJUN21) Notable: 'fact-checkrs' got their facts wrong again: it's legal to name an unindicted co-conspirator.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://freedomfirstnetwork.com/2021/06/the-fact-checkers-get-it-wrong-again-its-not-illegal-to-name-an-unindicted-co-conspirator

The fact-checkers get it wrong again: It’s not illegal to name an unindicted co-conspirator

After Tucker Carlson’s bombshell story about the FBI’s involvement in organizing the violence at the Capitol Building on January 6th went viral, the Mainstream Media and Big Tech predictably “fact-checked” his story, “debunking” it with “legal experts” who claim that the reason the names of the unindicted co-conspirators are concealed is because it is illegal to release their names. The fact checkers should have checked their facts, because that is patently false.

Over the past few nights, Tucker Carlson has been citing a Revolver News story that is claiming the FBI was involved, whether directly or indirectly, in the planning, organizing and carrying out of the violence that occurred on January 6th. As is predictable, the Mainstream Media moved quickly to “debunk” this story.

The problem for them is that they might have moved too quickly and should have taken a little more time to check their facts. Although, at this point, do any of us think that the Mainstream Media and Big Tech actually care about the truth? No, the ends justify the means… and in this case, the ends is lambasting anyone who believes that Donald Trump won the 2020 Election and labeling us all as violent extremists.

Anyways, back to the story…

Twitter put out a “fact check” in regards to Tucker Carlson’s videos and Revolver News’ article: ..

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64976

Originally posted at >>>/qresearch/13929964 (181131ZJUN21) Notable: (?) Newsbot self-doxxes + an explanation why this is of importance,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13929774

in possibly the most revelatory self dox fuckup of the year, newsbot (who is now up to 56 posts this bread at 528) posted a full-screen screenshot rather than whatever picked-for-aggregators graphic he had in mind. thus revealing open tabs and his view of QR, including his You on the post he was in the midst of noting in the reply box with notepad++ nearby as if a baker, in a QR tab using Baker Tools (tm) ?

Implication being that newsbot is sock puppeting or dual boxing as the baker in order to shill the notables with their own posts.

immediately asks BV to remove

>>>/qresearch/13929770

then the baker tools "maintainer" shows up and starts a narrative about how it's really for lurkers (because nobody with Baker Tools in a screen shot would be baking, right?)

with cameo appearance by Baker Tools "originator" to add some legit

>>>/qresearch/13929800, >>>/qresearch/13929808

>>64968 Mike Pompeo's Response

the graphic in question

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64977

File: 067e8e8d704f84f⋯.png (312.99 KB,796x618,398:309,Clipboard.png)

Originally posted at >>>/qresearch/13929970 (181132ZJUN21) Notable: NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/huge-development-nsa-reveals-foia-response-fbi-involved-improper-surveillance-16000-americans/

HUGE DEVELOPMENT: NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

By Joe Hoft

Published June 17, 2021 at 8:45pm

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64978

Originally posted at >>>/qresearch/13930009 (181140ZJUN21) Notable: Corona insurance fraud? Judge orders insures to pay New Hampshire based hotel 100 million dollars in Corona damages.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The Manchester Union Leader has an article about 100 million dollar payout for an hotel ownership company based up an insurance settlement for 'damage' to the property.

Covid is said to have damaged the property.

the Insurance Company tried to deny the claim.

a judge ruled in favor of the claiment.

sounds like big news

https://www.unionleader.com/news/courts/judge-to-insurers-pay-100m-covid-19-claim-for-nh-hotel-operator/article_84161565-a088-5a0a-9b77-565bca92d875.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64979

File: 5c46663c9f21ee2⋯.png (643.71 KB,900x716,225:179,Clipboard.png)

Originally posted at >>>/qresearch/13930028 (181145ZJUN21) Notable: US Senate: ‘Establishment Covid-19 narrative is a lie’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.biznews.com/undictated/2021/06/14/covid-19-narrative-lie

US Senate: ‘Establishment Covid-19 narrative is a lie’

14th June 2021 by Nadya Swart

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64980

Originally posted at >>>/qresearch/13930062 (181154ZJUN21) Notable: >>13928470 #17630, >>13929232 #17631, #17632

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

#17632

>>64957 HUUUUGE. Chinese defector held at DIA is fount of intel

>>64958 DIG INTO MUSIC AND THE CONNECTIONS TO THE CULT - POSTED OR ARCHIVE

>>64959 Something is in the food, water and air that's holding everyone in a trance

>>64960, >>64961, >>64962 Witnessed

>>64963, >>64965 Qclockwork?

>>64964 Biden gave Vladimir Putin A pair of Randolph Aviator Sunglasses, in the Concord style

>>64966 Live Bats in Wuhan Lab & “Intense Clashes” Between China & France

Baker change

>>64967 Recap of last weeks covert wins

>>64968 (?) Newsbot self-doxxes + an explanation why this is of importance, >>64976

>>64969 More about Richard BEEBO Russell

>>64970 Predictive programming? Large swarts of the American Watersupply is a security disaster waiting to happen.

>>64971 Voice of Reason: Greenwich parents protest child-masking, 'critical race theory' & the school curriculum.

>>64972 The 'maybe' line: US-produced make-up sold in Canada, found high level of a marker for toxic PFAS substances.

>>64973 Gen. Flynn calls Georgian citizens to demand a resignation of their Senator

>>64974 CDC wiping Vaccine Deaths from their databases?

>>64975 'fact-checkrs' got their facts wrong again: it's legal to name an unindicted co-conspirator.

>>64977 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>64978 Corona insurance fraud? Judge orders insures to pay New Hampshire based hotel 100 million dollars in Corona damages.

>>64979 US Senate: ‘Establishment Covid-19 narrative is a lie’

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64981

File: e8e08f68037d4d6⋯.jpeg (407.47 KB,750x1080,25:36,Clipboard.jpeg)

Originally posted at >>>/qresearch/13930177 (181224ZJUN21) Notable: @Cernovich finds out California Democrats have a hotline to Twitter Thought Police?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Very troubling. I have asked @twitter for a meeting to explain this.

I hope they respond.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64982

Originally posted at >>>/qresearch/13930201 (181234ZJUN21) Notable: Reminder that while Newsbot self-doxxed, this doesn't mean BakerTools is comped.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13930194

i want to clear the record. this person in the image is NOT using BakerTools. They are using some other custom js. Bakertools has a bakertools menu in top right corner near [options].

The comments in the screenshot about bakertools maintainer discussions are all speculation that are unrelated.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64983

File: b3af5889532bd30⋯.png (367.22 KB,2128x1320,266:165,Clipboard.png)

Originally posted at >>>/qresearch/13930215 (181237ZJUN21) Notable: 2.54 Billion Vaccine Shots administered around the world

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

as of June 17:

2.54 BILLION SHOTS administered worldwide

21.1% of the world has received at least one dose

https://ourworldindata.org/covid-vaccinations

https://www.aa.com.tr/en/latest-on-coronavirus-outbreak/over-254b-coronavirus-vaccine-shots-given-worldwide/2278317

Over 2.54 billion doses of coronavirus vaccines have been given worldwide so far, figures compiled by Our World in Data, a tracking website, showed on Friday.

China leads the global count with over 966.65 million jabs, followed by the US with 314.97 million.

India has administered 268.96 million shots, Brazil 84.1 million, the UK 72.89 million, Germany 64.76 million, France 46.26 million and Italy 44.43 million.

Turkey ranks 9th on the list with over 39.69 million doses given, followed by Mexico, Spain and Indonesia.

The country with the most doses administered by population is the United Arab Emirates, with 143.39 doses per 100 people.

Most COVID-19 vaccines are administered in two doses, so the number of shots given is not the same as the number of individuals fully vaccinated.

Since December 2019, the pandemic has claimed over 3.84 million lives in 192 countries and regions, with more than 177.5 million cases reported worldwide, according to the US-based Johns Hopkins University.

The US, India, and Brazil remain the worst-hit countries.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64984

File: 8c8b53932c31520⋯.png (559.2 KB,684x620,171:155,Clipboard.png)

Originally posted at >>>/qresearch/13930258 (181247ZJUN21) Notable: Two More Months: Maricopa County Audit Report 'expected in August'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

August. The damn audit report isn't expected until AUGUST.

There are days anon feels damn foolish for even trying.

https://www.theepochtimes.com/maricopa-county-audit-report-expected-in-august_3864225.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64985

Originally posted at >>>/qresearch/13930262 (181248ZJUN21) Notable: Former WH Physician called on President Biden to immediately undergo a cognitive test to prove he has 'sound mental capabilities'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dr. Ronny Jackson calls on Biden to immediately undergo cognitive test to assess 'mental impairment'

Dr. Ronny Jackson, the former White House physician, called on President Biden to immediately undergo a cognitive test so the commander-in-chief can prove to the American public sound mental capabilities.

"We can't sit on this any longer," Jackson told "Hannity" Thursday night, citing Biden's "embarrassing" performance overseas this week with world leaders.

"He's not physically or cognitively fit to be our president right now," Jackson added

https://www.foxnews.com/politics/dr-ronny-jackson-calls-on-biden-to-immediately-undergo-cognitive-test-to-assess-mental-impairment

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64986

Originally posted at >>>/qresearch/13930274 (181249ZJUN21) Notable: Michigan Senate Passes Legislation to Add Voter ID Requirements: ‘Overwhelmingly Popular’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Not sure if posted

Michigan Senate Passes Legislation to Add Voter ID Requirements: ‘Overwhelmingly Popular’

Michigan’s Republican-led Senate on June 16 passed several bills that, if signed into law, would implement more voter identification requirements for in-person voters and absentee voters, adding Michigan to a growing list of states pursuing more stringent election measures.

All Senate Republicans voted in favor of the three bills, while every Senate Democrat opposed them.

Current law stipulates that Michigan residents who don’t have photo identification when they vote in person can still cast their ballot if they sign an affidavit at their designated polling location. More than 11,000 individuals cast ballots this way during the Nov. 3 election, according to election officials.

https://www.theepochtimes.com/michigan-senate-passes-legislation-to-add-voter-id-requirements-overwhelmingly-popular_3861610.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64987

File: add5af5cd3f31ea⋯.mp4 (8.19 MB,540x540,1:1,Clipboard.mp4)

Originally posted at >>>/qresearch/13930290 (181254ZJUN21) Notable: Based Black Clinician gives strong rebuke of critical race theory at school meeting

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

WATCH: Illinois father gives STRONG rebuke of critical race theory at local school board meeting

father from Illinois took center stage at his local school board meeting to rail against critical race theory in a speech. He tells the crowd of parents despite growing up in a rough childhood, he as a black man still managed to find success.

It happened back on June 9th.

Father SLAMS critical race theory at an Illinois school board meeting: "How do I have two medical degrees if I’m sitting here oppressed?"

https://twitter.com/TPostMillennial/status/1405626871199375362

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64988

Originally posted at >>>/qresearch/13930293 (181254ZJUN21) Notable: New Congress Bills,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.congress.gov/search?pageSort=latestAction%3Adesc&q=%7B%22congress%22%3A%5B%22117%22%5D%2C%22source%22%3A%22all%22%2C%22chamber%22%3A%22Senate%22%7D

1. S.2138 — 117th Congress (2021-2022)

A bill to respond to international trafficking of Cuban medical professionals by the Government of Cuba, and for other purposes.

Sponsor: Sen. Menendez, Robert [D-NJ] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Judiciary

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on the Judiciary. (All Actions)

2. S.2137 — 117th Congress (2021-2022)

A bill to amend title 49, United States Code, to establish an Office of Rural Investment, to ensure that rural communities and regions are equitably represented in Federal decision-making for transportation policy, and for other purposes.

Sponsor: Sen. Durbin, Richard J. [D-IL] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Commerce, Science, and Transportation

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Commerce, Science, and Transportation. (All Actions)

3. S.2136 — 117th Congress (2021-2022)

A bill to amend the Public Health Service Act to provide for the implementation of curricula for training students, teachers, parents, and school and youth development personnel to understand, recognize, prevent, and respond to signs of human trafficking and exploitation in children and youth, and for other purposes.

Sponsor: Sen. Murkowski, Lisa [R-AK] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Health, Education, Labor, and Pensions

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions)

4. S.2135 — 117th Congress (2021-2022)

A bill to amend title 31, United States Code, to require the Chief Operating Officer of each agency to compile a list of unnecessary programs, and for other purposes.

Sponsor: Sen. Hassan, Margaret Wood [D-NH] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Homeland Security and Governmental Affairs

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Homeland Security and Governmental Affairs. (All Actions)

5. S.2134 — 117th Congress (2021-2022)

A bill to establish the Data Protection Agency.

Sponsor: Sen. Gillibrand, Kirsten E. [D-NY] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Commerce, Science, and Transportation

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Commerce, Science, and Transportation. (All Actions)

6. S.2133 — 117th Congress (2021-2022)

A bill to amend the Congressional Budget Act of 1974 to provide for studies and reports relating to the impact of legislation on spending on children, and for other purposes.

Sponsor: Sen. Van Hollen, Chris [D-MD] (Introduced 06/17/2021) Cosponsors: (2)

Committees: Senate - Budget

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on the Budget. (All Actions)

7. S.2132 — 117th Congress (2021-2022)

A bill to amend title 5, United States Code, to limit the use of taxpayer funded union time for employees of the Internal Revenue Service, and for other purposes.

Sponsor: Sen. Braun, Mike [R-IN] (Introduced 06/17/2021) Cosponsors: (5)

Committees: Senate - Finance

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Finance. (All Actions)

8. S.2131 — 117th Congress (2021-2022)

A bill to require a review of the effects of FHA mortgage insurance policies, practices, and products on small-dollar mortgage lending, and for other purposes.

Sponsor: Sen. Tester, Jon [D-MT] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Banking, Housing, and Urban Affairs

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64989

Originally posted at >>>/qresearch/13930297 (181255ZJUN21) Notable: New Congress Bills,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64988

9. S.2130 — 117th Congress (2021-2022)

A bill to modify the disposition of certain outer Continental Shelf revenues and to open Federal financial sharing to heighten opportunities for renewable energy, and for other purposes.

Sponsor: Sen. Whitehouse, Sheldon [D-RI] (Introduced 06/17/2021) Cosponsors: (9)

Committees: Senate - Energy and Natural Resources

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Energy and Natural Resources. (All Actions)

10. S.2129 — 117th Congress (2021-2022)

A bill to promote freedom of information and counter censorship and surveillance in North Korea, and for other purposes.

Sponsor: Sen. Portman, Rob [R-OH] (Introduced 06/17/2021) Cosponsors: (2)

Committees: Senate - Foreign Relations

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Foreign Relations. (All Actions)

11. S.2128 — 117th Congress (2021-2022)

A bill to ensure the humane treatment of pregnant women by reinstating the presumption of release and prohibiting shackling, restraining, and other inhumane treatment of pregnant detainees, and for other purposes.

Sponsor: Sen. Murray, Patty [D-WA] (Introduced 06/17/2021) Cosponsors: (18)

Committees: Senate - Judiciary

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on the Judiciary. (All Actions)

12. S.2127 — 117th Congress (2021-2022)

A bill to amend title 31, United States Code, to require that Federal children's programs be separately displayed and analyzed in the President's budget, and for other purposes.

Sponsor: Sen. Menendez, Robert [D-NJ] (Introduced 06/17/2021) Cosponsors: (2)

Committees: Senate - Budget

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on the Budget. (All Actions)

13. S.2126 — 117th Congress (2021-2022)

A bill to designate the Federal Office Building located at 308 W. 21st Street in Cheyenne, Wyoming, as the "Louisa Swain Federal Office Building".

Sponsor: Sen. Lummis, Cynthia M. [R-WY] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Environment and Public Works

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Environment and Public Works. (All Actions)

14. S.2125 — 117th Congress (2021-2022)

A bill to divert Federal funding away from supporting the presence of police in schools and toward evidence-based and trauma informed services that address the needs of marginalized students and improve academic outcomes, and for other purposes.

Sponsor: Sen. Murphy, Christopher [D-CT] (Introduced 06/17/2021) Cosponsors: (3)

Committees: Senate - Health, Education, Labor, and Pensions

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Health, Education, Labor, and Pensions. (All Actions)

15. S.2124 — 117th Congress (2021-2022)

A bill to prohibit the award of Federal Government contracts to inverted domestic corporations, and for other purposes.

Sponsor: Sen. Durbin, Richard J. [D-IL] (Introduced 06/17/2021) Cosponsors: (4)

Committees: Senate - Homeland Security and Governmental Affairs

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Homeland Security and Governmental Affairs. (All Actions)

16. S.2123 — 117th Congress (2021-2022)

A bill to establish the Federal Clearinghouse on Safety and Security Best Practices for Faith-Based Organizations and Houses of Worship, and for other purposes.

Sponsor: Sen. Portman, Rob [R-OH] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Homeland Security and Governmental Affairs

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Homeland Security and Governmental Affairs. (All Actions)

17. S.2122 — 117th Congress (2021-2022)

A bill to amend title 18, United States Code, to regulate the use of cell-site simulators, and for other purposes.

Sponsor: Sen. Wyden, Ron [D-OR] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Judiciary

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on the Judiciary. (All Actions)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64990

Originally posted at >>>/qresearch/13930311 (181300ZJUN21) Notable: New Congress Bills,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64989

18. S.2121 — 117th Congress (2021-2022)

A bill to develop best practice guidelines for the use of dogs in Federal courts, and for other purposes.

Sponsor: Sen. Cornyn, John [R-TX] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Judiciary

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on the Judiciary. (All Actions)

19. S.2120 — 117th Congress (2021-2022)

A bill to establish the United States-Israel Artificial Intelligence Center to improve artificial intelligence research and development cooperation.

Sponsor: Sen. Rubio, Marco [R-FL] (Introduced 06/17/2021) Cosponsors: (3)

Committees: Senate - Foreign Relations

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Foreign Relations. (All Actions)

20. S.2119 — 117th Congress (2021-2022)

A bill to provide for nonpreemption of measures by State and local governments to divest from entities that engage in certain boycott, divestment, or sanctions activities targeting Israel or persons doing business in Israel or Israeli-controlled territories, and for other purposes.

Sponsor: Sen. Rubio, Marco [R-FL] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Banking, Housing, and Urban Affairs

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Banking, Housing, and Urban Affairs. (All Actions)

21. S.2118 — 117th Congress (2021-2022)

A bill to amend the Internal Revenue Code of 1986 to provide tax incentives for increased investment in clean energy, and for other purposes.

Sponsor: Sen. Wyden, Ron [D-OR] (Introduced 06/17/2021) Cosponsors: (9)

Latest Action: Senate - 06/17/2021 Introduced in the Senate. Read the first time. Placed on Senate Legislative Calendar under Read the First Time. (All Actions)

22. S.2117 — 117th Congress (2021-2022)

A bill to amend the Help America Vote Act of 2002 to ensure that voters in elections for Federal office do not wait in long lines in order to vote.

Sponsor: Sen. Wyden, Ron [D-OR] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Rules and Administration

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Rules and Administration. (All Actions)

23. S.2116 — 117th Congress (2021-2022)

A bill to prevent mail, telemarketing, and internet fraud targeting seniors in the United States, to promote efforts to increase public awareness of the enormous impact that mail, telemarketing, and internet fraud have on seniors, to educate the public, seniors, their families, and their caregivers about how to identify and combat fraudulent activity, and for other purposes.

Sponsor: Sen. Gillibrand, Kirsten E. [D-NY] (Introduced 06/17/2021) Cosponsors: (1)

Committees: Senate - Commerce, Science, and Transportation

Latest Action: Senate - 06/17/2021 Read twice and referred to the Committee on Commerce, Science, and Transportation. (All Actions)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64991

File: cf01743df944e6a⋯.mp4 (6.07 MB,640x640,1:1,Clipboard.mp4)

Originally posted at >>>/qresearch/13930312 (181300ZJUN21) Notable: Why hasn't Federal Agent Ray Epps (Capitol Hill Riot instigator) been indicted?, Is it because of this?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Is Ray Epps a Fed? Why hasn’t this guy been indicted?

https://twitter.com/MillerStream/status/1405612420287004673

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64992

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13930377 (181311ZJUN21) Notable: Chucky 'Cheese Pizza' Schumer warns of Threat of 'Qanon' to 'Peace' in United States

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Schumer Warns Of "Threat Of QAnon" To Peace In The United States

12,196 views•Jun 16, 2021

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64993

File: 8f239b9269cc63a⋯.jpg (93.4 KB,828x890,414:445,Clipboard.jpg)

Originally posted at >>>/qresearch/13930393 (181314ZJUN21) Notable: Why hasn't Federal Agent Ray Epps (Capitol Hill Riot instigator) been indicted?, Is it because of this?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64991

They found the Boomer Feds Facebook.

He’s been running Ops at the capital since atleast 9/2012

https://twitter.com/BrebDaily/status/1405479415547514884

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64994

File: b0a1e9f866422c8⋯.jpeg (476.15 KB,750x1016,375:508,Clipboard.jpeg)

Originally posted at >>>/qresearch/13930425 (181320ZJUN21) Notable: Child Modelling Agencies: a deep swamp of systematic and horrific phsyical, mental and sexual abuse

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Time to start calling model agents out, so many ppl/kids being exploited sexually under the guise of “becoming famous” If we don’t speak up it will continue to happen because that is the only way to break the cycle @frenchpolicia @thysia_huisman @cornes_nicole @NBCNews #SpeakUp

(Virginia Guifree, Epstein/Maxwell victim)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64995

File: c0a3f1673399854⋯.jpg (296.33 KB,591x651,197:217,Clipboard.jpg)

Originally posted at >>>/qresearch/13930481 (181332ZJUN21) Notable: Israel says it's willing to transfer 1 million vaccines to Palestine, if Palestine is willing to return 1 million vaccines later

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

ABC News

https://twitter.com/ABC/status/1405864652941271046

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64996

File: 5aea4720fb76d99⋯.jpeg (205.18 KB,1241x864,1241:864,Clipboard.jpeg)

File: 83a74238daea1aa⋯.jpeg (231.08 KB,1241x1054,73:62,Clipboard.jpeg)

Originally posted at >>>/qresearch/13930489 (181333ZJUN21) Notable: North Carolina Senate just passed a bill banning private money from being used to administration elections

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/SwainForSenate/status/1405547193948262404?s=20

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64997

File: db9e578b250d25f⋯.jpg (296.33 KB,619x453,619:453,Clipboard.jpg)

Originally posted at >>>/qresearch/13930509 (181336ZJUN21) Notable: House Republicans Demand Answers After Biden Admin Lifts Iran Sanctions Without Consulting Congress

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

House Republicans Demand Answers After Biden Admin Lifts Iran Sanctions Without Consulting Congress

https://thefederalist.com/2021/06/18/house-republicans-demand-answers-after-biden-admin-lifts-iran-sanctions-without-consulting-congress/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64998

File: 72b65105d7f21ae⋯.jpg (296.33 KB,592x260,148:65,Clipboard.jpg)

Originally posted at >>>/qresearch/13930544 (181342ZJUN21) Notable: Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NEW - Positive PCR test results do not sufficiently prove that people infected with #SARSCoV2 can infect others with the coronavirus, new research that included 190k results from 160k people at the UDE Faculty of Medicine in Germany concludes.

https://twitter.com/disclosetv/status/1405882906304712706

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.64999

Originally posted at >>>/qresearch/13930553 (181344ZJUN21) Notable: Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64998

German Language link here; https://www.uni-due.de/2021-06-18-studie-aussagekraft-von-pcr-tests

If anyone wants to share with our frens in the German QR

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65000

Originally posted at >>>/qresearch/13930555 (181345ZJUN21) Notable: Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64998

https://www.uni-due.de/2021-06-18-studie-aussagekraft-von-pcr-tests

https://archive.is/O0uGd

https://www.journalofinfection.com/article/S0163-4453(21)00265-6/fulltext

https://archive.is/lcwd5

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65001

Originally posted at >>>/qresearch/13930560 (181346ZJUN21) Notable: CNN's Chris Cuomo dares 'the Internet' to call him a fact-denier.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Chris Cuomo should really have known not to provoke the internet like this.

https://www.infowars.com/posts/cnn-host-chris-cuomo-dares-the-internet-to-name-a-time-when-he-has-denied-facts-twitter-says-challenge-accepted/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65002

File: b72fbb45be4b2d2⋯.png (1.7 MB,1920x1080,16:9,Clipboard.png)

Originally posted at >>>/qresearch/13930597 (181352ZJUN21) Notable: Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65000

'''Around 190,000 PCR tests evaluated

Results alone unsuitable as a basis for pandemic measures'''

06/18/2021

In the renowned Journal of Infection *, researchers from the Medical Faculty of the UDE point out that the results of RT-PCR tests alone are insufficiently meaningful to justify measures to combat pandemics. According to their investigation, positive test results do not sufficiently prove that people infected with SARS-CoV-2 can infect other people with the coronavirus. Together with scientists from the University of Münster and the MVZ Labor Münster, they had previously evaluated around 190,000 results from more than 160,000 people.

The RT-PCR test technique is considered the gold standard when it comes to detecting an infection with the SARS-CoV-2 coronavirus. It can only be carried out in specialized facilities. During the pandemic, the results of corona tests using RT-PCR technology were and will be used to determine the number of nationwide new infections per 100,000 inhabitants (incidence).

This incidence value in turn forms an important basis for the federal and state governments to justify anti-corona measures, for example contact restrictions or curfews. However, the research teams from Essen and Münster question this based on their data analysis. "According to our study, a positive RT-PCR test alone is not sufficient proof that those tested can also transmit the coronavirus to other people," says first author Prof. Dr. Andreas Stang, Director of the Institute for Medical Informatics, Biometry and Epidemiology (IMIBE) at the Essen University Hospital. "The number of SARS-CoV-2 positive testers calculated at the end should therefore not be used as a basis for pandemic control measures such as quarantine, isolation or lockdown."

The authors therefore advise collecting or using data from other areas to assess the pandemic situation. "For example, reliable information on intensive care bed occupancy and mortality, i.e. the respective number of deaths in connection with COVID-19," suggests epidemiologist Prof. Stang, would be more suitable. In his area of ​​expertise, the consequences of epidemics on societies are examined.

The research team also talks about the possibility of improving the informative value of the RT-PCR value in future assessments of the pandemic situation by including the so-called cycle threshold value (Ct value). The number, also known as the threshold cycle value, can be used to make statements about the risk of infection by people who have tested positive. If the Ct value of those who tested positive is 25 or higher, it is currently assumed that they are no longer contagious because the viral load is too low. “On average, around 60% of those tested with COVID-19 symptoms were found to have such high CT values; In weeks 10 to 19 it was even 78% who were very probably no longer contagious, ”emphasizes Prof. Stang. "Querying the COVID-19 symptoms of those tested would also help,

* Original publication:

"The performance of the SARS-CoV-2 RT-PCR test as a tool for detecting SARS-CoV-2 infection in the population" https://doi.org/10.1016/j.jinf.2021.05.022

https://www.uni-due.de/2021-06-18-studie-aussagekraft-von-pcr-tests

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65003

File: 73af70a4bfccc08⋯.jpg (296.33 KB,844x757,844:757,Clipboard.jpg)

Originally posted at >>>/qresearch/13930598 (181352ZJUN21) Notable: Election Fraud: 2nd Atlanta official caught double scanning ballots

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

EXPLOSIVE DEVELOPMENT: Election Worker Ralph Jones Is Now Second Worker Caught Double-Counting Ballots at the State Farm Center on Election Night!

https://www.thegatewaypundit.com/2021/06/explosive-new-report-confirms-least-two-elections-officials-ruby-freeman-ralph-jones-caught-double-counting-ballots-state-farm-center-election-night/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65004

File: 38c7a4757dff6c4⋯.mp4 (5.75 MB,320x568,40:71,Clipboard.mp4)

Originally posted at >>>/qresearch/13930599 (181352ZJUN21) Notable: Reminder why PCR tests are untrustworthy to begin with

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64998

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65005

File: 66f46dba009aeee⋯.pdf (809.34 KB,Clipboard.pdf)

Originally posted at >>>/qresearch/13930608 (181354ZJUN21) Notable: Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>64998

pdf rip off google translate

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65006

File: f603be0b412b4ed⋯.png (121.11 KB,1212x743,1212:743,Clipboard.png)

Originally posted at >>>/qresearch/13930618 (181356ZJUN21) Notable: Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65000

The performance of the SARS-CoV-2 RT-PCR test as a tool for detecting SARS-CoV-2 infection in the population

Dear Editor,

Worldwide, detection and monitoring of SARS CoV-2 infection continues to be based on results of the real-time reverse-transcription polymerase chain reaction (RT-PCR) test.

A recent scoping review in this journal reported that assessment of the diagnostic accuracy of the RT-PCR test for SARS-CoV-2 has been less than perfect [1]. We analysed real-world data from a large laboratory in the city of Münster (population 313,000), Germany, derived from a single fully automated high throughput RT-PCR platform (cobas SARS-CoV-2 RT-PCR system, Roche Diagnostics) utilizing the same two gene targets for the entire study period (weeks 10-49, 2020).

This laboratory performed about 80% of all SARS-CoV-2 RT-PCR tests in the Münster region during this time. We explored changes in the percentage of positive RT-PCR tests (positive rate) over time. In addition, we assessed the influence of covariates such as age, sex, calendar time, and symptoms at the time of first RT-PCR test on the distribution of cycle threshold (Ct) values.

Nearly all swab specimens were tested within 24 hours of collection. The tests and their interpretation were carried out in accordance with the Roche cobas SARS-CoV-2 emergency use authorization (EUA) protocol, the specific targets of the test being the open reading frame (ORF) 1ab and the pan-Sarbecovirus E genes.

The limit of detection, defined as the concentration of analyte that will be detected in 95% of replicate tests was 0.007 median tissue culture infectious doses (TCID50) per ml for target 1 and 0.004 TCID50/ml for target 2, corresponding to Ct values of approximately 33 and 36, respectively (cobas® SARS-CoV-2 package insert, version 1.0).

RT-PCR tests that had not crossed the positivity threshold after the 40th cycle were reported as “negative”. The Ct value is inversely proportional to the initial amount of target nucleic acid and is thus a relative indicator of the concentration of viral particles in the clinical specimen. An increase in Ct value of three points indicates that the initial amount of viral particles was smaller by a factor of about ten.

We categorized our population-based Ct values according to the recommendations of the UK Office for National Statistics (ONS) COVID-19 household survey as

Since there has been some discussion regarding this Ct-threshold [3, 4, 5], we performed a second categorization using a cutoff of

Of 162,457 tested individuals, 4,164 (2.6%) had a positive RT-PCR test. The positive rate was lower among children aged 0-9 years (2.2%) and among adults aged 70 or more (1.6%), compared to the intermediate group aged 10-69 years (2.8%). The positive rate was strongly linked to the national SARS-CoV-2 test strategy. During the first and third phase of national testing, predominantly symptomatic people were tested. During these phases, the positive rates were higher than during the intermittent second phase corresponding to the summer season, when predominantly asymptomatic individuals were tested. The positive rate during the third phase was considerably higher than during the first phase. During the peak of testing asymptomatic individuals, only 0.4% tested positive with a mean Ct value of 28.8. Higher mean Ct values were observed among children aged 0-9 years (28.6) and adults above 70 years (27.0). Only 40.6% of positive tests showed Ct values below the threshold of 25, indicating a likelihood of the person being infectious (Table 1). In the small group of individuals for whom clinical information was available, symptomatic subjects had a markedly lower mean Ct value of 25.5 compared to asymptomatic subjects, who showed a mean Ct value of 29.6 (Figure 1).

>https://www.journalofinfection.com/article/S0163-4453(21)00265-6/fulltext

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65007

File: cafc6b4ccc97f6b⋯.pdf (388.93 KB,Clipboard.pdf)

Originally posted at >>>/qresearch/13930637 (181401ZJUN21) Notable: Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65005

Moreover…

https://www.journalofinfection.com/action/showPdf?pii=S0163-4453%2821%2900265-6

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65008

Originally posted at >>>/qresearch/13930643 (181402ZJUN21) Notable: On the Geostate: Jeffrey Prather interview: Deep dive into USA, China and Russia military capabilities and vulnerabilities.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13930595

It's an interview with J.R. Nyquist, a geopolitics scholar and researcher.

Mike Adams does very little talking. Nyquist is a genius. Jeffrey Prather acknowledged this fact yesterday.

Jeffrey Prather interview: Deep dive into USA, China and Russia military capabilities and vulnerabilities.

https://www.brighteon.com/4fd82b43-7722-4fd5-91d6-7970fa9eea36

Reasonable to reject MA bloviating, but Nyquist is smarter than him and he knows it and remains mostly silent throughout the interview.

It's key intel. Worth your time.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65009

File: 51e6be1b2b5ca74⋯.png (1000.79 KB,1616x673,1616:673,Clipboard.png)

Originally posted at >>>/qresearch/13930652 (181404ZJUN21) Notable: PF Update: AF2 on the move

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

AF2 on the move

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65010

File: b15f1b5ecf9cb6c⋯.jpg (91.26 KB,720x595,144:119,Clipboard.jpg)

Originally posted at >>>/qresearch/13930655 (181405ZJUN21) Notable: (Source needed) Colorado Secretary of State has just moved to ban any election audit in the state of Colorado

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/laurenboebert/status/1405871098705682438?s=19

The Colorado Secretary of State has just moved to ban any possible election audit in the state of Colorado.

Democrats are consistently terrified of election integrity!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65011

File: 593f7a937605386⋯.png (107.94 KB,1025x597,1025:597,Clipboard.png)

File: 053504dd98a26f9⋯.png (148.73 KB,996x600,83:50,Clipboard.png)

File: c55fb1d73d45c9c⋯.png (126.73 KB,995x602,995:602,Clipboard.png)

File: 9f32b73bd35510a⋯.png (144.46 KB,997x595,997:595,Clipboard.png)

File: 31cbe455bdc66a4⋯.png (127.93 KB,992x595,992:595,Clipboard.png)

Originally posted at >>>/qresearch/13930705 (181412ZJUN21) Notable: Meet California's Board of Behavioral Sciences,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

1/3

Meet California's Board of Behavioral Sciences

Working off the theory that current events are a giant phsyop, it occurred to Anon that we need to know something about the people, in each state, who may be connected to said phsyop. This phsyop seems to be about eliciting a preconceived (on the part of the perpetrator's) reaction from the general population. In other words, the perpetrators expect the population to change their behavior in a certain way.

Who knew that California has a Board of Behavioral Sciences. Fauci and the MSM want us to follow the science, so maybe Anons (on a local level) should know who they want us to follow.

Let's meet them.

v v v

Board Members and Committees

https://bbs.ca.gov/about/board_members.html

Fauci and the MSM want us to follow the science, so maybe Anons should know (on a local and state level) who we're expected to follow. It will be fascinating to find out what the "local scientists" will do as the fraud continues to be exposed. This Anon believes that there are some local behavioral scientists who are uncomfortable with their part in this phsyop. When will they say enough is enough? When will they speak out? Will they speak out? Will they remain silent, preferring their paychecks over the welfare of the people they supposedly serve?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65012

File: b0691570aafc613⋯.png (126.06 KB,991x599,991:599,Clipboard.png)

File: 11d4bbb6dcd7721⋯.png (167.96 KB,992x639,992:639,Clipboard.png)

File: a7e0a453286a87c⋯.png (8.82 KB,1013x552,1013:552,Clipboard.png)

File: 947d23c55387f51⋯.png (26.31 KB,1030x546,515:273,Clipboard.png)

Originally posted at >>>/qresearch/13930717 (181413ZJUN21) Notable: Meet California's Board of Behavioral Sciences,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65011

2/3

Meet California's Board of Behavioral Sciences continued.

Board Members and Committees continued.

https://bbs.ca.gov/about/board_members.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65013

File: 7f88573aef3fdcf⋯.png (150.05 KB,1040x636,260:159,Clipboard.png)

File: 26b79f7ee08eae9⋯.png (205.82 KB,859x653,859:653,Clipboard.png)

File: 4f8a503f0221644⋯.png (191.27 KB,887x643,887:643,Clipboard.png)

Originally posted at >>>/qresearch/13930722 (181414ZJUN21) Notable: Meet California's Board of Behavioral Sciences,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65011

3/3

Meet California's Board of Behavioral Sciences continued.

Board leadership is list as the Department of Consumer Affairs. Anon finds this a little odd. Is it an admission that people are expected to consume what behavioral science is selling?

Department of Consumer Affairs (DCA)

Leadership

https://www.dca.ca.gov/about_dca/leadership.shtml

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65014

File: 027e9eca65c023f⋯.png (78.03 KB,1123x794,1123:794,Clipboard.png)

File: 64903473f6a7020⋯.png (119.8 KB,1123x794,1123:794,Clipboard.png)

File: 26a821bbaac3c93⋯.jpg (72.65 KB,672x372,56:31,Clipboard.jpg)

Originally posted at >>>/qresearch/13930737 (181416ZJUN21) Notable: Kind reminder for newfrens.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Newfags…

We love you, but -

Do NOT reply to shills

Do NOT demolish their intentionally flawed arguments

Do NOT debate their idiotic "concerns"

Do NOT engage shills.

Do NOT participate in shill KAYFABE

In professional wrestling, kayfabe is the portrayal of staged events within the industry as "real" or "true", specifically the portrayal of competition, rivalries, and relationships between participants as being genuine and not of a staged or predetermined nature of any kind.

https://en.wikipedia.org/wiki/Kayfabe

Do NOT perpetuate shill SLIDES.

Do NOT reply to shills.

Do NOT pick up spit

If you are NOT sure, LEARN to ID shills

shills = hate

shills = labels

shills = repetition

shills = envy, greed, theology etc.

Do NOT correct intentional shill mistakes

Do NOT be triggered by shill taunts

do NOT eat bats off the street

Do NOT bark back at dogs

Spot a clown

Dealing with ye Clowns & ye Shills

>>>/qresearch/2322789 Spot a shill

>>>/qresearch/2323031 Spot A Clown

shills have no agency, no will independent of their masters. Shills are passed gas of history. The slave of the slaves, their words are writ upon water.

DIG MEME PRAY

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65015

Originally posted at >>>/qresearch/13930848 (181432ZJUN21) Notable: #17633, #17634,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

#17633

>>64981 @Cernovich finds out California Democrats have a hotline to Twitter Thought Police?

>>64982 Reminder that while Newsbot self-doxxed, this doesn't mean BakerTools is comped.

>>64983 2.54 Billion Vaccine Shots administered around the world

>>64984 Two More Months: Maricopa County Audit Report 'expected in August'

>>64985 Former WH Physician called on President Biden to immediately undergo a cognitive test to prove he has 'sound mental capabilities'

>>64986 Michigan Senate Passes Legislation to Add Voter ID Requirements: ‘Overwhelmingly Popular’

>>64987 Based Black Clinician gives strong rebuke of critical race theory at school meeting

>>64988 New Congress Bills, >>64989, >>64990

>>64991 Why hasn't Federal Agent Ray Epps (Capitol Hill Riot instigator) been indicted?, >>64993 Is it because of this?

>>64992 Chucky 'Cheese Pizza' Schumer warns of Threat of 'Qanon' to 'Peace' in United States

>>64994 Child Modelling Agencies: a deep swamp of systematic and horrific phsyical, mental and sexual abuse

>>64996 North Carolina Senate just passed a bill banning private money from being used to administration elections

>>64995 Israel says it's willing to transfer 1 million vaccines to Palestine, if Palestine is willing to return 1 million vaccines later

>>64997 House Republicans Demand Answers After Biden Admin Lifts Iran Sanctions Without Consulting Congress

>>64998 Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others, >>64999, >>65000, >>65002, >>65006, >>65005, >>65007

>>65001 CNN's Chris Cuomo dares 'the Internet' to call him a fact-denier.

>>65003 Election Fraud: 2nd Atlanta official caught double scanning ballots

>>65004 Reminder why PCR tests are untrustworthy to begin with

>>65008 On the Geostate: Jeffrey Prather interview: Deep dive into USA, China and Russia military capabilities and vulnerabilities.

>>65009 PF Update: AF2 on the move

>>65010 (Source needed) Colorado Secretary of State has just moved to ban any election audit in the state of Colorado

>>65011 Meet California's Board of Behavioral Sciences, >>65012, >>65013

>>65014 Kind reminder for newfrens.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65016

File: 93b284aff6c8154⋯.jpg (296.33 KB,639x656,639:656,Clipboard.jpg)

Originally posted at >>>/qresearch/13930931 (181443ZJUN21) Notable: Oped: ‘Exodus of the rich’ to Florida threatens disaster for NYC

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

‘Exodus of the rich’ to Florida threatens disaster for NYC

(Op-Ed)

https://nypost.com/2021/06/17/exodus-of-the-rich-to-florida-threatens-disaster-for-nyc/?utm_source=twitter_sitebuttons&utm_medium=site%20buttons&utm_campaign=site%20buttons

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65017

File: 7d6ab03a4ddf71b⋯.png (51.67 KB,631x378,631:378,Clipboard.png)

Originally posted at >>>/qresearch/13930933 (181444ZJUN21) Notable: Colorado Secretary of State will have no 'fraudits' in her State

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

confused by this….I thought the Secretary of State didn't have jurisdiction over this and it was the state legislators that decided. that's what happened in AZ yes?

https://twitter.com/JenaGriswold/status/1405615665591947270

"My office just issued rules prohibiting sham election audits in the State of Colorado. We will not risk the state’s election security nor perpetuate The Big Lie. Fraudits have no place in Colorado. "

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65018

Originally posted at >>>/qresearch/13930941 (181445ZJUN21) Notable: Earthquake in Indiana yesterday (West of Bloomingdale)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Earthquake in Indiana yesterday

Magnitude 3.8. 3 km west of Bloomingdale, IN. 3:18 pm.

https://earthquake.usgs.gov/earthquakes/eventpage/nm60344372/executive

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65019

File: 3b1073485c55416⋯.png (1.82 MB,2808x1312,351:164,Clipboard.png)

Originally posted at >>>/qresearch/13931009 (181458ZJUN21) Notable: Planefag reports

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

AF2, Venus93 and an n/a B752s

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65020

File: 36ba67364f6083e⋯.jpg (296.33 KB,1020x173,1020:173,Clipboard.jpg)

Originally posted at >>>/qresearch/13931035 (181504ZJUN21) Notable: Joe Rogan slams CNN's Stelter: 'Your show is f—ing terrible'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Joe Rogan slams CNN's Stelter: 'Your show is f—ing terrible'

https://thehill.com/homenews/media/559136-joe-rogan-slams-cnns-stelter-your-show-is-f-ing-terrible

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65021

File: 17e6603ec291f36⋯.png (521.51 KB,599x777,599:777,Clipboard.png)

Originally posted at >>>/qresearch/13931044 (181505ZJUN21) Notable: USSOCOM: Didn't a Q drop have a picture of an old guy wearing the 5 diamond patch?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Didn't a Q drop have a picture of an old guy wearing the 5 diamond patch? Anyone know what drop that was?

https://twitter.com/USSOCOM/status/1405901881302474753

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65022

File: 0aa23af890b532b⋯.jpg (36.42 KB,300x413,300:413,Clipboard.jpg)

File: bb52bdd9f19d07f⋯.jpg (34.32 KB,620x465,4:3,Clipboard.jpg)

Originally posted at >>>/qresearch/13931086 (181513ZJUN21) Notable: "Where the pedovores roam"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

New York Times

"Where the pedovores roam"

Mark Thompson, CEO of the pedovore protectin' New York Times is the former CEO of BBC - the British Broadcasting Corporation where the satanist pedophile Jimmy Savile worked for 30 + years, raping 10s of 000s of children, some of them in hospitals, others in the studios on premises owned by the BBC.

Thompson engineered the BBC Savile cover up then jumped ship to become CEO of the NY Times. Thompson continues to protect the satanist pedovore cultists who rape and sacrifice children.

https://www.independent.ie/world-news/europe/keep-your-mouth-shut-hes-a-vip-jimmy-savile-report-reveals-culture-of-fear-at-bbc-34484838.html

https://deadline.com/2012/11/legal-letter-raises-questions-mark-thompson-learned-alleged-jimmy-savile-abuse-bbc-new-york-times-373020/

https://www.irishtimes.com/news/world/uk/jimmy-savile-raped-or-abused-64-victims-in-one-hospital-1.2119124

https://www.nytimes.com/2012/11/05/business/media/mark-thompson-and-bbc-missed-red-flags-in-savile-scandal.html

https://www.telegraph.co.uk/news/uknews/crime/jimmy-savile/10512203/Former-BBC-boss-Mark-Thompson-lied-over-Savile-evidence-Nick-Pollard-claims.html

https://www.mirror.co.uk/news/uk-news/jimmy-savile-sex-abuse-newsnight-7736720

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65023

File: 3870488125ca010⋯.png (372.05 KB,857x827,857:827,Clipboard.png)

Originally posted at >>>/qresearch/13931094 (181514ZJUN21) Notable: EXPLOSIVE DEVELOPMENT: Election Worker Ralph Jones Is Now Second Worker Caught Double-Counting Ballots at the State Farm Center on Election Night!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/explosive-new-report-confirms-least-two-elections-officials-ruby-freeman-ralph-jones-caught-double-counting-ballots-state-farm-center-election-night/

EXPLOSIVE DEVELOPMENT: Election Worker Ralph Jones Is Now Second Worker Caught Double-Counting Ballots at the State Farm Center on Election Night!

By Jim Hoft

Published June 18, 2021 at 8:00am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65024

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13931098 (181515ZJUN21) Notable: "Giant Mistake" - CDC Delays Emergency Meeting On Post-Vax Heart Inflammation Due To Juneteenth

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

"Giant Mistake" - CDC Delays Emergency Meeting On Post-Vax Heart Inflammation Due To Juneteenth

Tyler Durden's Photo

BY TYLER DURDEN

FRIDAY, JUN 18, 2021 - 06:30 AM

Authored by Zachary Stieber via The Epoch Times,

The Centers for Disease Control and Prevention (CDC) has pushed back an emergency meeting on post-vaccination heart inflammation seen in Americans, primarily young people, because of a new federal holiday.

https://www.zerohedge.com/covid-19/giant-mistake-cdc-delays-emergency-meeting-post-vax-heart-inflammation-due-juneteenth

"Giant Mistake" - CDC Delays Emergency Meeting On Post-Vax Heart Inflammation Due To Juneteenth

Jun 18, 2021

DAHBOO777

253K subscribers

The Centers for Disease Control and Prevention (CDC) has pushed back an emergency meeting on post-vaccination heart inflammation seen in Americans, primarily young people, because of a new federal holiday.-

https://youtu.be/skVRRB56XWU

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65025

File: 1b2a463db5af643⋯.png (235.29 KB,1044x173,1044:173,Clipboard.png)

File: 6044796b777a76a⋯.jpg (194.16 KB,615x839,615:839,Clipboard.jpg)

File: f02968cf1a7aab5⋯.jpg (269.11 KB,600x600,1:1,Clipboard.jpg)

Originally posted at >>>/qresearch/13931109 (181516ZJUN21) Notable: Soros Spending in Colorado Elections

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65017

>>65017

>confused by this

Soros niggers don't care about the constitution.

Soros Spending in Colorado Elections

Politicians who are currently serving in Colorado and supported by the Soros familyinclude Secretary of State Jena Griswold, Rep. Tony Exum, Senator Rachel Zenzinger, Governor Jared Polis, and Rep. Meg Froelich.

https://freestatecolorado.com/who-are-george-soros-candidates-in-colorado/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65026

File: ce24b37549e148b⋯.jpg (263.71 KB,1397x1257,1397:1257,Clipboard.jpg)

Originally posted at >>>/qresearch/13931113 (181516ZJUN21) Notable: Human body activity associated with a task provided to a user may be used in a mining process of a cryptocurrency system.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13930964

https://patents.google.com/patent/WO2020060606A1/en

Abstract

Human body activity associated with a task provided to a user may be used in a mining process of a cryptocurrency system. A server may provide a task to a device of a user which is communicatively coupled to the server. A sensor communicatively coupled to or comprised in the device of the user may sense body activity of the user. Body activity data may be generated based on the sensed body activity of the user. The cryptocurrency system communicatively coupled to the device of the user may verify if the body activity data satisfies one or more conditions set by the cryptocurrency system, and award cryptocurrency to the user whose body activity data is verified.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65027

File: 4eec5e87cd4f163⋯.png (44.75 KB,1014x329,1014:329,Clipboard.png)

Originally posted at >>>/qresearch/13931189 (181531ZJUN21) Notable: Illinois governor signs law expanding curbside voting, permanent vote by mail

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://thehill.com/homenews/state-watch/559125-illinois-governor-signs-law-expanding-curbside-voting-permanent-vote-by

Illinois governor signs law expanding curbside voting, permanent vote by mail

BY JORDAN WILLIAMS - 06/18/21 09:52 AM EDT 698

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65028

File: f46d79efb4bc8eb⋯.jpg (296.33 KB,588x468,49:39,Clipboard.jpg)

Originally posted at >>>/qresearch/13931197 (181532ZJUN21) Notable: BREAKING: Congressman Gaetz Issues Letter to FBI Requesting Briefing on Wuhan Lab Whistleblower Investigation

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BREAKING: Congressman Gaetz Issues Letter to FBI Requesting Briefing on Wuhan Lab Whistleblower Investigation

"I am particularly concerned the FBI may have mislabeled Dr. Li-Meng Yan as a counterintelligence threat…"

Director Wray:

During our public hearing in the House Judiciary Committee on June 10, 2021, I asked you about the FBI’s interactions with Doctor Li-Meng Yan. In response, you stated that you cannot comment on ongoing investigations.

As a member of the Judiciary Committee with oversight authority over your Bureau, I request the FBI to provide me and my colleagues interested in this subject matter with a classified briefing detailing the FBI’s interactions with Dr. Yan.

I am particularly concerned the FBI may have mislabeled Dr. Yan as a counterintelligence threat, when in reality she was a whistleblower, defector, and fact witness with critical information about the role the Chinese Communist Party had in the origins of the COVID-19 pandemic.

I expect this classified briefing to take place within two weeks of this request. Please be in touch with my chief of staff to organize this meeting.

Sincerely,

Matt Gaetz

https://gaetz.house.gov/media/press-releases/congressman-matt-gaetz-issues-letter-fbi-requesting-briefing-wuhan-lab

https://twitter.com/RepMattGaetz/status/1405910486848262160

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65029

File: ecd1f1955f610fb⋯.png (306.56 KB,1085x501,1085:501,Clipboard.png)

File: 0570864b1d92d59⋯.png (365.33 KB,1101x603,367:201,Clipboard.png)

Originally posted at >>>/qresearch/13931250 (181543ZJUN21) Notable: HOT auditing review in August?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

HOT auditing review in August?

Don't recall seeing HOT and AUGUST discussed vis-a-vis audit before, throwing this out for consideration. Uncertain if HOT missile [goes BOOM] and / or Congressional AUGUST BREAK are relevant or not, likewise throwing out.

+ + +

What is the difference between Hot and Cold reviews in auditing?

According to ISQC 1 it is the objective of the firm to establish and maintain a system of quality control to provide it with reasonable assurance that:

- The firm and its personnel comply with professional standards and applicable legal and regulatory requirements; and

- Reports issued by the firm or engagement partners are appropriate in the circumstances.

Beside ISQC 1 there can be local quality control standards as well by the bodies regulating the auditor’s work in specific jurisdiction with almost similar objectives to be achieved.

Although there are many elements and aspects of audit firm and auditor’s work get included but the foremost is the auditor’s report. To ensure whether objectives of the audit have been achieved or not we have thetechniques called hot file review (aka hot review)and cold file review (aka cold review).

Hot file review: Hot file review or hot review is conducted usually conducted during the audit and/or audit work is completed but before the auditor’s report is issued. This in nature is a detailed review that is conducted with an aim to find out if there s any weakness in application of audit procedures or if the results have been misinterpreted. Hot reviews are usually carried out usually by the senior the audit team or someone with the same authority who is not connected with the engagement. Such reviews mostly include meetings with audit team personnel and their individual work so that both work and the skills of members are improved by pointing out discrepancies and providing recommendations…

Summary

Hot file review or Hot review is conducted during the audit work is conducted but before the auditor’s report is issued with a prime objective to ensure compliance with relevant auditing standards and achieving engagement’s objectives.

https://pakaccountants.com/difference-between-hot-and-cold-reviews-auditing/

https://www.theepochtimes.com/maricopa-county-audit-report-expected-in-august_3864225.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65030

File: ac1b2fad2e848b2⋯.png (20.42 KB,654x477,218:159,Clipboard.png)

File: bdbf42fb4959754⋯.png (918.04 KB,1034x1400,517:700,Clipboard.png)

Originally posted at >>>/qresearch/13931293 (181553ZJUN21) Notable: HOT auditing review in August?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65029

thinking about the Camp David pool image, more inclined to interpret as breaking + Seal → DECLAS.

IDK, enjoying the movie and trying to figure out plot twists

suppose we could also go Law of War manual per Superproof dude and interpret the pool cues as being Chapter 11, cue ball (s.1) to racked balls (s.12)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65031

File: 677c01051cdbe49⋯.png (464.05 KB,653x528,653:528,Clipboard.png)

File: 3d03a8bef779a3d⋯.png (126.15 KB,1183x780,91:60,Clipboard.png)

File: 6240a9670f64cca⋯.png (61.23 KB,976x446,488:223,Clipboard.png)

Originally posted at >>>/qresearch/13931312 (181558ZJUN21) Notable: Four Young Pilots have Mysteriously Died, but NOT from the Vaccine

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Reuters Fact Chekt:

Four Young Pilots have Mysteriously Died, but NOT from the Vaccine

https://www.reuters.com/article/factcheck-coronavirus-aviation-idUSL2N2NZ1ZO

Fact Check-British Airways is not in ‘crisis talks’ with the government over vaccinated pilots

By Reuters Fact Check

4 MIN READ

Claims that British Airways is in “crisis talks” with the British government due to the deaths of three pilots who received COVID-19 shots are unfounded, a company representative and British medicines regulator spokesperson has told Reuters.

Shared in the form of a voice recording on Facebook, Instagram and Twitter, an unidentified male says he has spoken to a “friend who’s a BA pilot” and explains “things are getting crazy” after three fellow pilots passed away (here , here and here).

“They’ve had the third BA pilot die in the last seven days, yeah? Third pilot dead in the last week,” says the man heard in the recording. “The first two guys were in their forties and fifties; this guy, mid-thirties, perfectly fit, no underlying conditions. He gets his second jab and he’s dead within days, exactly the same with the first two.

“Because of this, BA are now in crisis talks with the government about whether to allow vaccinated pilots to fly. The issue with that of course is that about 80%, according to my friend in BA, 80-85% have been injected.”

The man then goes on to say only “10% of pilots will be able to fly,” branding it a “serious issue”.

On Twitter, some users have also shared a photo of what appears to be four books of condolence next to framed pictures of four men in a British Airways-themed lounge (here). “I believe it was actually FOUR young pilots who died due to the Maxine,” tweeted one user.

Reuters presented the claims to British Airways, which said they were unfounded and that no such talks were underway with the government. The spokesperson, however, confirmed the authenticity of the four condolence books, as four company pilots had recently passed away. “Our thoughts are with their family and friends,” they said, adding that none of the deaths was linked to vaccines.

In a statement to Reuters, the UK’s Medicines & Healthcare products Regulatory Agency (MHRA) also denied any such crisis talks with Britain’s flagship air carrier.

“We have not been made aware of deaths of BA pilots after receiving the Covid-19 vaccine and have not had discussions with BA or other airlines, about preventing pilots from flying after receiving the COVID-19 vaccine,” said Dr. Sarah Branch, the director of vigilance and risk management of medicines for the MHRA. “There are currently no restrictions on aviation or other industries and activities post vaccination.

“Our advice remains that the benefits of the vaccine outweigh the risks in the majority of people. It is still vitally important that people come forward for their vaccination and for their second dose when invited to do so. 

“We ask anyone who suspects they have experienced a side effect linked with their COVID-19 vaccine to report it to the Coronavirus Yellow Card website.” 

VERDICT

False. British Airways is not in “crisis talks” with the British government about vaccinated pilots. Four pilots have recently died – and British Airways says none of these is linked to vaccines.

This article was produced by the Reuters Fact Check team. Read more about our work to fact-check social media posts here .

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65032

File: fb32b09c71158e1⋯.png (404.14 KB,653x747,653:747,Clipboard.png)

Originally posted at >>>/qresearch/13931336 (181603ZJUN21) Notable: Col. Dr. Lawrence Sellin: we need to transition from COVID-19 detectives to CCP-Hunters

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Col. Dr. Lawrence Sellin: we need to transition from COVID-19 detectives to CCP-Hunters

For the coming battle we need to transition from COVID-19 detectives to CCP-Hunters. Cleaning out the vermin infestation of CCP agents in the U.S. will go part and parcel with bringing down the CCP in Beijing. Search their Tweets, link with other sites, associates and relations.

https://twitter.com/LawrenceSellin/status/1405814265798344707

Was also on the https://warroom.org/listen-live/ today in the last segment.

Whistleblower chinese Dr. Li-Meng Yan's husband was allowed in the U.S. Is her life in danger NOW

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65033

File: e4310aad1d03a26⋯.png (330.24 KB,659x692,659:692,Clipboard.png)

Originally posted at >>>/qresearch/13931357 (181608ZJUN21) Notable: Col. Dr. Lawrence Sellin: we need to transition from COVID-19 detectives to CCP-Hunters

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65032

moar from Dr Sellin

It is totally unfathomable to me howANY medical research center could harbor & protect a foreigner, who has been accused of trying to kill his wife, clearly sent to the U.S. by the Chinese Communist Party & arguably connected to the China's biowarfare program.

ReTweet everywhere

https://twitter.com/LawrenceSellin/status/1404651259827830784

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65034

File: 633eed64a6bc378⋯.png (492.28 KB,787x443,787:443,Clipboard.png)

Originally posted at >>>/qresearch/13931397 (181614ZJUN21) Notable: Osama Bin Laden’s Niece Trolls Biden With ‘Trump Won’ Sign At Geneva Summit

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13930879

Osama Bin Laden’s Niece Trolls Biden With ‘Trump Won’ Sign At Geneva Summit

https://www.dailywire.com/news/osama-bin-ladens-niece-trolls-biden-with-trump-won-sign-at-geneva-summit?itm_source=parsely-api&utm_source=cnemail&utm_medium=email

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65035

File: 7842a4dfcd99e87⋯.png (2.15 MB,1242x2688,207:448,Clipboard.png)

File: 179dc1e07359af7⋯.png (1.27 MB,1242x2688,207:448,Clipboard.png)

File: 717e4eeefea6864⋯.png (1.64 MB,1242x2688,207:448,Clipboard.png)

Originally posted at >>>/qresearch/13931559 (181639ZJUN21) Notable: Liz Cheney Puts The ‘Forever’ In ‘Forever War’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Liz Cheney Puts The ‘Forever’ In ‘Forever War’

Jordan Davidson

Warmonger Rep. Liz Cheney is putting the “forever” in “forever war” by condemning her fellow congressional colleagues who voted to repeal the two-decade-old Authorization for Use of Military Force used by President George W. Bush to invade Iraq.

“AUMF repeal without comprehensive replacement is dangerous, misguided, and ignores the security challenges facing our nation. This legislation removes a critical tool used by previous administrations – Republican and Democrat – to defeat terrorist threats originating in Iraq,” the Wyoming representative who was ousted from House leadership wrote in a statement.

Despite her insistence that the “repeal would send a message of weakness to our adversaries and allies alike” and that it “is not part of a comprehensive replacement providing adequate authority to combat terrorists or those who want to do our nation harm is a vote to leave America exposed to our enemies,” the lower chamber voted 268 to 161 to remove the authorization.

The repeal comes after nearly 20 years of aimless military adventurism enabled by the authorization and multiple attempts to cut off the “blank check” to keep American soldiers overseas.

Senate Minority Leader Mitch McConnell echoed Cheney’s concerns about repealing the funding but multiple Republican representatives voted in favor of getting rid of the measure and noted that it was “no longer relevant.”

“The 2002 AUMF is no longer relevant and its repeal would not impact ongoing operations in the Middle East,” Rep. Mike Gallagher of Wisconsin said in a statement calling the vote a “matter of basic constitutional hygiene and a small but significant step forward in reasserting Congress’s war powers authorities.”

https://thefederalist.com/2021/06/17/liz-cheney-puts-the-forever-in-forever-war/#.YMvABhcZuvw.twitter

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65036

Originally posted at >>>/qresearch/13931567 (181641ZJUN21) Notable: #17634

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Notable Posts

#17634 @FINAL,

>>65016 Oped: ‘Exodus of the rich’ to Florida threatens disaster for NYC

>>65017 Colorado Secretary of State will have no 'fraudits' in her State

>>65018 Earthquake in Indiana yesterday (West of Bloomingdale)

>>65019 Planefag reports

>>65020 Joe Rogan slams CNN's Stelter: 'Your show is f—ing terrible'

>>65021 USSOCOM: Didn't a Q drop have a picture of an old guy wearing the 5 diamond patch?

>>65022 "Where the pedovores roam"

>>65023 EXPLOSIVE DEVELOPMENT: Election Worker Ralph Jones Is Now Second Worker Caught Double-Counting Ballots at the State Farm Center on Election Night!

>>65024 "Giant Mistake" - CDC Delays Emergency Meeting On Post-Vax Heart Inflammation Due To Juneteenth

>>65025 Soros Spending in Colorado Elections

>>65026 Human body activity associated with a task provided to a user may be used in a mining process of a cryptocurrency system.

>>65027 Illinois governor signs law expanding curbside voting, permanent vote by mail

>>65028 BREAKING: Congressman Gaetz Issues Letter to FBI Requesting Briefing on Wuhan Lab Whistleblower Investigation

>>65029, >>65030 HOT auditing review in August?

>>65031 Four Young Pilots have Mysteriously Died, but NOT from the Vaccine

>>65032, >>65033 Col. Dr. Lawrence Sellin: we need to transition from COVID-19 detectives to CCP-Hunters

>>65034 Osama Bin Laden’s Niece Trolls Biden With ‘Trump Won’ Sign At Geneva Summit

>>65035 Liz Cheney Puts The ‘Forever’ In ‘Forever War’

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65037

File: 7ecf064ae7f0dec⋯.jpg (256.43 KB,1680x1050,8:5,Clipboard.jpg)

File: f9469c3c8353599⋯.jpg (272.6 KB,1680x1050,8:5,Clipboard.jpg)

File: 3b0bb0e6884d128⋯.jpg (289.25 KB,1680x1050,8:5,Clipboard.jpg)

Originally posted at >>>/qresearch/13931656 (181658ZJUN21) Notable: RE: Covid Vax/Blood cells/Spike Proteins, Is This Verifiable? Contagious?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Does anyone have a microscope? This needs to be verified.

“Vetted Images - Blood Before and After the mRNA COVID "Vaccine" Shot”

https://www.bitchute.com/video/qRUuSThq6RRv/

The patient was given an unspecified mRNA jab.

How did this get past ANY initial testing?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65038

File: 4a91961563408f4⋯.jpeg (1.08 MB,1854x1444,927:722,Clipboard.jpeg)

Originally posted at >>>/qresearch/13931696 (181703ZJUN21) Notable: RE: Covid Vax/Blood cells/Spike Proteins, Is This Verifiable? Contagious?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65037

The Covid virus causes white blood cells to explode

Vax mimics the virus as a way to combat it(supposedly)

The Covid and the vax are blood agents….they will spread the tainted blood over next year by way of transfusions, just like Fauci

did with AIDS

https://www.nhlbi.nih.gov/news/2020/study-identifies-autoimmune-antibodies-culprit-behind-life-threatening-blood-clots-covid

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65039

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13931698 (181704ZJUN21) Notable: , Clowns trending for attempting to bomb themselves

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Suspicious package near CIA HQ Virginia…

Jun 18, 2021

Citizen Free Press

2.8K subscribers

https://youtu.be/k01BaU1an4s

http://citizenfreepress.com is the #1 site for news junkies across the world updated live 18 hours a day!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65040

File: a3809cabe1bf6a9⋯.png (84.73 KB,1263x388,1263:388,Clipboard.png)

File: c6ae6da13e2d22c⋯.png (116.35 KB,772x574,386:287,Clipboard.png)

File: f467a11da2a4004⋯.png (105.44 KB,692x555,692:555,Clipboard.png)

Originally posted at >>>/qresearch/13931703 (181705ZJUN21) Notable: New Details Emerge in Chinese Defector Story

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13931639 (LB) - Repost per Baker's Request

New Details Emerge in Chinese Defector Story

https://townhall.com/tipsheet/mattvespa/2021/06/18/heres-what-the-chinese-defector-has-reportedly-given-us-about-covid-but-also-o-n2591167

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65041

Originally posted at >>>/qresearch/13931748 (181715ZJUN21) Notable: Seattle:10 Arrested Thursday, Pro-Palestinian Protesters attempted to block the unloading of a Israeli Cargo Ship

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.newsweek.com/seattle-pro-palestinian-protest-tries-block-israeli-owned-cargo-ship-1602070?piano_t=1

Seattle police arrested 10 people on Thursday after a group of pro-Palestinian protesters attempted to block the unloading of a cargo ship owned by an Israeli company. The incident comes amid renewed Mideast hostilities between Israel and the Palestinians.

The protest, organized by Palestinian feminist collective Falastiniyat, took place after a cargo ship owned by Israeli company ZIM docked at the Port of Seattle. Activists said the vessel was initially scheduled to unload its cargo in Seattle on June 2.

KUOW reported the union representing dockworkers said it supported the protesters' first amendment rights in a statement.

Fred Felleman, president of the Port Commission, told KUOW he disagreed with the protest, adding ZIM is "a public entity on the stock market."

"To target a shipping company is not targeting the cause of the problem," he said. "The impact is not on world politics, but on the working-class waterfront."

Seattle City Councilmember Kshama Sawant was among the protesters, tweeting: "Unions & the labor movement courageously blocking corporate profits will be crucial."

The Seattle demonstration is part of Block The Boat, a series of port-based protests led by the California-based Arab Resource and Organizing Center (AROC). AROC said Block The Boat operates under the Boycott Divest Sanctions (BDS) movement.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65042

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13931768 (181720ZJUN21) Notable: Entire Portland riot squad resigns after officer's indictment

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Entire Portland riot squad resigns after officer's indictment

Fox News June 18 2021

Former Detroit police chief James Craig is 'not surprised' that police are resigning en masse in Portland. He also says the crime surge in Chicago is due to a failed criminal justice system.

https://www.youtube.com/watch?v=R6hWHNRUycM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65043

File: 5ce647fb8b4e12d⋯.png (105.42 KB,692x555,692:555,Clipboard.png)

Originally posted at >>>/qresearch/13931769 (181720ZJUN21) Notable: New Details Emerge in Chinese Defector Story

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Consider the disparate data in this list. From how many different sources would this person have had to dredge to come up with this dirt? Were the names of compromised US congressmen in the same "file cabinet" as the SARS bio warfare research?

This was a well-prepared docket of information, not some quick-snapped spy-camera data; there was a group behind this from all of the segments defined by what info was given - this is very encouraging and incredibly timely as well.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65044

Originally posted at >>>/qresearch/13931771 (181721ZJUN21) Notable: Protester in MAGA Hat Spotted Next to Antifa’s John Sullivan on Jan. 5 Urged Protesters to Storm US Capitol on 6th — Is Identified — Smells Like Informant??

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dirtbag fbi provocateur "aka boomer fed" caught on tape

Holy Crap! Protester in MAGA Hat Spotted Next to Antifa’s John Sullivan on Jan. 5 Urged Protesters to Storm US Capitol on 6th — Is Identified — Smells Like Informant??

https://www.thegatewaypundit.com/2021/06/holy-crap-protester-maga-hat-spotted-next-antifas-john-sullivan-jan-5-urged-protesters-storm-us-capitol-6th-smells-like-informant/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65045

File: d3ac3f2e074bc78⋯.png (229.93 KB,597x535,597:535,Clipboard.png)

Originally posted at >>>/qresearch/13931810 (181732ZJUN21) Notable: Pence gets drowned out by hecklers at the Faith & Freedom Coalition summit, some of whom appear to be chanting "traitor!"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/AndrewSolender/status/1405928997880533003

Pence gets drowned out by hecklers at the Faith & Freedom Coalition summit, some of whom appear to be chanting "traitor!"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65046

File: 92867ee88f1636c⋯.png (547.29 KB,930x878,465:439,Clipboard.png)

File: f2e1536968567a0⋯.png (214.07 KB,700x350,2:1,Clipboard.png)

Originally posted at >>>/qresearch/13931823 (181735ZJUN21) Notable: Pennsylvania Audit Prospects

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Pennsylvania Audit Prospects

Pennsylvania's 20 electoral college votes constitute a huge bloc. Hypothetically, if Penn goes for Trump after audit, only 2 other states are need for 270. For example, AZ & GA.

-

"Pennsylvania Election Audit a ‘Very Real Possibility’:

Top Senate Republican"

"In Pennsylvania, the Senate can vote to authorize an audit without support from the House."

https://www.theepochtimes.com/pennsylvania-election-audit-a-very-real-possibility-top-senate-republican_3864414.html?welcomeuser=1

-

Penn State Senate breakdown:

R - 28

D - 21

I - 1

https://www.legis.state.pa.us/cfdocs/legis/home/member_information/mbrList.cfm?body=S

So Penn Republicans can go do it.

-

Very likely related: DJT put the heat on 'em 3 days ago:

"Why is State Senator Jake Corman of Pennsylvania fighting so hard that there not be a Forensic Audit of the 2020 Presidential Election Scam? Corman is fighting as though he were a Radical Left Democrat, saying that a Forensic Audit of Pennsylvania not take place. Why is Senator David Argall playing the same game? Are they stupid, corrupt, or naive? What is going on? Other State Senators want this Forensic Audit to take place—immediately. I feel certain that if Corman continues along this path of resistance, with its lack of transparency, he will be primaried and lose by big numbers. What went on in Philadelphia and other areas of the State must be properly and legally exposed. If it is not, just like with open Borders, we won’t have a Country anymore!"

https://gab.com/realdonaldtrump/posts/106410625515903501

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65047

File: 36724bcca76b0c6⋯.png (1.33 MB,750x1334,375:667,Clipboard.png)

File: 92785ad41abb5e8⋯.mp4 (2.58 MB,638x360,319:180,Clipboard.mp4)

File: d0a663afa229db0⋯.mp4 (313.57 KB,570x270,19:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13931835 (181738ZJUN21) Notable: Pence gets drowned out by hecklers at the Faith & Freedom Coalition summit

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65045

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65048

File: 40dc05c05779712⋯.png (24.61 KB,1268x364,317:91,Clipboard.png)

Originally posted at >>>/qresearch/13931847 (181741ZJUN21) Notable: Biden admin sending 'F— you' message with string of family-related hires: Obama ethics chief

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Biden admin sending 'F— you' message with string of family-related hires: Obama ethics chief

Walter Shaub, the director of the United States Office of Government Ethics under President Obama, said the Biden administration is sending a "f— you" to ethics experts by hiring so many relatives of senior White House officials.

Press secretary Jen Psaki, Secretary of State Antony Blinken, national security adviser Jake Sullivan, senior adviser Anita Dunn, White House counselor Steve Richetti, deputy chief of staff Bruce Reed and presidential personnel office director Cathy Russell each have at least one direct family member working for the Biden administration.

"I'm sorry, I know some folks don't like hearing any criticism of him. But this royally sucks. I'm disgusted," Shaub wrote in a Twitter thread Friday, reacting to an article about the family ties of Biden officials.

"A lot of us worked hard to tee him up to restore ethics to government and believed the promises," Shaub added, calling the string of family-related hires "a real ‘f*** you’ to us—and government ethics."

"EVEN THE F-ING HEAD OF PRESIDENTIAL PERSONNEL, WHO IS SUPPOSED TO BE KEEPING THEM HONEST, HAS A CHILD WHO'S A RECENT COLLEGE GRAD WORKING IN THE ADMINISTRATION. AND THE SPOUSE OF THE WHITE HOUSE CHIEF OF STAFF, FOR CRYING OUT LOUD," Shaub added.

"This is ridiculous. What a f***ing failure."

"And I don't love having a milk lobbyist running USDA or a ‘strategic advisor’ (i.e., shadow lobbyist) running the State Department," Shaub continued. "Or the brother of Biden's top WH advisor lobbying the Executive Office of the President through a firm the Biden appointee founded."

The White House defended the hiring practices in a statement on Friday, claiming that Biden has implemented the strictest ethics standards to ever hit the executive branch.

"The president has instituted the highest ethical standards of anyone to ever hold this office," deputy White House press secretary Andrew Bates told The Washington Post. "And he's proud to have staffed the most diverse administration in American history with well-qualified public servants who reflect his values."

The White House declined Fox News' request for comment on Shaub's characterization of the administration's hiring practices.

moar here -

https://www.foxnews.com/politics/biden-administration-family-hires-richetti

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65049

Originally posted at >>>/qresearch/13931878 (181748ZJUN21) Notable: RE: Covid Vax/Blood cells/Spike Proteins, Is This Verifiable? Contagious?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65037

Additional questions:

How contagious is this?

Is it safe to go shopping? (let alone go out to eat)

Can this happen to us from having caught the "shedding"?

For how long are they contagious?

Will the med beds fix this?

And when will those become available to the public?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65050

File: 1ba98fc4915c77b⋯.png (353.74 KB,1196x737,1196:737,Clipboard.png)

Originally posted at >>>/qresearch/13931883 (181749ZJUN21) Notable: Florida to Send Officers to Texas and Arizona to Assist with Border Crisis

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://amgreatness.com/2021/06/17/florida-to-send-officers-to-texas-and-arizona-to-assist-with-border-crisis/

Florida to Send Officers to Texas and Arizona to Assist with Border Crisis

By Eric Lendrum

June 17, 2021

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65051

File: 3611cd6a198bbf7⋯.png (225.06 KB,787x497,787:497,Clipboard.png)

Originally posted at >>>/qresearch/13931920 (181757ZJUN21) Notable: November Memo Documented 'Massive' Election Integrity Problems in Atlanta

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://pjmedia.com/news-and-politics/matt-margolis/2021/06/18/bombshell-memo-documents-massive-election-integrity-problems-in-atlanta-n1455516

BOMBSHELL: November Memo Documented 'Massive' Election Integrity Problems in Atlanta

BY MATT MARGOLIS JUN 18, 2021 11:13 AM ET

BOMBSHELL: November Memo Documented 'Massive' Election Integrity Problems in Atlanta

BY MATT MARGOLIS JUN 18, 2021 11:13 AM ET

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65052

File: 2eaab763affff5c⋯.png (1.02 MB,980x551,980:551,Clipboard.png)

Originally posted at >>>/qresearch/13931924 (181759ZJUN21) Notable: Anonymous email says BOMB planted in Moscow government building, demands end to ‘mandatory’ Covid-19 vaccinations, media reports

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Anonymous email says BOMB planted in Moscow government building, demands end to ‘mandatory’ Covid-19 vaccinations, media reports

https://www.rt.com/russia/526983-bomb-moscow-government-covid19/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65053

File: f13e33655c8ceeb⋯.png (462.48 KB,1404x2812,351:703,Clipboard.png)

File: 733edccd181e366⋯.png (863.3 KB,1065x779,1065:779,Clipboard.png)

Originally posted at >>>/qresearch/13931929 (181801ZJUN21) Notable: @mikepompeo (Probably something)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13931806

>>>/qresearch/13931191 pb

>Probably

noice *PIPE* references

/pB ALL

>>>/qresearch/13931253, >>>/qresearch/13931253, >>>/qresearch/13931288, >>>/qresearch/13931396,

>>>/qresearch/13931533

PEDO maybe? Hunters HUNT:

Definition of clean (one's) pipes - Online Slang Dictionary

clean (one's) pipes: [verb] to have sex with ??? choice is yours ??? !sickness!

'How would you like to clean my pipes ?

When do you call a plumber?" - Q

also this +: Sports youth, young athletes, scouting new talent/models, etc

due to POMPEO reference to PIPE-hitter:

there is also PIPE-fitter

also PLUMber PIPE

also PIPE-bomb, as in BOSTON, why BOSTON?

https://en.wikipedia.org/wiki/Mike_Cavanaugh

Mike Cavanaugh is an American ice hockey coach and former player.

Cavanaugh was an assistant at Boston College for 18 seasons[1]

before being named as Bruce Marshall's successor at Connecticut

in the spring of 2013.[2]

https://uconnhuskies.com/sports/mens-ice-hockey/roster/coaches/mike-cavanaugh/352

https://archive.ph/WW5We

check the SPONSORS of Entertainment

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65054

File: c7b4dd81949affc⋯.png (733.34 KB,853x917,853:917,Clipboard.png)

Originally posted at >>>/qresearch/13931930 (181801ZJUN21) Notable: Liberian rebel leader sentenced to 20 years in prison for war crimes including cannibalism in first such trial by Swiss court

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Liberian rebel leader sentenced to 20 years in prison for war crimes including cannibalism in first such trial by Swiss court

https://www.rt.com/news/526984-swiss-court-sentence-liberian-rebel-commander-war-crimes/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65055

File: ce354dd1cb7a63d⋯.png (214.14 KB,2550x3300,17:22,Clipboard.png)

Originally posted at >>>/qresearch/13931942 (181802ZJUN21) Notable: Twitter Subpoenaed in Georgia Lawsuit Involving Fulton County Elections Supervisor Wandrea Shaye Moss

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Twitter Subpoenaed in Georgia Lawsuit Involving Fulton County Elections Supervisor Wandrea Shaye Moss

Wandrea Shaye Moss was an elections supervisor at the State Farm Arena in Atlanta, Georgia, on election day November 3, 2020.

Shaye is the daughter of Ruby Freeman who was filmed feeding the same stacks of ballots through voting machines late at night at the center — after observes were sent home.

On Thursday plaintiffs Caroline Jeffords and Robbin Sotir subpoenaed Twitter for the production of documentary evidence on elections supervisor Shaye Moss.

In early June Shaye Moss was subpoenaed for a deposition in a civil trial in Fulton County.

The subpoena was later delayed as Democrats continue to block and delay the investigations in Georgia.

What are they so afraid of?

https://www.thegatewaypundit.com/2021/06/twitter-subpoenaed-georgia-lawsuit-involving-fulton-county-elections-supervisor-wandrea-arshaye-moss/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65056

File: 038f498fdf3773f⋯.png (277.17 KB,600x315,40:21,Clipboard.png)

Originally posted at >>>/qresearch/13931958 (181805ZJUN21) Notable: Multiple Individuals Push Multiple Ballots through Multiple Tabulators Multiple Times in Georgia. This Is Illegal. Law Enforcement Does Nothing.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Multiple Individuals Push Multiple Ballots through Multiple Tabulators Multiple Times in Georgia. This Is Illegal. Law Enforcement Does Nothing.

Today we reported on Ralph Jones pushing multiple ballots into voting machine tabulators in Georgia. This was not the first time we reported on this subject.

On December 4, 2020, we reported on Fulton County Georgia poll worker Ruby Freeman pushing multiple ballots through the vote tabulators multiple times. This was illegal.

President Trump retweeted our article and we noted this in the post below (this was of course back in the day when the President of the United States was allowed to have a Twitter account).

Then in early January, we reported more video in Georgia showing multiple workers jamming multiple ballots into tabulation machines multiple times.

Today we reported on Ralph Jones pushing ballots through the tabulators multiple times. This, again, is a crime.

Multiple People pushed multiple ballots through multiple tabulators multiple times in Georgia. This was illegal. The FBI and DOJ do nothing.

https://www.thegatewaypundit.com/2021/06/multiple-individuals-push-multiple-ballots-multiple-tabulators-multiple-times-georgia-illegal-law-enforcement-nothing/

https://www.thegatewaypundit.com/2021/06/multiple-individuals-push-multiple-ballots-multiple-tabulators-multiple-times-georgia-illegal-law-enforcement-nothing/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65057

Originally posted at >>>/qresearch/13931975 (181807ZJUN21) Notable: US Department of Health and Human Services Pushes Ad Claiming Vaccines “Prevented Nearly 100% of Hospitalizations and Deaths Due to COVID”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

US Department of Health and Human Services Pushes Ad Claiming Vaccines “Prevented Nearly 100% of Hospitalizations and Deaths Due to COVID”

The US Department of Health and Human Services released an ad where they claim China Coronavirus vaccines prevent nearly 100% of COVID-19 hospitalizations and deaths.

An advertisement from the HHS appears to claim that the COVID-19 vaccines will prevent 100% of hospitalizations and deaths due to COVID. But how can they know this, let alone prove it?

The short 30-second advertisement shares the following:

Thanks for letting me know in clinical trials vaccines prevented nearly 100% of hospitalizations and deaths due to COVID.

The ad does use a caveat – “in clinical trials.” But there is no information on how many people were selected in their trials and how they reached their determination that the vaccines they tested basically prevent all hospitalizations and deaths due to COVID. They also use the word “nearly” and the definition of this too is not provided.

What a crock. This ad appears very misleading.

https://www.thegatewaypundit.com/2021/06/us-department-health-human-services-pushes-ad-claiming-vaccines-prevented-nearly-100-hospitalizations-deaths-due-covid/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65058

File: 50401067919d520⋯.png (262.68 KB,599x547,599:547,Clipboard.png)

Originally posted at >>>/qresearch/13931990 (181810ZJUN21) Notable: Suspicious package at #CIA's headquarters in McLean, Virginia. Parameter closed down. Bomb squad at the site.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/disclosetv/status/1405930931630882823

JUST IN - Suspicious package at #CIA's headquarters in McLean, Virginia. Parameter closed down. Bomb squad at the site.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65059

File: 3aab2ec55bf788b⋯.png (43.77 KB,755x868,755:868,Clipboard.png)

File: 69af5e19f5c47b8⋯.png (42.49 KB,764x867,764:867,Clipboard.png)

File: d934d2f4ef4c214⋯.png (26.83 KB,760x504,95:63,Clipboard.png)

Originally posted at >>>/qresearch/13931993 (181811ZJUN21) Notable: Chinese Defector's Identity Confirmed, Was Top Counterintelligence Official

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Chinese Defector's Identity Confirmed, Was Top Counterintelligence Official

We now know the name of the Chinese defector who has been working with the Defense Intelligence Agency (DIA) for a few months and what his position within the Chinese military and government was, among other details.

Matthew Brazil and Jeff Stein at Spy Talk reported on the “rumor,” and gave the name and background of the rumored defector:

Chinese-language anti-communist media and Twitter are abuzz this week with rumors that a vice minister of State Security, Dong Jingwei (董经纬) defected in mid-February, flying from Hong Kong to the United States with his daughter, Dong Yang.

Dong is, or was, a longtime official in China’s Ministry of State Security (MSS), also known as the Guoanbu. His publicly available background indicates that he was responsible for the Ministry’s counterintelligence efforts in China, i.e., spy-catching, since being promoted to vice minister in April 2018. If the stories are true, Dong would be the highest-level defector in the history of the People’s Republic of China.

RedState’s sources confirmed that the defector is, in fact, Dong, that he was in charge of counterintelligence efforts in China, and that he flew to the United States in mid-February, allegedly to visit his daughter at a university in California. When Dong landed in California he contacted DIA officials and told them about his plans to defect and the information he’d brought with him. Dong then “hid in plain sight” for about two weeks before disappearing into DIA custody.

According to Spy Talk, Dong’s name came up during the Sino-American Summit held in Alaska in March 2021:

In a tweet on Wednesday, Han [Dr. Han Lianchao, a Chinese defector], citing an unnamed source, alleged that China’s foreign minister Wang Yi and Communist Party foreign affairs boss Yang Jiechi demanded that the Americans return Dong and Secretary of State Anthony Blinken refused.

RedState’s sources say that Chinese officials did demand that the United States return Dong, but Blinken didn’t exactly refuse; at that time Blinken wasn’t aware that Dong was with the US government, the sources say, and told China that the US didn’t have Dong.

It’s only in the last three to four weeks that anyone outside DIA knew about the defector, according to RedState’s sources. Prior to that time, DIA was vetting the information provided and confronting Langley officials with what they’d learned without divulging the source.

https://redstate.com/jenvanlaar/2021/06/17/breaking-chinese-defector-confirmed-as-top-counterintelligence-official-n398374

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65060

File: 977cc64276b7b88⋯.png (8 KB,680x127,680:127,Clipboard.png)

Originally posted at >>>/qresearch/13932038 (181820ZJUN21) Notable: Supreme Court Sides With Megacorps, Child Trafficking OK as Long as it Happens Outside US

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Supreme Court Sides With Megacorps, Child Trafficking OK as Long as it Happens Outside US

Human rights advocates Thursday denounced a Supreme Court decision in favor of the U.S. corporate giants Nestlé USA and Cargill, which were sued more than a decade ago by six men who say the two companies were complicit in child trafficking and profited when the men were enslaved on cocoa farms as children.

The Supreme Court ruled 8-1 against the plaintiffs, saying they had not proven the companies’ activities in the U.S. were sufficiently tied to the alleged child trafficking. The companies had argued that they could not be sued in the U.S. for activities that took place in West Africa.

Neal Katyal, former acting solicitor general under the Obama administration, represented the two companies and also argued that they could not be sued for complicity in child trafficking because they are corporations, not individuals.

Writing at Slate last December, Mark Joseph Stern called Katyal’s position “radical” and “extreme,” detailing the nine justice’s skepticism about his defense of the companies—but the court ultimately sided with him.

The plaintiffs, who are from Mali and say they are survivors of child trafficking and slavery in Côte d’Ivoire, filed their lawsuit under the Alien Tort Statute, an 18th century law which allows federal courts to hear civil actions filed by foreigners regarding offenses “committed in violation of the law of nations or a treaty of the United States.”

In recent years the Court has limited when the law can be invoked in court, arguing it cannot be used to file a lawsuit when the offense was committed “almost entirely abroad,” according to the New York Times.

Lawyers for the plaintiffs argued that Nestlé and Cargill have total control over the production of cocoa in Côte d’Ivoire, where child labor is widespread and where the men said they were forced to work long hours and to sleep in locked shacks at night.

The U.S. Department of Labor recently reported that the use of child labor on family farms in cocoa-growing areas of Côte d’Ivoire and Ghana increased from 31 percent to 45 percent between 2008 and 2019.

The corporations “should be held accountable for abetting a system of child slavery,” said Paul Hoffman, a lawyer for the plaintiffs.

The U.S. Court of Appeals for the 9th Circuit ruled in October 2018 that Nestlé and Cargill couldn’t avoid the lawsuits, but writing for the Supreme Court majority on Thursday, Justice Clarence Thomas said the plaintiffs had failed to establish that the companies’ conduct “occurred in the United States … even if other conduct occurred abroad” and that the companies made “major operational decisions” in the United States.

EarthRights International, which filed an amicus brief with the court on behalf of the plaintiffs, called the ruling “a giant step backward for U.S. leadership on international law and protecting human rights.”

“The ruling implies that U.S. corporations whose executives decide, from comfortable American boardrooms, to profit from murder, torture, and slavery abroad cannot be sued in U.S. federal courts for violating international law,” said Marco Simons, general counsel for the organization. “This ruling has disturbing implications for future victims of human rights abuses seeking justice against businesses in U.S. courts. This ruling also sets a dangerous precedent, giving corporations impunity for profiting from human rights abuses.”

Organizer Bree Newsome noted the irony of the ruling on the day the U.S. Congress passed legislation recognizing Juneteenth—the day Union soldiers arrived in Texas and informed Black people who had been enslaved that slavery had ended with the Civil War.

We’re celebrating “the end of slavery” but American companies are still profiting off of slave labor.

— DEFUND & ABOLISH POLICE, REFUND OUR COMMUNITIES (@BreeNewsome) June 17, 2021

https://thefreethoughtproject.com/scotus-tr-okay-megacorps-child-trafficking/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65061

File: b5aa02f28f9eee9⋯.png (192.86 KB,511x521,511:521,Clipboard.png)

Originally posted at >>>/qresearch/13932059 (181822ZJUN21) Notable: ‘It’s Always Jared’: Trump Regrets Trusting Kushner On Black Outreach, 2020 Riot Response – Report

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

‘It’s Always Jared’: Trump Regrets Trusting Kushner On Black Outreach, 2020 Riot Response – Report

"I’ve done all this stuff for the blacks - it’s always Jared telling me to do this. And they all f**king hate me, and none of them are going to vote for me.”

A new report claims that former President Donald Trump expressed resentment towards his son-in-law and senior advisor Jared Kushner for constantly pressuring him to pander to “the blacks,” noting, “And they all fucking hate me, and none of them are going to vote for me.”

Senior White House reporter Michael C. Bender makes the claim in a new book titled, Frankly, We Did Win This Election: The Inside Story of How Trump Lost. According to the book, Trump told a confidante, “I’ve done all this stuff for the blacks – it’s always Jared telling me to do this. And they all fucking hate me, and none of them are going to vote for me.”

Kushner’s push to appease violent Black Lives Matter rioters in the wake of the George Floyd death in Minnesota, coupled with his bungling of Trump’s 2020 re-election campaign, reportedly led Trump to avoid Kushner and complain about him in private during the summer of 2020.

Certain passages of the book appear to corroborate reporting in July 2020 that Trump became fed up with Kushner’s “woke s**t” after watching coverage by Fox News’ Tucker Carlson:

President Donald Trump reportedly regrets letting son-in-law Jared Kushner take the reigns on foreign and domestic policy, in light of the negative public response to the Trump administration’s ill-received efforts to placate Black Lives Matter rioters over the past month. Axios reported Wednesday that sources inside the White House say Trump wants “no more of Jared’s woke sh*t,” after several weeks of abysmal polling for the administration that indicates an uphill battle in the 2020 election, and no net increase in black voters.

Carlson, who became the most-watched cable news host of all time during the month of June, has repeatedly praised Trump’s instincts while contrasting said instincts unfavorably with Kushner’s policies, and the end result of enacting them. “Donald Trump may lose this election,” Carlson said last week, pointing out that despite virtue signalling for “criminal justice reform” from the White House, Black Lives Matter still polled significantly higher than the President.

https://nationalfile.com/its-always-jared-trump-regrets-trusting-kushner-on-black-outreach-2020-riot-response-report/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65062

File: 539b52126549f41⋯.png (290.35 KB,800x450,16:9,Clipboard.png)

Originally posted at >>>/qresearch/13932069 (181824ZJUN21) Notable: Senior NASA Scientist Gets Just 30 Days Prison for Lying to FBI About CCP Collaboration.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Senior NASA Scientist Gets Just 30 Days Prison for Lying to FBI About CCP Collaboration.

A senior NASA scientist has been sentenced to just 30 days in prison for lying about his Chinese university professorship and participation in a Chinese government program to the Federal Bureau of Investigation (FBI) and NASA.

Meyya Meyyappan, a 66-year-old from Pacifica, California, has worked for the National Aeronautics and Space Administration (NASA) since about 1996.

Around 2006, Meyyappan became the Chief Scientist, Exploration Technology at the Center for Nanotechnology, for NASA’s Ames Research Center at Moffett Field located in Silicon Valley, California.

Meyyappan, while employed by NASA, was subject to certain requirements, including prohibitions relative to travel, outside employment, and compensation. He “participated in China’s Thousand Talents Program, a program established by the Chinese government to recruit individuals with access to or knowledge of foreign technology or intellectual property.”

Meyyappan further held professorships for universities in South Korea, Japan, and China without telling either NASA or the U.S. Office of Government Ethics. Meyyappan later lied about these associations.

“On or about October 27, 2020, MEYYAPPAN was interviewed by the FBI, NASA OIG, and the USAO, in New York, New York. During that proffer session, MEYYAPPAN falsely stated, among other things, that he was not a member of the Thousand Talents Program and that he did not hold a professorship at a Chinese university. In truth and in fact, MEYYAPPAN was a member of the Thousand Talents Program and held a professorship at a Chinese university, funded by the Chinese government.”

He pleaded guilty to the charges against him on January 13, 2021, and was sentenced on June 16 to 30 days in prison for having made false statements to the FBI, NASA’s Office of Inspector General (NASA OIG), and the United States Attorney for the Southern District of New York (USAO). He was also ordered to pay a $100,000 fine.

“The privilege of access to cutting edge U.S. technologies and intellectual property comes with the critical responsibility of protecting their secrecy,” stated USAO Audrey Strauss. “Meyyappan betrayed that trust, by failing to disclose his foreign activities and then compounding his mistakes by lying to the FBI and NASA. He has now been sentenced to time in federal prison for his unlawful conduct.”

https://thenationalpulse.com/breaking/senior-nasa-scientist-gets-just-30-days-prison-for-lying-to-fbi-about-ccp-collaboration/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65063

File: cf4b3888d99c829⋯.png (535.75 KB,800x680,20:17,Clipboard.png)

File: 82cd3e254604af2⋯.png (77.38 KB,874x470,437:235,Clipboard.png)

Originally posted at >>>/qresearch/13932077 (181825ZJUN21) Notable: Wuhan Lab Found All Genes To Recreate ‘Epidemic Strain’ Of Coronavirus in 2017.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Wuhan Lab Found All Genes To Recreate ‘Epidemic Strain’ Of Coronavirus in 2017.

The Wuhan Institute of Virology – increasingly believed to be the source for the SARS CoV-2 coronavirus – obtained “all the genes to make a SARS coronavirus similar to the epidemic strain,” according to a 2017 report by Science News.

The article – “Bats in China carry all the ingredients to make a new SARS virus” – documents how a Wuhan Institute of Virology research team led by the Fauci-funded “bat lady” Shi Zhengli sampled wild bats.

Also cross-posted to the Wuhan lab’s website, the November 30th 2017 report reveals how data collected by Shi’s team enabled the lab to “make a SARS coronavirus similar to the epidemic strain”:

“After five years of surveying bats in a cave in southern China’s Yunnan Province, Zhengli Shi and colleagues discovered 11 new strains of SARS-related viruses in horseshoe bats (especially in Rhinolophus sinicus). Within the strains, the researchers found all the genes to make a SARS coronavirus similar to the epidemic strain, says Shi, a virologist at the Wuhan Institute of Virology, Chinese Academy of Sciences.

These new strains are more similar to the human version of SARS than were previously identified bat viruses, says Matthew Frieman, a virologist at the University of Maryland in Baltimore.

The article, which was recently wiped from the Wuhan Institute of Virology’s website, also notes that Shi and her colleagues found that “several of the strains” could grow in human cells.

“By analyzing the new viruses’ complete genetic makeup, Shi and her colleagues retraced the steps that might have given rise to the original SARS virus. A few spots in the viruses’ DNA seem particularly prone to rearrangement, so remixing happens often. The study suggests that recombination between viruses has shaped the evolution of SARS, says Baric.

Several of the strains could already grow in human cells, Shi’s team found. That indicates “there’s a chance that the viruses that exist in these bats could jump to people,” Frieman says. “Whether they will or not is anybody’s guess.”

https://thenationalpulse.com/news/wuhan-found-genes-to-make-epidemic-coronavirus/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65064

File: 50c01dd50a456a7⋯.png (111.24 KB,732x747,244:249,Clipboard.png)

Originally posted at >>>/qresearch/13932085 (181826ZJUN21) Notable: Maricopa County Audit Report Expected in August

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Maricopa County Audit Report Expected in August

The final report for the 2020 election audit taking place in Arizona’s largest county is not expected to be out until August, an official involved with the work says.

Led by Cyber Ninjas, which was hired by the Arizona Senate, auditors are working on evaluating ballots after finishing their ballot recount, save less than 100 braille ballots.

The ballot evaluation is supposed to wrap up by the end of June—the Senate is slated to vacate the Veterans Memorial Coliseum, where the audit is taking place, by July 1—but there will be a few weeks worth of additional work after that, Ken Bennett, a former Arizona Republican secretary of state, told The Epoch Times.

“We’ve got the remainder of June to do what we’re doing here at the coliseum. Then there’s a few weeks probably of work on checking the envelope signatures, and looking at voter registration anomalies, and this work that we want to do on the retabulation, so maybe that takes up some or most of July, and then the auditors are going to need a few to several weeks to put the report together,” said Bennett, the Arizona Senate’s liaison for the audit.

Cyber Ninjas, which has not returned requests for comment, said in documents sent to the Senate that it estimated the audit would take approximately 35 days, followed by a five-day period to produce the final report.

Auditors were set to start their 34th day of work on Friday. The audit started on April 23 but the teams had to leave the coliseum for approximately 9 days in May as high school graduations took place. Auditors resumed work on May 24.

No details about the final report are included in the documents from Cyber Ninjas. Bennett said the report would be “massive.”

“It’s going to very in-depth,” he added.

https://www.ntd.com/maricopa-county-audit-report-expected-in-august_629708.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65065

File: 48ee84a36cbdf8b⋯.jpg (382.65 KB,1284x1708,321:427,Clipboard.jpg)

File: d4b13ef26a0037d⋯.png (329.15 KB,714x560,51:40,Clipboard.png)

File: af25e5c0843b24a⋯.jpg (116.5 KB,1280x720,16:9,Clipboard.jpg)

File: 121f178d208c537⋯.png (347.61 KB,933x600,311:200,Clipboard.png)

File: 4b0aad86cc3ece8⋯.jpg (4.49 MB,4032x3024,4:3,Clipboard.jpg)

Originally posted at >>>/qresearch/13932091 (181828ZJUN21) Notable: RE: Think Reflection/Watch the water ( Scavino pics, Symbolism etc.)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65066

File: be584663a191e36⋯.png (605.55 KB,980x551,980:551,Clipboard.png)

Originally posted at >>>/qresearch/13932095 (181828ZJUN21) Notable: British Tory MP Imran Ahmad Khan charged with sexual assault of 15-year-old boy

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

British Tory MP Imran Ahmad Khan charged with sexual assault of 15-year-old boy

An MP for Britain’s Conservative Party has been charged with the sexual assault of a 15-year-old boy in 2008, it was revealed on Friday after reporting restrictions surrounding the case were lifted.

Tory MP for Wakefield, West Yorkshire, Imran Ahmad Khan appeared at Westminster Magistrates’ Court on Thursday, where he pleaded “not guilty” to the charge. The 47-year-old, who was elected in 2019, is accused of groping the teenager in the county of Staffordshire in the West Midlands.

In a statement on Friday the MP confirmed that a historic sexual assault allegation had been made against him and denied the accusation.

“May I make it clear from the outset that the allegation, which is from over 13 years ago, is denied in the strongest terms,” he said.

“This matter is deeply distressing to me and I, of course, take it extremely seriously.”

The alleged victim cannot be identified for legal reasons.

Khan is now due to appear at the Central Criminal Court at London’s Old Bailey on July 15 after the magistrate judge referred the case for trial.

https://www.rt.com/uk/526986-british-tory-mp-sexual-assault-charge/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65067

File: f7291d9a0d0ceaf⋯.jpeg (163.29 KB,1199x801,1199:801,Clipboard.jpeg)

File: 63d668ffe702183⋯.png (117.48 KB,697x411,697:411,Clipboard.png)

File: 70f2573457c23c1⋯.png (575.46 KB,598x778,299:389,Clipboard.png)

Originally posted at >>>/qresearch/13932141 (181838ZJUN21) Notable: USSOCOM 3 YEAR Q DELTA (autist contribution?)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

USSOCOM 3 YEAR Q DELTA

Ok anons, heres my autist contribution for the day

https://twitter.com/USSOCOM/status/1405901881302474753

2d Ranger Battalion are wearing orange diamond “two” patches on the back of their helmets this month paying tribute to the WWII-era Rangers of the 2nd and 5th Battalions who painted an orange diamond on the back of their helmet with a black numeral indicating their battalion.

>orange diamond “two”

[O]range [D]iamond [two]

O = 15

D = 4

Two = 2

Q1542 18-Jun-2018 12:32:42 AM EDT

*See Attached

https://qposts.online/?q=1542

yes i got the message sirs, ty. o7

not sure who needed to see this.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65068

File: 7aa80f5e3ef7234⋯.png (564.07 KB,1028x553,1028:553,Clipboard.png)

Originally posted at >>>/qresearch/13932142 (181838ZJUN21) Notable: Act-IL Initiative Dig

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Israel's war on truth - paid shills and trolls underneath your comments

https://brandnewtube.com/watch/israel-039-s-war-on-truth-paid-shills-and-trolls-underneath-your-comments_jgoAKQPkvwy3tCC.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65069

Originally posted at >>>/qresearch/13932152 (181840ZJUN21) Notable: US Senate passes bill to give billions of dollars in funding for human-animal hybrid experiments

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

US Senate passes bill to give billions of dollars in funding for human-animal hybrid experiments

'We shouldn’t need to clarify in law that creating animal-human hybrids or "chimeras" is ethically unthinkable, but sadly the need for that very clear distinction has arrived,' said Senator James Lankford.

The U.S. Senate has passed a bill which will allocate billions of dollars to the National Institutes of Health (NIH), with some of the funds expected to go toward a disturbing form of research whereby tissue from aborted babies is spliced with animal cells to create mixed-species organisms called “chimeras.”

Introduced by Senate Majority Leader Chuck Schumer (D-New York), the U.S. Innovation and Competition Act (USICA), also called the “Endless Frontier Act,” was passed by the Senate in a 68-32 vote June 9.

Supposed to address growing Chinese technological competition by increasing investment in American innovation in science and technology to the tune of $250 billion, the bill had been hotly debated on the Senate floor for weeks, with over 600 amendments being proposed before last week’s vote.

Although the measure passed with significant bipartisan support, it had drawn fire from Senate Republicans concerned about the possible ethical implications of some of the bill’s intended spending.

One of their concerns had to do with the bill’s proposed funding for the National Institutes of Health, which has long considered lifting its moratorium on conducting chimeric experiments pending new guidelines from the International Society for Stem Cell Research (ISSCR).

In response to concern that the NIH will shortly lift its stay on the unethical research, Senators Mike Braun, Steve Daines, and James Lankford proposed an amendment to the bill which would criminalize the creation of animal-human hybrid organisms.

“We shouldn’t need to clarify in law that creating animal-human hybrids or ‘chimeras’ is ethically unthinkable, but sadly the need for that very clear distinction has arrived,” said Senator Lankford (R-OK), who recently observed the 48th anniversary of Roe v. Wade by giving a 20-minute biology lesson on the Senate floor demonstrating the personhood of unborn babies to pro-abortion Democrats.

“In trying to compete with China, we shouldn’t become like them,” Senator Daines (R-MT) warned. “It’s critical that we draw a bright line against unethical forms of research that fail to recognize the distinct value of humans over animals.”

The NIH’s chimeric research plans had been stymied by a 2019 Trump Administration policy which had shut down the acquisition of human fetal tissue from elective abortions for research and instituted an ethics board to review any such research at labs and universities.

But in April 2021 the NIH announced it was reversing the policy, permitting the acquisition of new fetal tissue from abortions for research and abolishing the ethics board requirement.

Just a month later the ISSCR put out its much-anticipated new guidelines which explicitly allow and provide guidance for chimera research. The NIH is expected to adopt the new guidelines.

To date the NIH has not lifted its moratorium, and it does not directly fund chimera research. However private chimeric research is actively underway in American universities, producing a number of disturbing results. In May 2020 a mouse embryo composed of 96% animal cells and 4% human cells was created by researchers from the State University of New York at Buffalo and the Roswell Park Comprehensive Cancer Center.

In April 2021 researchers with the Salk Institute in California injected 25 induced pluripotent stem cells (IPS cells) from humans into macaque monkey embryos in a grotesque Frankenstein-like chimeric experiment resulting in the creation of human-monkey embryos.

“Currently the National Institutes of Health does not do this research and we need to keep it that way,” Sen. Lankford said, “Researchers who are attempting these horrific once-science-fiction experiments should focus on valuing the dignity of human life, not trying to genetically merge and manipulate humans and animals.”

https://www.lifesitenews.com/news/us-senate-passes-bill-to-give-billions-of-dollars-in-funding-for-human-animal-hybrid-experiments

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65070

File: 6724715e9d1fb5c⋯.png (91.27 KB,752x576,47:36,Clipboard.png)

Originally posted at >>>/qresearch/13932166 (181843ZJUN21) Notable: HUNDREDS of fully vaccinated healthcare workers get COVID; dozens are HOSPITALIZED… 28.6% of deaths from the Delta variant of COVID-19 in the UK occurred in fully vaccinated individuals

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Effective: HUNDREDS of fully vaccinated healthcare workers get COVID; dozens are HOSPITALIZED… 28.6% of deaths from the Delta variant of COVID-19 in the UK occurred in fully vaccinated individuals

Hundreds of Indonesian healthcare workers contract COVID-19 despite vaccination, dozens hospitalised

JAKARTA, June 17 (Reuters) – More than 350 Indonesian doctors and healthcare workers have contracted COVID-19 despite being vaccinated with Sinovac and dozens have been hospitalised, officials said, as concerns rise about the efficacy of some vaccines against more virulent virus variants.

Most were asymptomatic and self-isolating at home, said Badai Ismoyo, head of the Kudus district health office in Central Java, but dozens were in hospital with high fevers and declining oxygen saturation levels.

Kudus is battling an outbreak believed to be driven by the more transmissible Delta variant which has pushed bed occupancy rates above 90% in the district.

Designated as a priority group, Indonesian healthcare workers were among the first to be vaccinated when the inoculation drive started in January.

28.6% of deaths from the Delta variant of COVID-19 in the UK occurred in fully vaccinated individuals

More than 90% of Covid cases in the UK are now down to the coronavirus Delta variant first discovered in India, data has revealed, as the total number of confirmed cases passed 42,000.

Also known as B.1.617.2, the Delta variant has been linked to a rise in Covid cases in the UK in the past weeks. It is believed to spread more easily than the Alpha variant, B.1.1.7, that was first detected in Kent, and is somewhat more resistant to Covid vaccines, particularly after just one dose. It may be also associated with a greater risk of hospitalisation.

Now, Public Health England (PHE) has said that more than 90% of new Covid cases in the UK involve the Delta variant. Indeed the most recent data suggests the figure could be as high as 96% of new cases in England.

Royal Caribbean Postpones Cruise After Eight Vaccinated Crew Members Test Positive for COVID

The ship, the Odyssey of the Seas, seems to be snakebit. It was initially supposed to sail from Haifa, Israel, on June 2 but that trip was canceled due to “unrest” in the region. They decided to try again on July 3, disembarking from Port Everglades.

That’s off now too due to a bunch of positive tests for COVID among the crew, all of whom had been vaccinated.

https://www.investmentwatchblog.com/effective-hundreds-of-fully-vaccinated-healthcare-workers-get-covid-dozens-are-hospitalized-28-6-of-deaths-from-the-delta-variant-of-covid-19-in-the-uk-occurred-in-fully-vaccinated-individuals/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65071

File: 214d323ac57b2d6⋯.png (122.48 KB,1021x697,1021:697,Clipboard.png)

File: 5a459cd4de8b4e6⋯.png (676.8 KB,1556x718,778:359,Clipboard.png)

File: cd1acae07ab1a59⋯.png (77.61 KB,351x226,351:226,Clipboard.png)

Originally posted at >>>/qresearch/13932198 (181848ZJUN21) Notable: Act-IL Initiative Dig

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Act-IL Initiative

Act-IL leads an online community that acts on social media platforms, fighting antisemitism and positively influencing the narrative regarding Israel.

https://www.abbaeban.idc.ac.il/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65072

File: 018dd43792b00bc⋯.png (93.87 KB,656x538,328:269,Clipboard.png)

Originally posted at >>>/qresearch/13932209 (181850ZJUN21) Notable: Here's How Much the Pentagon Has Spent So Far to Treat Transgender Troops

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Here's How Much the Pentagon Has Spent So Far to Treat Transgender Troops

The Pentagon has spent $15 million in the past five years to treat 1,892 transgender troops, including $11.5 million for psychotherapy and $3.1 million for surgeries, according to Defense Department data provided to Military.com

Of the 243 gender reassignment surgeries performed on military personnel since 2016, 50 took place between Jan. 1, 2016 and Dec. 31, 2017, and 193 occurred from Jan. 1, 2018 to Dec. 31, 2019 – the two years after President Donald Trump announced via Twitter that he would bar transgender individuals from serving in the U.S. military.

According to the Defense Health Agency, the surgeries were performed in military health facilities and included removal of breasts or testicles, hysterectomies and labiaplasty – creation of or reshaping the flesh around a vagina.

The total number of transgender persons serving in the armed forces across all three components active-duty, Reserve and National Guard is not known as not all likely have sought treatment.

But as of May, 1,892 military personnel have been diagnosed and treated for gender dysphoria, including 726 Army soldiers, 576 Navy sailors, 449 Air Force airmen and 141 Marines, according to DHA spokesman Peter Graves.

The Palm Center, a public policy think tank that focuses on LGBT issues, estimated in 2018 that 14,707 transgender troops serve in the U.S. armed forces, including nearly 9,000 on active duty and 5,727 in the reserves.

In 2016, then-Defense Secretary Ash Carter announced that transgender people already serving in the military would be allowed to serve openly and transgender individuals were allowed to enlist as of July 1, 2017.

Trump announced via tweet in July 2017 that planned to ban transgender people from serving in the U.S. military, saying he consulted with military leaders and military experts before deciding that DoD did not need to be "burdened with the tremendous medical costs and disruption that transgender in the military would entail."

A policy was released by then-Secretary of Defense James Mattis in 2018 that prohibited individuals diagnosed with gender dysphoria from serving, with exceptions. It also said that transgender persons who didn't have the gender dysphoria defined as extreme anxiety or distress that may accompany a person's desire to be the opposite gender could serve, but only in their birth gender.

A number of lawsuits were filed over the policy, which was upheld by the U.S. Supreme Court in January 2019.

President Joe Biden reversed the policy on his fifth day in office, Jan. 25, 2021.

https://www.military.com/daily-news/2021/06/18/heres-how-much-pentagon-has-spent-so-far-treat-transgender-troops.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65073

File: 249dc74c73d204a⋯.png (183.92 KB,1258x261,1258:261,Clipboard.png)

File: ee4e304cd81f20a⋯.png (129.68 KB,420x419,420:419,Clipboard.png)

File: 81a70fce8d235f4⋯.png (3.68 MB,1379x2025,1379:2025,Clipboard.png)

File: 2f598bb646f0325⋯.png (2.04 MB,1647x697,1647:697,Clipboard.png)

Originally posted at >>>/qresearch/13932213 (181851ZJUN21) Notable: RE: Think Reflection/Watch the water ( Scavino pics, Symbolism etc.)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13932140

das-sting$

>>>/qresearch/13932187

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65074

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13932223 (181853ZJUN21) Notable: Katy Perry & Orlando Bloom: Transmissions from the Future

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.youtube.com/watch?v=nKoKeHceakQ

>Q

Katy Perry & Orlando Bloom: Transmissions from the Future

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65075

Originally posted at >>>/qresearch/13932237 (181857ZJUN21) Notable: Israel to give Palestinians a million vaccines, Palestinians reject offer

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Israel to give Palestinians a million vaccines, Palestinians reject offer

When the Palestinian Authority gets its order of 1.4 million doses of the Pfizer vaccine in September or October, one million of them will go to Israel.

https://www.jpost.com/breaking-news/vaccine-exchange-deal-between-israel-and-pa-has-been-announced-671413

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65076

File: 0f67baccbfbba08⋯.png (34.33 KB,737x841,737:841,Clipboard.png)

File: 5f871234f8b3a4f⋯.png (29.53 KB,762x774,127:129,Clipboard.png)

File: 706377243506901⋯.png (35.45 KB,748x847,68:77,Clipboard.png)

File: 59b1a1fe373897a⋯.png (37.45 KB,751x867,751:867,Clipboard.png)

Originally posted at >>>/qresearch/13932247 (181900ZJUN21) Notable: Georgia investigator's notes reveal 'massive' election integrity problems in Atlanta

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Georgia investigator's notes reveal 'massive' election integrity problems in Atlanta

Twenty-nine page memo obtained by Just the News cites double counting, insecure storage, "massive chain of custody problem" and a worker's threat to "f*ck sh*t up."

In a nationally televised interview in January, Georgia Secretary of State Brad Raffensperger rattled off an impressive list of measures his state used to ensure the November election count was accurate. "We had safe, secure, honest elections," he declared to "60 Minutes."

That rosy assessment, however, masked an ugly truth inside his agency's own files: A contractor handpicked to monitor election counting in Fulton County wrote a 29-page memo back in November outlining the "massive" election integrity failures and mismanagement that he witnessed in the Atlanta-area's election centers.

The bombshell report, constructed like a minute-by-minute diary, cited a litany of high-risk problems such as the double-counting of votes, insecure storage of ballots, possible violations of voter privacy, the mysterious removal of election materials at a vote collection warehouse, and the suspicious movement of "too many" ballots on Election Day.

"This seems like a massive chain of custody problem," the contractor Carter Jones warned in the memo delivered by his firm Seven Hill Strategies to Raffensperger's office shortly after the election.

That glaring notation was written around 4:00 p.m. on Election Day, when Jones observed absentee ballots arriving at the county's central absentee scanning center at Atlanta's State Farm Arena "in rolling bins 2k at a time."

"It is my understanding is that the ballots are supposed to be moved in numbered, sealed boxes to protect them," he wrote, noting these ballots weren't.

He also feared the flow of absentee ballots seemed too voluminous. "Too many ballots coming in for secure black ballot boxes," he observed.

You can read the full report obtained by Just the News from the Secretary of State's office here.

File

Unabridged Notes.pdf

Jones also raised concerns about the temporary workers brought in by a firm called Happy Faces to scan and count ballots after an election observer purported to witness a conversation in an elevator in which one of the workers revealed his intention to "f*ck sh*t up."

"I must keep an eye on these two," Jones wrote. "Perhaps this was a bad joke, but it was very poorly timed in the presence of a poll watcher."

He wrote that the two suspect workers had been assigned to a "team confirming and boxing ballots that have already been scanned to prepare them for later audit" because "this is the place where they could do least to achieve their declared objective."

But Jones expressed larger concerns about the temporary staffing agency's recruitment of workers. "What is Happy Faces doing to vet the people who they are sending to make sure that they are not sending in people who do actually want to 'f*ck sh*t up?'" he asked.

https://justthenews.com/politics-policy/elections/ga-investigators-election-day-notes-reveal-chaotic-unsecured-ballot

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65077

File: b265c7156b3f570⋯.png (752.5 KB,800x500,8:5,Clipboard.png)

File: 76de7c05d49a0f6⋯.png (3.68 MB,1120x1500,56:75,Clipboard.png)

File: 4573bcf88b80b39⋯.png (1.7 MB,1613x839,1613:839,Clipboard.png)

Originally posted at >>>/qresearch/13932258 (181902ZJUN21) Notable: RE: Think Reflection/Watch the water ( Scavino pics, Symbolism etc.)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65073

>>>/qresearch/13932226

>born from the water

Irish Mermaid - of the WATER, symbaalizms >>>/qresearch/13932140

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65078

File: 9bfd51859bce374⋯.png (50.78 KB,669x311,669:311,Clipboard.png)

Originally posted at >>>/qresearch/13932275 (181904ZJUN21) Notable: 80% of the people in the group who plotters to "kidnap MI Gov Gretchen Whitmer" were FBI agents.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Robert Patrick Lewis

@RobertPLewis

80% of the people in the group who plotters to "kidnap MI Gov Gretchen Whitmer" were FBI agents.

All of the plans & ideas came from those agents.

Really think about that in regards to the reporting on potential FBI involvement in Jan 6.

https://twitter.com/RobertPLewis/status/1405948691664408577

Its this true, frens?

80% were agents?

Does anyone have sauce on that?

Many thanks

o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65079

File: 933746460c012cd⋯.png (412.66 KB,598x569,598:569,Clipboard.png)

Originally posted at >>>/qresearch/13932279 (181905ZJUN21) Notable: 'Pee-wee's Playhouse' star John Paragon dead at 66

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

'Pee-wee's Playhouse' star John Paragon dead at 66

https://twitter.com/nypost/status/1405869978771984385

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65080

File: 3f834d76c43774c⋯.png (50.8 KB,748x480,187:120,Clipboard.png)

File: b006c63d1f274a1⋯.png (57.72 KB,748x504,187:126,Clipboard.png)

Originally posted at >>>/qresearch/13932286 (181906ZJUN21) Notable: The Dems. taking each other down

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Biden: "That's a private matter and I don't think that's gonna happen."

Answer to reporter asking about his feelz about Catholic bishops banning him from communion because of abortion beliefs.

Anon thinks it's gunna happen.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65081

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13932291 (181907ZJUN21) Notable: EU approval of Russia's Sputnik V vaccine delayed, sources say

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

This message will resonate with those that comprehend the hybrid/hubrid breeding programs, the "alien bloodline" ""essence"" within a 'human.'

The Russian covid vaccine was manufactured to eliminate the evil from within. Sputnik V vaccine. The V is for "vlash'(one of the evil that walks among us looking like humans, but they are not)

Sputnik V will go to other countries where there are 'nests/hives' and it will too cause complication only for those who have that Vlash evil essence within them. The essence is like a switch that can be activated at any time in the DNA. ((News a couple days ago, EU approved the Sputnik V vaccine))

The Cause are the white hats defeating the black hats.

The highest country with those hubrids/hubrids with 'bloodline essence' of evil reside in China.

This vid was re done after Sputnik V death figures were released in news and added to vid.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65082

File: 3971dafba25d14c⋯.png (593.01 KB,1280x721,1280:721,Clipboard.png)

File: fd892fd5a50e090⋯.png (483.43 KB,1024x618,512:309,Clipboard.png)

Originally posted at >>>/qresearch/13932305 (181910ZJUN21) Notable: PFIZER ??? PIPELINE

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13932262

PFIZER ??? PIPELINE

https://seekingalpha.com/article/4270285-hold-pfizer-market-performer-income

http://labiotech.eu/novartis-attacks-amgen-roche-pfizer-biosimilar-war/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65083

File: 7be54158483aef0⋯.png (141.85 KB,640x340,32:17,Clipboard.png)

File: 68612bdfb73eb3e⋯.png (171.85 KB,595x521,595:521,Clipboard.png)

File: b0acacf2968d0e0⋯.png (297.87 KB,688x624,43:39,Clipboard.png)

File: c15a6c037ceed86⋯.png (25.33 KB,701x618,701:618,Clipboard.png)

Originally posted at >>>/qresearch/13932306 (181910ZJUN21) Notable: CDC Delays Emergency Meeting On Post-Vaccine Heart Inflammation to 'Observe Juneteenth'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CDC Delays Emergency Meeting On Post-Vaccine Heart Inflammation to 'Observe Juneteenth'

The Centers for Disease Control and Prevention is delaying their "emergency meeting" on post-mRNA vaccination heart inflammation that was scheduled for Friday in order to observe the new federal holiday Juneteenth.

From The Epoch Times:

President Joe Biden signed a bill on Thursday making June 19 a new holiday, Juneteenth. Shortly afterwards, the CDC said its June 18 meeting "is being rescheduled due to the observation of the Juneteenth National Independence Day holiday."

A federal office said Thursday that because June 19 falls on a Saturday this year, the observation will take place on Friday.

The meeting, which was deemed an emergency when announced last week, will now be folded into a June 23 to June 25 virtual meeting, the CDC said.

This should give you an idea of how seriously CDC director Rochelle Walensky is taking these cases, that is to say, she literally couldn't care less.

As some 800 reports were pouring in of youths experiencing potentially-deadly heart inflammation, the CDC on June 10 announced they were scheduling an "emergency meeting" for over a week later on June 18.

https://www.informationliberation.com/?id=62312

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65084

File: 3d77cf0e50abb86⋯.png (31.6 KB,533x590,533:590,Clipboard.png)

Originally posted at >>>/qresearch/13932307 (181910ZJUN21) Notable: EU approval of Russia's Sputnik V vaccine delayed, sources say

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65081

EU approval of Russia's Sputnik V vaccine delayed, sources say

https://www.reuters.com/world/europe/eu-approval-russias-sputnik-v-vaccine-delayed-sources-say-2021-06-16/

The elite in EU think they can drag this out for their survival Kek

They have no idea their party is over.

God Won, its time to clean up their mess for good.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65085

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13932368 (181924ZJUN21) Notable: 'Pee-wee's Playhouse' star John Paragon dead at 66

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65079

>'Pee-wee's Playhouse' star John Paragon dead at 66

At SIXTY-SIX you say? Well we know he was a perv who wacked off in a theater for 'wacking off' but was he a diddler too? Probably he was 'famous' & most likely in the 'club' in some way or form.

Sad - anon grew up in the 80's & much of what I cherished as a child is garbage now

>Stay Tuned.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65086

File: 3c1a856790dfec0⋯.png (1021.74 KB,984x1665,328:555,Clipboard.png)

Originally posted at >>>/qresearch/13932394 (181931ZJUN21) Notable: Who was in charge at DIA during Hussein's occupation?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/EmeraldRobinson

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65087

Originally posted at >>>/qresearch/13932405 (181935ZJUN21) Notable: Could Chinese Vice-Premier be the Source Of Hunter Bidens Hardrives?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13932257

They were saying that he had contents from Hunter Bidens Hard Drive. Remember the Lude Media reposts of the contents of his hard drive. Could this be the source of those three hard drives? This was back in December 2020 . So maybe this is just the Public Story about what has happened??

Lude Media: Hard Drive Content Exposes US Treasury Secretary Mnuchin’s Collusion with Xi Jinping

GNews, October 22, 2020

During the evening show on October 19, 2020, Lude disclosed that two members of President Trump’s cabinet had been bribed by Xi Jinping, and one of them was Secretary of the Treasury, Steven Mnuchin. Based on Lude, Mnuchin has deeply colluded with the CCP. Here is a summary of Lude’s program on Mnuchin.

“As the Hard Drive Gate continues to ferment, the Whistleblower Movement has entered the deep water zone by touching the deep state of the United States and exposing the force in the American capital market which has been deeply intertwined with the CCP behind the surface.” In the show, Lude revealed that Stephen Mnuchin had been bribed by Xi to engage with the CCP and advised on Biden’s campaign.

1. The hard drive(s) contains all the data about the collusion between Treasury Secretary Mnuchin and the CCP over the past several years.

2.The hard drive(s) also contains indecent videos and photos of Mr. Mnuchin with underage girls.

3. Mnuchin took orders from Xi, cooperated with the CCP to control the US stock market, and has obtained huge profits from it. Mingzhe Ma of Ping An Insurance Group Co. (http://www.pingan.cn) was involved in this.

4. Mnuchin gave advice to Xi on the establishment of digital currency blockchain in China.

5. He has coached Joe Biden to publicly declare Xi as a “hooligan” in order to win the election.

Based on Steven Mnuchin’s public profile, he previously worked for Goldman Sachs for 17 years. This company has deeply colluded with the CCP since the 90’s. As a high rank employee who worked there for so many years, he must be part of this collusion. According to the info from the Whistleblower Movement, Goldman Sachs has been involved in a number of Chinese concept stock listings and also helped the CCP launder money and move assets overseas.

https://fromthetrenchesworldreport.com/lude-media-hard-drive-content-exposes-us-treasury-secretary-mnuchins-collusion-with-xi-jinping/278939

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65088

Originally posted at >>>/qresearch/13932412 (181937ZJUN21) Notable: RE: Covid Vax/Blood cells/Spike Proteins, Is This Verifiable? Contagious?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13932391

https://t.me/AdamBigelsen/7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65089

File: 8d0b69f6f37fb16⋯.png (24.38 KB,636x250,318:125,Clipboard.png)

Originally posted at >>>/qresearch/13932514 (182008ZJUN21) Notable: Atheist activist group wants Bible removed from POW-MIA table at naval facility

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Atheist activist group wants Bible removed from POW-MIA table at naval facility: 'Not every sailor is a white, straight Anglo-Saxon Christian male'

An atheist activist group is ordering a naval facility to remove a Bible from a POW-MIA table as its presence goes against the military's core values and hurts unity, morale, and diversity, Stars and Stripes reported.

The Military Religious Freedom Foundation last week sent a letter to Capt. John Montagnet — commander of Naval Air Facility Atsugi in Japan — after receiving 15 complaints about the Bible from personnel at the installation, MRFF founder Michael Weinstein told the paper.

The MRFF also sent the letter to Army Gen. Mark Milley, chairman of the Joint Chiefs of Staff, as well as acting Secretary of the Navy Thomas Harker, Stars and Stripes said.

POW-MIA tables — which honor missing and captured service members — often are set up in military dining facilities, the paper said, adding that official instructions concerning such tables say they must be round and include a white tablecloth, an empty chair, a black napkin, a single red rose, a yellow candle and ribbon, lemon slices, salt, and an overturned wine glass.

Stars and Stripes added that the regulation also says the displays include a Bible to represent "faith in a higher power and the pledge to our country, founded as one nation under God."

Weinstein, an Air Force veteran, told the paper "this is not a move against Christianity, but one toward inclusivity. Not every sailor is a white, straight Anglo-Saxon Christian male."

Weinstein noted to Stars and Stripes that he hadn't received a response from NAF Atsugi as of Monday.

What did the naval facility have to say?

Base spokesman Sam Samuelson told paper Monday he wasn't aware of the letter.

"The POW-MIA table here is a significant legacy display intended to memorialize and honor American POWs and MIAs among a varied military demographic and is certainly greater than the sum of its parts," Samuelson told Stars and Stripes. "We can absolutely balance the larger meaning of the table with appropriate policies and the interests of our diverse base culture."

More from the paper:

Over the past five years, the MRFF's petitions resulted in the removal of Bibles from POW-MIA tables at Wright Patterson Air Force Base, Ohio; four Veterans' Administration offices in Pennsylvania, Texas and Ohio; and an allergy clinic at Eglin Air Force Base, Fla.

In 2018, the MRFF filed an inspector general complaint against the Navy over a Bible that was included in a POW-MIA table display at U.S. Naval Hospital Okinawa.

In May of 2019, the MRFF backed a federal lawsuit filed against the Manchester Veterans Administration Medical Center in New Hampshire for including a Bible on its POW-MIA table following complaints relayed through the foundation.

Weinstein said the goal of the MRFF is not to eliminate Bibles, but to promote religious diversity.

https://www.theblaze.com/news/atheist-group-bible-pow-mia-table

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65090

Originally posted at >>>/qresearch/13932522 (182008ZJUN21) Notable: DIA discussion

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

If the so called Dong has been feeding the DIA information for a while now I'm guessing if all the information he has leaked could be coroborated it would tie in to Q Drops on Deltas or Posts within that timeframe.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65091

File: 1f815b0bdb1d4c2⋯.png (85.06 KB,692x810,346:405,Clipboard.png)

Originally posted at >>>/qresearch/13932529 (182010ZJUN21) Notable: Little Eagle South Dakota Man Indicted for Aggravated Sexual Abuse of Child

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Little Eagle Man Indicted for Aggravated Sexual Abuse of Child

https://www.justice.gov/usao-sd/pr/little-eagle-man-indicted-aggravated-sexual-abuse-child

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65092

File: 5605242a68c2c2c⋯.png (370.21 KB,666x862,333:431,Clipboard.png)

Originally posted at >>>/qresearch/13932541 (182011ZJUN21) Notable: Large TB Outbreak may because by surgical Bone Repair Product-FiberCel Aziyo Biologics, Inc.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Early this month, the maker of FiberCel, Aziyo Biologics Inc., issued a recall of a single lot of the product after one hospital reported that seven out of 23 patients who received FiberCel developed post-surgical infections, and four of these tested positive for TB, according to the recall notice from the Food and Drug Administration (FDA).

The recalled lot came from a single donor cadaver, and it had been shipped to 20 states, according to a statement from Aziyo Biologics. A total of 113 patients received the recalled product, with most suspected TB cases in Indiana and Delaware, the Post reported.

https://www.livescience.com/tuberculosis-outbreak-bone-repair-product-surgery.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65093

File: 2830142258f6cab⋯.png (36.09 KB,980x648,245:162,Clipboard.png)

Originally posted at >>>/qresearch/13932554 (182014ZJUN21) Notable: Organ Harvesting in China

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

UN Experts “Extremely Alarmed” by Alleged Organ Harvesting in China

Human rights experts from the United Nations expressed Monday their “extreme alarm” over alleged organ harvesting in China, targeting minorities like Falun Gong practitioners, Uyghurs, Tibetans, Muslims and Christians while they were held in detention, according to a press release.

This marks the most significant acknowledgement of these alleged atrocities since the China Tribunal, an independent people’s tribunal, released its final judgement in March of 2020.

The Tribunal was established to inquire into forced organ harvesting from, amongst others, prisoners of conscience in China and to investigate what criminal offences, if any, have been committed by state or state-approved bodies, organizations or individuals in China that may have engaged in forced organ harvesting.

The tribunal’s full judgement detailed evidence from over 50 witnesses and determined that based on the number of organ transplants performed and the “impossibility” of accessing enough donors, there was “direct and indirect evidence of forced organ harvesting.”

These minorities were allegedly forced into blood tests, ultrasounds and X-rays to examine their organs after being arrested, many times without explanation.

“According to the allegations received, the most common organs removed from the prisoners are reportedly hearts, kidneys, livers, corneas and, less commonly, parts of livers,” the experts said. “This form of trafficking with a medical nature allegedly involves health sector professionals, including surgeons, anaesthetists and other medical specialists.”

U.N. experts called on China to answer these allegations and asked that the country allow “independent monitoring by international human rights mechanisms.”

The China Tribunal took a tougher stance on the allegations.

https://www.occrp.org/en/daily/14667-un-experts-extremely-alarmed-by-alleged-organ-harvesting-in-china

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65094

File: 02a4ca6dd2fef90⋯.png (258.23 KB,565x508,565:508,Clipboard.png)

Originally posted at >>>/qresearch/13932566 (182017ZJUN21) Notable: Catholic Bishops Taking Steps to Prevent Biden From Receiving Communion

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

“That’s a Private Matter” – Biden Looks Like a Deer in Headlights When Asked About Catholic Bishops Taking Steps to Prevent Him From Receiving Communion

Joe Biden looked spooked on Friday when a reporter asked him about Catholic Bishops taking steps to prevent him from receiving Holy Communion.

U.S. Catholic bishops have approved the drafting of a “teaching document” that will prevent Joe Biden and other pro-abortion politicians from receiving Communion for their support for the practice.

The vote was overwhelmingly in favor of the move, with 168 in favor and 55 against. It was announced on Friday at the end of the three-day meeting of the U.S. Conference of Catholic Bishops, following their vote on Thursday.

Blood drained from Joe Biden’s face on Friday when a reporter asked him about his impending doom during a presser on Covid.

“That’s a private matter. I don’t think it’s going to happen,” Biden said.

That look on Biden’s face says it all!

https://www.thegatewaypundit.com/2021/06/private-matter-biden-looks-like-deer-headlights-asked-catholic-bishops-taking-steps-prevent-receiving-communion-video/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65095

File: d96768f0e8c003c⋯.jpg (143.09 KB,650x595,130:119,Clipboard.jpg)

Originally posted at >>>/qresearch/13932571 (182017ZJUN21) Notable: Top Chinese official defected to the US with Wuhan lab secrets

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

So now we know why Buzzfeed and WaPo released the Fauci emails. They were getting ahead of the Dong story.

-Daily Mail

Has a top Chinese official defected to the US with Wuhan lab secrets? Rumors swirl vice minister of State Security fled Beijing in February with information that sparked Biden u-turn on COVID origins

https://www.dailymail.co.uk/news/article-9699221/Has-Chinese-official-defected-Rumors-swirl-diplomat-told-DC-Wuhan-lab.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65096

Originally posted at >>>/qresearch/13932575 (182019ZJUN21) Notable: DIA discussion

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65090

I think this is the same information that had come out at the end of 2020 that Lude Media was reporting on. They had said there were three hard drives at the time. Hunter Bidens, one with coronavirus information on it, and one that had real estate holdings in the US. Trying to find more info all i got is this right now.

Lude Media: Hard Drive Content Exposes US Treasury Secretary Mnuchin’s Collusion with Xi Jinping

GNews, October 22, 2020

During the evening show on October 19, 2020, Lude disclosed that two members of President Trump’s cabinet had been bribed by Xi Jinping, and one of them was Secretary of the Treasury, Steven Mnuchin. Based on Lude, Mnuchin has deeply colluded with the CCP. Here is a summary of Lude’s program on Mnuchin.

“As the Hard Drive Gate continues to ferment, the Whistleblower Movement has entered the deep water zone by touching the deep state of the United States and exposing the force in the American capital market which has been deeply intertwined with the CCP behind the surface.” In the show, Lude revealed that Stephen Mnuchin had been bribed by Xi to engage with the CCP and advised on Biden’s campaign.

1. The hard drive(s) contains all the data about the collusion between Treasury Secretary Mnuchin and the CCP over the past several years.

2.The hard drive(s) also contains indecent videos and photos of Mr. Mnuchin with underage girls.

3. Mnuchin took orders from Xi, cooperated with the CCP to control the US stock market, and has obtained huge profits from it. Mingzhe Ma of Ping An Insurance Group Co. (http://www.pingan.cn) was involved in this.

4. Mnuchin gave advice to Xi on the establishment of digital currency blockchain in China.

5. He has coached Joe Biden to publicly declare Xi as a “hooligan” in order to win the election.

Based on Steven Mnuchin’s public profile, he previously worked for Goldman Sachs for 17 years. This company has deeply colluded with the CCP since the 90’s. As a high rank employee who worked there for so many years, he must be part of this collusion. According to the info from the Whistleblower Movement, Goldman Sachs has been involved in a number of Chinese concept stock listings and also helped the CCP launder money and move assets overseas.

https://fromthetrenchesworldreport.com/lude-media-hard-drive-content-exposes-us-treasury-secretary-mnuchins-collusion-with-xi-jinping/278939

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65097

File: 55f8a7092f5ab7a⋯.png (46.94 KB,749x836,749:836,Clipboard.png)

File: 9a2b7c8cf025321⋯.png (30.52 KB,740x571,740:571,Clipboard.png)

File: a94c9a212faee68⋯.png (2.39 MB,1280x853,1280:853,Clipboard.png)

Originally posted at >>>/qresearch/13932685 (182033ZJUN21) Notable: Former Chinese general owns 200 square miles in Texas next to Laughlin Air Force Base

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Former Chinese general owns 200 square miles in Texas next to Air Force Base

A Chinese firm run by a former officer in the People’s Liberation Army has purchased 130,000 acres of land in Texas which is situated near one of the busiest Air Force pilot training bases in the nation, an analyst said.

If this seems like it might be an issue for U.S. national security, read on.

Sun Guangxin, who has close ties to the Chinese Communist Party, purchased the land allegedly to build wind farms, Kyle Bass, founder and principal of Hayman Capital Management and a founding member of the Committee on the Present Danger: China, told Epoch TV in a recent interview.

The wind farm project, known as the Blue Hills Wind development, is being managed by GH America Energy, the U.S. subsidiary of Sun Guangxin’s Guanghui Energy Company.

The land area, 130,000 acres, is 200 square miles. It is near Laughlin Air Force Base.

“Just think about that for a second, 200 square miles of property. We have a Chinese general who owns two-thirds of the real estate in the capital of Xinjiang where the concentration camps are for the ethnic Uyghurs. And he now owns 200 square miles of Texas land between one of our most active Air Force bases and the border of the U.S. and Mexico,” Bass noted.

“You’ve got a former People’s Liberation Army general billionaire who has bought over 130,000 acres of Texan land, including a giant wind farm in an area where there isn’t particularly a lot of wind but happens to be right beside a very sensitive U.S. military installation,” Bass said.

Bass said he had visited the Devil’s River area of Texas where the land purchased by Sun Guangxin is located.

“When you think about the Texas map, it’s the southern region of Texas where the bend is essentially, just south of where that bend is and it’s right on the U.S. border with Mexico which also is actually functionally relevant or germane to this conversation.”

Bass said there is a “4,000 or 5,000-foot runway there where the Chinese general is expanding it to, we think, 10,000 feet. This is happening inside the United States, and this general is actually interfacing directly with the critical infrastructure of the United States. My view and this is my view only, not our country view yet, but my view is the reason that he bought the wind farm and wants to put up 700-foot turbines is he plugs directly into our electric grid.”

Bass continued: “Plugging directly into our electric grid is something that should never happen. Whether you’re a Chinese general or a North Korean general or an Iranian general or a Russian general, you should be precluded from buying property next to our busiest Air Force training base and plugging directly into our grid.”

The name of the property purchased by the Chinese firm is called the Morning Star Ranch.

“And if you remember in the Bible, the devil’s name is Lucifer Morning Star. And you should see the obtuse star that denotes the landmark of this ranch. Again, it’s almost made for TV fiction. You couldn’t make this up if you try,” Bass said.

https://www.worldtribune.com/former-chinese-general-owns-200-square-miles-in-texas-next-to-air-force-base/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65098

Originally posted at >>>/qresearch/13932711 (182036ZJUN21) Notable: Gun Owners Accuse Top NY Police Officers, NYC of Violating 2nd Amendment

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BREAKING: Gun Owners Accuse Top New York Police Officers, New York City of Violating Second Amendment

Four New York gun owners have filed a class action lawsuit against top police leaders and the City, accusing them of violating the Second Amendment by stopping gun owners from carrying handguns in public places.

The class action lawsuit was filed in New York on June 16 by Plaintiffs Jason Frey, Brianna Frey, Jack Cheng, and William Sappe, who allege Acting Superintendent of the New York State Police Kevin P. Bruen, NYPD Police Commissioner Dermot Shea, and New York City violate Second Amendment gun laws with provisions in the New York State Penal Law.

According to the class action lawsuit, New York State’s handgun licensing scheme under Penal Law “unconstitutionally infringes upon the preexisting individual right” of the group members to “bear arms” for self-protection by banning the unrestricted open carriage of a handgun; criminalizing the open carriage of a handgun; and restricting the validity of an unrestricted carry license based on the county of issuance.

https://topclassactions.com/civil-rights/1022925-gun-owners-accuse-new-york-police-violating-second-amendment-rights/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65099

File: ed203f635ba909f⋯.jpg (157.94 KB,1033x775,1033:775,Clipboard.jpg)

File: 7adf43f88ed7b1e⋯.jpeg (87.19 KB,802x612,401:306,Clipboard.jpeg)

File: d883b7b3c569c8f⋯.jpg (79.56 KB,967x544,967:544,Clipboard.jpg)

Originally posted at >>>/qresearch/13932748 (182041ZJUN21) Notable: Planefag UFO siting

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13932443 lb

>>>/qresearch/13932490 lb

>Any Idea what this might be?

Looks a little like a Guppy or a Global Hawk (bulbous nose), but not enough detail to ID

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65100

Originally posted at >>>/qresearch/13932792 (182048ZJUN21) Notable: Planefag UFO siting

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65099

Thank you, it was my post. I appreciate your answer. Lots of activity out of Otis AFB I believe it's one Space Force uses. I swear on my life I saw a UFO a couple months ago. It was at a low height , orange solid light, flew pretty fast overhead and disappeared in front of me, over the Cape Cod Canal. It was at night and pretty cool. Bless and protect everyone serving there!! And the Anons here answering questions without being dicks :)

They should get Obama, Skippy, and whoever at his Martha's Vineyard house.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65101

Originally posted at >>>/qresearch/13932801 (182050ZJUN21) Notable: DIA discussion

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65090

Bring the thunder. 1/3 of Chinese students. No surprise there. Names of US citizens who provided Intel to CCP. They'll be politicians and business leaders, hopefully no Military.

“He’s provided DIA with the contents of Hunter Biden’s laptop,” Robinson noted, adding that Jingwei confirms a “third of all Chinese students in US are spies.” According to Red State, the following is the type of information Jingwei provided to U.S. intel:

Early pathogenic studies of the virus we now know as SARS-CoV-2

Models of predicted COVID-19 spread and damage to the US and the world

Financial records detailing which exact organizations and governments funded the research on SARS-CoV-2 and other biological warfare research

Names of US citizens who provide intel to China

Names of Chinese spies working in the US or attending US universities

Financial records showing US businessmen and public officials who’ve received money from the Chinese government

Details of meetings US government officials had (perhaps unwittingly) with Chinese spies and members of Russia’s SVR

How the Chinese government gained access to a CIA communications system, leading to the death of dozens of Chinese people who were working with the CIA

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65102

Originally posted at >>>/qresearch/13932813 (182052ZJUN21) Notable: DIA discussion

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65101

Forgot the link.

https://beckernews.com/2-massive-chinese-spy-defects-to-usa-with-dirt-on-hunter-biden-intel-on-wuhan-bioweapons-research-39800/

It's being picked up on twitter too.

https://twitter.com/EmeraldRobinson/status/1405911564444655621

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65103

File: f8108ec8bc283fc⋯.jpeg (111.71 KB,750x341,750:341,Clipboard.jpeg)

Originally posted at >>>/qresearch/13932830 (182056ZJUN21) Notable: Leading Chinese nuclear scientist Zhang Zhijian dies in fall from building.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

SCMP: Leading Chinese nuclear scientist Zhang Zhijian dies in fall from building.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65104

Originally posted at >>>/qresearch/13932834 (182056ZJUN21) Notable: DIA discussion

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65102

Lets hope its true, all we can do at this point.

>>>/qresearch/13932810

Yes that would be the other option, it is either one or t'other. I wonder if Q knew Trump wouldn't win the election. If this is all being orchestrated is it all a plan or is this a big spanner into th eplan?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65105

File: 122900790847f36⋯.png (290.56 KB,596x604,149:151,Clipboard.png)

Originally posted at >>>/qresearch/13932897 (182105ZJUN21) Notable: Sidney Powell summoned to Michigan court hearing next month, facing possible sanctions

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/jsolomonReports/status/1405994010142023689

Report: Sidney Powell summoned to Michigan court hearing next month, facing possible sanctions | Just The News

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65106

File: 6fedbff0966cd4c⋯.png (252.85 KB,860x662,430:331,Clipboard.png)

Originally posted at >>>/qresearch/13932923 (182108ZJUN21) Notable: Stacey Abrams Texting Arizonans To Pass the S.1 Legislation that Gives Democrats More Ability to Cheat

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/stacey-abrams-texting-arizonans-pass-s-1-legislation-gives-democrats-ability-cheat/

Stacey Abrams Texting Arizonans To Pass the S.1 Legislation that Gives Democrats More Ability to Cheat

By Jordan Conradson

Published June 18, 2021 at 4:05pm

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65107

File: 0ee0dbed78dae3d⋯.png (336.75 KB,500x500,1:1,Clipboard.png)

Originally posted at >>>/qresearch/13932929 (182109ZJUN21) Notable: Say His Name - Seth Rich

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65108

File: 7a9893444c2159f⋯.png (103.01 KB,714x482,357:241,Clipboard.png)

Originally posted at >>>/qresearch/13932942 (182111ZJUN21) Notable: Say His Name - Seth Rich

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13932932

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65109

File: 320bc794077d983⋯.png (8.12 KB,1107x137,1107:137,Clipboard.png)

Originally posted at >>>/qresearch/13932947 (182112ZJUN21) Notable: Canada says restrictions on U.S. travel will last until late July

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://justthenews.com/politics-policy/coronavirus/canada-says-restrictions-us-travel-will-last-until-late-july?

Canada says restrictions on U.S. travel will last until late July

"Non-essential international travel" is banned.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65110

File: f1b890e67fa3a85⋯.png (117.65 KB,734x435,734:435,Clipboard.png)

Originally posted at >>>/qresearch/13932966 (182114ZJUN21) Notable: Say His Name - Seth Rich

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13932957

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65111

File: 2ea66858ef12319⋯.png (362.17 KB,766x633,766:633,Clipboard.png)

Originally posted at >>>/qresearch/13933002 (182119ZJUN21) Notable: Lawsuit Twitter conspired with Dems including Alex Padilla (new CA Senator appointed by Newsome)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://pjmedia.com/news-and-politics/tyler-o-neil/2021/06/18/lawsuit-twitter-conspired-with-democrats-on-orwellian-censorship-of-election-concerns-n1455569

LAWSUIT: Twitter Conspired With Democrats on 'Orwellian' Censorship of Election Concerns

BY TYLER O'NEIL JUN 18, 2021 3:35 PM ET

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65112

File: 542079ed9d679bc⋯.png (384.99 KB,700x392,25:14,Clipboard.png)

File: 0a34de5e3357c4e⋯.png (208.01 KB,680x565,136:113,Clipboard.png)

File: 51a6b001f434963⋯.png (815.72 KB,768x775,768:775,Clipboard.png)

File: e7acebb9d0ae980⋯.png (60.74 KB,1060x600,53:30,Clipboard.png)

File: b461ce7b19a9f11⋯.png (147.61 KB,452x629,452:629,Clipboard.png)

Originally posted at >>>/qresearch/13933049 (182128ZJUN21) Notable: President Trump Endorses Alaska Department of Administration Commissioner Kelly Tshibaka As Primary Challenger to Decepticon Senator Lisa Mukowski

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://theconservativetreehouse.com/blog/2021/06/18/president-trump-endorses-alaska-department-of-administration-commissioner-kelly-tshibaka-as-primary-challenger-to-decepticon-senator-lisa-murkowski/

https://www.kellyforak.com/news

Tshibaka.

Kelly Tshibaka.

President Trump Endorses Alaska Department of Administration Commissioner Kelly Tshibaka As Primary Challenger to Decepticon Senator Lisa Mukowski

According to recent polling, Alaska Department of Administration Commissioner Kelly Tshibaka is leading DeceptiCon Senator Lisa Murkowski in the 2022 primary.

Today President Trump gives his full endorsement to Mrs. Tshibaka to finally get rid of the thorn in the side of our republic. Senator Murkowski and others must be removed if we are ever going to Make America Great Again.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65113

File: 5074ebe70d13dff⋯.jpg (204.73 KB,1180x1814,590:907,Clipboard.jpg)

Originally posted at >>>/qresearch/13933051 (182129ZJUN21) Notable: President Trump Endorses Alaska Department of Administration Commissioner Kelly Tshibaka As Primary Challenger to Decepticon Senator Lisa Mukowski

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65114

File: d52350ae4b7324e⋯.png (168.88 KB,881x547,881:547,Clipboard.png)

Originally posted at >>>/qresearch/13933111 (182142ZJUN21) Notable: (pb) RIDERS OF JUSTICE (2020), COVERS A LOT OF UNCOMFORTABLE TOPICS, INCLUDING AUTISTISM SIDE

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

RIDERS OF JUSTICE (2020)

MOVIE RECOMMENDATION - NOTE, SUBTITLES DANISH MOVIE. WORTH A WATCH, COVERS A LOT OF UNCOMFORTABLE TOPICS, INCLUDING AUTISTISM SIDE==

Markus, who has to go home to his teenage daughter, Mathilde, when his wife dies in a tragic train accident. It seems like an accident until a mathematics geek, who was also a fellow passenger on the train, and his two colleagues show up.

Markus, a deployed military man, has to go home to his teenage daughter, Mathilde, when his wife dies in a tragic train accident. It seems to be plain bad luck - but it turns out that it might have been a carefully orchestrated assassination, which his wife ended up being a random casualty of.

Markus, a veteran soldier in Afghanistan, returns home to take care of his daughter, Mathilde, after a horrible train accident. However, on his return, Markus has an unexpected encounter with the statistical analyst, Otto, one of the few survivors of the accident, who is convinced that there is more to this tragedy than meets the eye. Indeed, it seems that many secrets are hidden in plain sight. Now, pained and lethally dangerous Markus has no other choice but to delve deep into the mind-boggling world of possibilities to get answers to his unspoken questions. But, can he make sense of death?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65115

Originally posted at >>>/qresearch/13933122 (182144ZJUN21) Notable: Stocks slump as S&P 500 has its worst week since February

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Stocks slump as S&P 500 has its worst week since February

welcome to Bidenland

NEW YORK — Stocks sank again June 18, knocking the S&P 500 to its worst weekly loss since February, as more steam comes out of banks and other public companies that soared earlier this year with expectations for the economy and inflation.

The S&P 500 fell 1.3 percent in a widespread slump. It was the worst day for the closely followed index in a month as unease grows about the Federal Reserve making plans to eventually offer less help to markets.

The Dow Jones Industrial Average lost 1.6 percent, and the Nasdaq composite fell 0.9 percent

https://www.postandcourier.com/stocks-slump-as-s-p-500-has-its-worst-week-since-february/article_0b015782-d06b-11eb-9ee1-7b2799ca3e5a.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65116

File: 5359bcd06f501fc⋯.png (516.16 KB,888x492,74:41,Clipboard.png)

File: c22fb31fd25bfa1⋯.png (1.26 MB,1059x1256,1059:1256,Clipboard.png)

Originally posted at >>>/qresearch/13933202 (182158ZJUN21) Notable: Scavino Fakebook Post with Strange Symbol

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

New Dan FB

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65117

File: f5623c29ad6eb77⋯.png (11.35 KB,129x75,43:25,Clipboard.png)

File: ad2f535bcaf5adc⋯.png (108.31 KB,474x482,237:241,Clipboard.png)

Originally posted at >>>/qresearch/13933209 (182200ZJUN21) Notable: Scavino Fakebook Post with Strange Symbol

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65116

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65118

File: 7202c9d5d8d7092⋯.png (7.24 KB,104x66,52:33,Clipboard.png)

Originally posted at >>>/qresearch/13933214 (182201ZJUN21) Notable: Scavino Fakebook Post with Strange Symbol

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65116

Convenient Design for the Speaker.

Just a Coincidence, I'm Sure.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65119

File: eb31377b3b6e163⋯.png (64.25 KB,729x536,729:536,Clipboard.png)

File: e593bc8bdd6acf7⋯.png (300.31 KB,514x652,257:326,Clipboard.png)

File: 8dd6654cf9457f4⋯.png (443.43 KB,606x459,202:153,Clipboard.png)

File: a323490b0895aaf⋯.png (460.45 KB,606x678,101:113,Clipboard.png)

File: da2402332ffea5b⋯.png (160.44 KB,606x340,303:170,Clipboard.png)

Originally posted at >>>/qresearch/13933218 (182202ZJUN21) Notable: VaX Remedies Archive Offline

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933186

Yeah, i would not tell her that, lets hope there is a way out for them.

BELOW IS THE ONLY POST I HAVE COLLECTED IN TRYING TO HELP PEOPLE AFTER THEY REALISE WHAT HAS HAPPENED. WORTH ARCHIVING THE LINKS OFFLINE !!!

------------------------—-

POSTED FOR ARCHIVE AND RESEARCH, THE FIRST ANON WHO HAS PUT TOGETHER A LIST OF REMEDIES TO HELP THOSE WHO WERE DUPED !!

FRIENDS/FAMILY TOOK THE VAX? HERE'S WHAT THEY NEED TO REDUCE SPIKE PROTEIN DAMAGE (w/ Academic References)

=========

Lots of somewhat frantic enquiries today about how to help covidiots who took the jab and are now worried about spike protein damage. Well they damn well should be worried as that shit'll kill ya.

Anyway, here are the things anons have dug on that, based on preliminary research, seem to have some potential to reduce spike protein damage – either by protecting cells from the spikes, or by dissolving the spikes themselves.

A) SOURCES OF SHIKIMIC ACID (3)

1. Pine needle tea

2. Fennel tea (you know, the seeds they put in Italian sausage)

3. Anise tea (the star-like things they use in Chinese cooking, taste like liquorice)

B) Bromelain (an extract made from pineapples) – often sold in 10mg tabs

C) Acetylcysteine (also called N-Acetylcysteine or NAC) – an amino acid often sold as 200mg tabs that the FDA suddenly wants to regulate now.

Academic research on why these things are thought to be effective against spike proteins:

“Bromelain Inhibits SARS-CoV-2 Infection…”

https://www.biorxiv.org/content/10.1101/2020.09.16.297366v1

“Properties and Therapeutic Application of Bromelain: A Review”

https://www.researchgate.net/publication/234100148_Properties_and_Therapeutic_Application_of_Bromelain_A_Review

“N-Acetylcysteine: A Potential Therapeutive Agent for SARS-CoV-2”

https://www.researchgate.net/publication/341771564_N-Acetylcysteine_A_potential_therapeutic_agent_for_SARS-CoV-2

“The Functional Medicine Approach to Covid 19: Virus-Specific Nutraceutical and Botanical Agents”

https://www.ifm.org/news-insights/the-functional-medicine-approach-to-covid-19-virus-specific-nutraceutical-and-botanical-agents/#nac

“Thrombotic Complications of Covid-19…”

https://openheart.bmj.com/content/7/1/e001337

“Molecular Docking Studies of N-Acetylcysteine… on SARS-CoV-2 Protease…”

https://s3-eu-west-1.amazonaws.com/itempdf74155353254prod/12161493/Molecular_Docking_Studies_of_N-Acetyl_Cysteine__Zinc_Acetyl_Cysteine_and_Niclosamide_on_SARS_Cov_2_Protease_and_Its_Comp_v1.pdf

“Content Analysis of Shikimic Acid… and Antiplatelet-Aggregating Activity”

https://www.researchgate.net/publication/277348748_Content_Analysis_of_Shikimic_Acid_in_the_Masson_Pine_Needles_and_Antiplatelet-aggregating_Activity

“Total quantification and extraction of shikimic acid from star anise (llicium verum) using solid-state NMR…”

https://www.sciencedirect.com/science/article/abs/pii/S2352554116300493

“New Method for Rapid Extractions… Efficient Isolation of Shikimic Acid…”

https://pages.uoregon.edu/chendon/coffee_literature/2015%20Org.%20Lett.,%20Shikimic%20acid%20extraction%20from%20anise%20using%20espresso%20machine.pdf

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65120

File: 3fa11841256ef4a⋯.jpeg (123.38 KB,932x527,932:527,Clipboard.jpeg)

Originally posted at >>>/qresearch/13933346 (182226ZJUN21) Notable: PCR is completely incapable of diagnosing ANY infection.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

""PCR is completely incapable of diagnosing ANY infection.""

It only takes DNA /RNA from a sample and replicates it synthetically into a larger sample so that it can be analysed.

99.9% of people -including Drs and Scientists- touting PCR this or that even so called scientists using it fraudulently as a "test" apparently have zero comprehension of what PCR may even technically really be used for.

WHY IS THAT??

Because the first abuses of PCR started almost 30 years ago and now infectious disease "experts" have 30 years of utterly complete brainwashing behind them and now its even taught in medical schools.

USING PCR THE WAY THEY ARE… IS COMPLETE NONSENSE.

Look closely. This is a DISCLAIMER on a so called PCR HIV test.

This mirrors the disclaimers for ALL PCR so called "tests"

Note that it says not for DIAGNOSIS

There is a very good reason for such a disclaimer:

IT CANNOT DIAGNOSE INFECTION.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65121

File: 0520a89fd32cc13⋯.png (35.7 KB,678x646,339:323,Clipboard.png)

Originally posted at >>>/qresearch/13933358 (182229ZJUN21) Notable: GA Republican David Belle Isle Formal Request for Election Records from Brad Raffensperger

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Georgia Republican David Belle Isle Formally Files Wide Request for Election Records from Brad Raffensperger

Georgia Republican David Belle Isle, who is seeking to unseat Secretary of State Brad Raffensperger (R) in next year’s election, filed a far-reaching formal open records request Thursday for several documents related to Georgia’s 2020 election, Breitbart News has learned exclusively.

Belle Isle, a former mayor of Alpharetta, said in a phone interview with Breitbart News that he is taking the step, which he is entitled to do under Georgia’s Open Records Act, to bring more transparency to the election process.

“When [Raffensperger] came out of the 2020 election, the first thing he says is that it was the safest, most secure election in Georgia’s history,” Belle Isle explained. “Yet more and more things continue to unravel as we look and we see, and people are wanting to know and get to the bottom of it, and if you’re going to trust elections, there has to be transparency.”

The requests, which include items such as signature complaints, chain of custody documents for drop boxes, and surveillance videos for drop boxes, are listed in full below:

1. From the General Election held on November 3, 2020 (hereinafter “2020 General Election”), all written or recorded reports, complaints, requests for investigation, regarding signatures of electors on absentee ballots, envelopes, or voter registration for Fulton, Cobb, Dekalb, and Clayton counties;

2. All reports, records, transfer documents, custody documents, memoranda, notes, written or recorded statements, and any other document or relevant correspondence concerning all chain-of-custody records for every absentee ballot drop box authorized in Georgia for the 2020 General Election;

3. All surveillance videos of every authorized absentee ballot drop box utilized during the 2020 General Election;

4. All correspondence, both paper and electronic, received by negotiation or otherwise by the Georgia Secretary of State’s office in exchange for the Secretary’s consent to the March 6, 2020 Compromise Settlement Agreement And Release in the lawsuit between Democratic Party of Georgia, Inc. (“DPG”), the DSCC, and the DCCC), as Plaintiff, and Brad Raffensperger, Rebecca N. Sullivan, David J. Worley, Seth Harp, and Anh Le, as Defendants.

5. All surveillance videos of the Georgia World Congress Center for the dates of November 3, 2020, and November 4, 2020.

6. All reports, records, and tabulations of absentee ballots received by the Secretary of State’s office during the 2020 General Election.

7. All reports, records, and tabulations of absentee ballots envelopes received by the Secretary of State’s office during the 2020 General Election.

8. All official correspondence to and from the Secretary of State, both paper and electronic, to and from Dominion Voting Systems (hereinafter “Dominion”) or any person associated with Dominion regarding the 2020 General Election.

9. All correspondence, both paper and electronic, regarding any of the following: (1) all official audits of the Dominion ballot marking devices (hereinafter referred to as “BMD”); (2) any relationship between Dominion and Pro V&V; (3) the number of BMDs examined by the Secretary of State; and (4) the extent to which such BMDs were examined.

10. To the extent not previously requested herein, each and every document pertaining to all reports prepared by any expert or election official regarding: (1) the accuracy and performance of BMDs and (2) all reports of any person who investigated BMDs or absentee ballots for the 2020 General Election.

https://www.breitbart.com/2020-election/2021/06/18/exclusive-georgia-republican-david-belle-isle-formally-files-wide-request-for-election-records-from-brad-raffensperger/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65122

File: f3efea0b3e75d29⋯.jpg (40.72 KB,807x414,269:138,Clipboard.jpg)

File: 83ff4a593ad19c2⋯.jpg (39.38 KB,843x196,843:196,Clipboard.jpg)

File: a47ff5c89e64804⋯.jpg (84.18 KB,756x678,126:113,Clipboard.jpg)

Originally posted at >>>/qresearch/13933385 (182233ZJUN21) Notable: BOOM? Lindell v. Dominion/Smartmatic: Initiating Complaint Summary

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lindell v. Dominion/Smartmatic: Initiating Complaint Summary

https://uncoverdc.com/2021/06/18/lindell-v-dominion-smartmatic-initiating-complaint-summary/

Plaintiff’s June 3, 2021 filing that initiated the Lindell v. Dominion/Smartmatic case is comprised of the Complaint and 17 exhibits. This article summarizes the initiating Complaint. The full series of articles is available through the following links: Intro | Complaint Summary | Exhibits 1-4 Breakdown | Exhibits 5-7 | Exhibits 8-9 | Exhibit 12 | Exhibits 10-11 & 13-17.

Michael J. Lindell v. U.S. Dominion, Inc., et al. Complaint

A legal ‘Complaint‘ is a document filed with a court that functions to initiate a lawsuit and inform the court and the Defendants of Plaintiff’s intent. It offers a summary of ‘facts’ that aim to establish the necessary elements of the claim for relief that a Plaintiff is asserting. These ‘facts’ exist as to allegations against the Defendants, pending supporting evidence that will be brought forth in trial to be considered by the judge and/or jury.

The Complaint filed to start Lindell v. Dominion is more readable than a typical lawsuit in both vocabulary and style. Dystopian quotes are interspersed from George Orwell’s “1984,” E.M. Forster’s “The Machine Stops,” and other famous literature. In it, Plaintiff Lindell alleges that evidence has been suppressed that would show Defendants’ machines were manipulated to affect the November General election results.

Lindell claims that the Defendants’ lawsuits and legal demands against him amount to a weaponization of law or LawFare (Law + Warfare). He says they are essentially government because of their role in elections administration, so it is a violation of his first amendment rights to intimidate and try to silence him.

…

“A total of five (5) companies conduct and administer elections for more than ninety percent (90%) of counties in the United States: (1) Election Systems & Software, (2) Dominion Voting Systems, (3) Smartmatic USA Corp., (4) Hart InterCivic, and (5) Tenex.“

…

The lawsuit claims to show relevant ties to private equity firm Staple Street Capital, global investment firm The Carlyle Group, UBS Securities LLC, Chinese banks and corporations, and the Chinese government. “…by the time of the 2020 election, Chinese government-related entities, Chinese technology companies, and powerful Chinese financial interests had direct or indirect ownership of and near-total access to Dominion’s and Smartmatic’s voting machine technology.”

…

Part D., “Gaslighting: The REAL Big Lie,” begins by noting that the Department of Homeland Security (DHS) Cybersecurity and Infrastructure Security Agency (CISA) had published claims that the 2020 election was the “most secure in American history,” but points out that Dominion is a member of CISA’s Election Infrastructure Sector Coordinating Council, which it says gives them “self-serving influence over CISA’s proclamations.” It notes that Dominion “forced unplanned and unannounced software uploads into its machines” on the night before the 2020 election and that Dominion “publicly denied that any such updates… were made and that its machines were connected to the internet,” calling both statements false.

…

More at link

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65123

File: 6ff51559bbc8f2e⋯.jpeg (68.71 KB,678x452,3:2,Clipboard.jpeg)

File: 45a3df771364fa5⋯.png (319.91 KB,871x803,871:803,Clipboard.png)

File: 55960cf63d0b57c⋯.png (49.86 KB,625x669,625:669,Clipboard.png)

File: c3b4302a159664e⋯.png (61.24 KB,250x207,250:207,Clipboard.png)

File: a22aa3541140e97⋯.png (54.34 KB,400x250,8:5,Clipboard.png)

Originally posted at >>>/qresearch/13933388 (182234ZJUN21) Notable: RE: Delany's Chocolaty Colorado Mail-In Misadventure

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Delany's Chocolaty Colorado Mail-In Misadventure?

re previous: "Runbeck Louisiana Hero?"

>>>/qresearch/13892395 (pb)

>>>/qresearch/13893264 (pb)

>>>/qresearch/13893305 (pb)

Runbeck's Erin Delany hit some coincidences that made this anon wonder about her role. Is this Baton Rouge Runbeck employee the "hero" recipient of CodeMonkeyZ's recent Baton Rouge chocolate delivery?

Would "Runbeck run" if an employee having Delany's deep SoS connections "kept a copy"?

One more coincidence:

Delany didn't just represent the SoS inAZ and LA, but also inColorado. She "coordinated" the big CO "ballot on demand" operation in 2012, right before mail-in voting went live in 2013. And isn't Colorado in the news now, with the current CO SoS panicking so kekkily.

Just another coincidence?

Or is Erin Delany avery important person in the audit(s)?

-

Kinda convenient, having a system that can print ballots on demand, whenever the SoS might need 'em.

Day or night.

So what does Erin Delany know about SoS offices and on-demand ballot printing?

Except everything?

-

https://gab.com/threesevens/posts/106433732728573527

https://t.me/CodeMonkeyZ/463

https://www.linkedin.com/in/erin-delany-91418277

https://www.sos.state.co.us/pubs/newsRoom/pressReleases/2021/PR20210617Rules.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65124

File: 9c1dfbdb3c74b7e⋯.png (405.72 KB,674x596,337:298,Clipboard.png)

Originally posted at >>>/qresearch/13933393 (182234ZJUN21) Notable: Sidney Powell Summoned to Michigan Court for Sanctions Hearing

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Attorney Sidney Powell and other lawyers who filed lawsuits to support former President Donald Trump’s claims about the 2020 election were summoned by a judge to a sanctions hearing in Michigan.

https://www.theepochtimes.com/sidney-powell-summoned-to-michigan-court-for-sanctions-hearing-judge_3864570.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65125

File: 9a28aed4ce6fe1c⋯.png (175.79 KB,655x548,655:548,Clipboard.png)

Originally posted at >>>/qresearch/13933398 (182235ZJUN21) Notable: 'Huge' car dealer Billy Fuccillo dies in Florida at 64

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.wgrz.com/article/news/local/huge-car-dealer-billy-fuccillo-dies-in-florida-at-64/71-ebd546f0-6466-4ae3-b966-6327977e9656

LOCAL NEWS

'Huge' car dealer Billy Fuccillo dies in Florida at 64

Fuccillo's death, which reportedly came after a long illness.

Author: WTSP WGRZ

Published: 10:34 AM EDT June 18, 2021

Updated: 12:18 PM EDT June 18, 2021

TAMPA, Fla. — Legendary car dealer, Billy Fuccillo, whose catchphrase was "huge," has died at his Florida home, according to multiple reports.

The Syracuse Auto Dealers Association confirmed Fuccillo's death, which reportedly came after a long illness, CNY Central reported.

According to the Times-Union, his Syracuse-based Fuccillo Automotive Group is the largest privately-owned dealership in New York State, with locations there and in Florida. Fuccillo also owned dealerships on Grand Island.

The 64-year-old, who once played football at Syracuse University, is survived by his wife Cindy and son, Billy Fuccillo Jr.

H U G E

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65126

Originally posted at >>>/qresearch/13933452 (182242ZJUN21) Notable: PCR is completely incapable of diagnosing ANY infection.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933411

The way it is being used?

It absolutely IS being used to say INFECTION is diagnosed.

They are calling it asymptomatic infection.

What did I say?

It cannot be used to diagnose INFECTION.

and that is exactly how they are TOUTING it as being used.

And WHO decided how many cycles?

(Because depending on the cycles you can create the illusion of finding it anywhere you wish… in all humans.)

SO it has nothing to do with exposure.

ALL the PCR standard for current use in USA

is based on the in vitro shit science pulled from a SINGLE patient in Washington.

This is not viremia.

They have tied it to nothing.

Not only that modern virologists following Robert Gallo style of virology

have yet to prove what they are looking for causes anything.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65127

File: 12a6bb53d3fce5c⋯.jpg (136.58 KB,750x1156,375:578,Clipboard.jpg)

Originally posted at >>>/qresearch/13933454 (182242ZJUN21) Notable: RE: Theater - Jake Angeli, Phoenix AZ

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933040 lb

Theater huh…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65128

File: 68fd0393c858f76⋯.png (1.04 MB,1079x1499,1079:1499,Clipboard.png)

File: c91917df19057a7⋯.jpg (2.42 MB,972x7380,27:205,Clipboard.jpg)

Originally posted at >>>/qresearch/13933465 (182244ZJUN21) Notable: Sidney Powell Summoned to Michigan Court for Sanctions Hearing

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933420

Sidney Powell Summoned to Michigan Court for Sanctions Hearing: Judge

https://www.theepochtimes.com/sidney-powell-summoned-to-michigan-court-for-sanctions-hearing-judge_3864570.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65129

File: 7e3a6cce4630012⋯.png (297.47 KB,598x674,299:337,Clipboard.png)

Originally posted at >>>/qresearch/13933467 (182245ZJUN21) Notable: @BarackObama "On Monday, I’m joining @EricHolder for a grassroots conversation with @AllOnTheLine"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

@BarackObama

On Monday, I’m joining @EricHolder for a grassroots conversation with @AllOnTheLine to talk about why redistricting matters and how the Senate can help protect our democracy. Join us:

https://twitter.com/BarackObama/status/1405874188406210560

Kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65130

Originally posted at >>>/qresearch/13933468 (182245ZJUN21) Notable: RE: DONG

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>13932571 (lb)

Posted earlier that Dong and daughter coming to the US in Feb, a few weeks after Bidan is installed as pres. Doesn't make sense.

Story is he has covid stuff and Hunter/Bidan dirt. That would make him a marked man from the CCP side and from the Bidan group side. Who would defect to the US mainland under those conditions?

So, it could be a limited hangout by the Bidan group, trotting out someone who releases a bit of information that points back to US IC activity, for example, or a play by dems that offers up a "defector" who will be easily debunked, thereby discrediting any CCP/Bidan accusations.

Could be, too, that it's Mil Intel who has him outside CONUS and are releasing info bit by bit now as a force multiplier to the election scam revelations. The more state pols like the chick in CO spout off, for example, the harder the fall is the fraud is uncovered. IOW, CO AG got a margin call from the suits with the bucks to deliver the goods for the people who put her in office, and MIL Intel is blowing that up with timed drops.

Bidan/dems will not survive any revelation that they promoted the covid shit as part of an election steal. Time that info release in a way for the normies to connect the dots and it's over for them.

Add too, that a lot of stuff is starting to surface after Bidan's European trip. So could be Bidan fucked up. Can't see European NATO, for example, wanting to cover Bidan's six if he decides to declare the next corporate hack a Russia. attack, or if he demands Ukraine be made a NATO member. Cold War 2.0.

Putin might have jacked his ass in Geneva, say, and Bidan bailed on NATO/UKraine after telling NATO European members he was letting Ukraine in. Zelensky bitched and Bidan froze funds, if reports yesterday are accurate.

That very scenario got Trump impeached. Where the fuck is Vindman when you need him?

Bidan just might be getting tweaked from all sides at this juncture, and has to pick the source least damaging info to take a shit on. In this case, Putin has worse dirt than Zelensky. say, so tough shit for Zelensky.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65131

Originally posted at >>>/qresearch/13933500 (182249ZJUN21) Notable: PCR is completely incapable of diagnosing ANY infection.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933381

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome,

are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what

we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we

run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched

sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA

– reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human

genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a

100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match

to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to

the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-

CoV-2 RdRp gene.

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO

protocols, we find complete or high percentage matches with various fragments of the human genome.

This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique.

They could be anything from microbial sequences to fragments of human chromosomes.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65132

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13933548 (182257ZJUN21) Notable: Russell Brand: "Should I Go On FOX News? (after what happened last time!)"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Should I Go On FOX News? (after what happened last time!)

•Jun 18, 2021

Russell Brand

https://youtu.be/79xQW-jrcKA

Yes!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65133

Originally posted at >>>/qresearch/13933651 (182316ZJUN21) Notable: Is this legit?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933330

The three simple electric charge characteristics as it relates to an antenna specifically a dipole antenna are:

- Charged particles have an electric field at all times

- Charged particles create an magnetic field when moving at a constant speed.

- Charged particles create an electromagnetic field when accelerating or reversing

Half wavelength antennas at resonance have characteristics of a capacitor in that the current leads the voltage by 90 degrees within the antenna. Standing waves of voltage and current occur and each form their own distinct half sine wave over the antenna whereby the current is maximum whenever the voltage is minimum. The ends are voltage loops and the center is the current loop.

When a reversing current interacts with a resonant antenna it allows part of the antenna's collapsing electric field lines of force to be isolated from the antenna and loop on themselves and be propelled away from the antenna by the antenna electric field since the fields repel each other. The newly isolated moving looped electric field lines of force create magnetic lines of force that are in phase and have the same sign of magnitude. In the electromagnetic field the electric and magnetic fields are combined and in phase but 90 degrees apart or perpendicular to each other in space.

The local antenna electric and magnetic fields are called near field which along with properly timed new incoming charges allow for this creation of electromagnetic radiation which becomes the far field. The voltage versus current 90 degree phase relationship in the antenna and new charge timing allow this far field radiation to occur.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65134

File: c145bc7a45a53bf⋯.jpg (213.1 KB,720x1212,60:101,Clipboard.jpg)

File: 67233a55a376813⋯.jpg (79.82 KB,650x900,13:18,Clipboard.jpg)

Originally posted at >>>/qresearch/13933702 (182326ZJUN21) Notable: Mike Obama talking funny

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Odd birthday greeting

No 'daughter '

No ''mom'

Not even 'birthing person'

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65135

File: 0b6368203345056⋯.jpg (41.5 KB,400x400,1:1,Clipboard.jpg)

Originally posted at >>>/qresearch/13933764 (182338ZJUN21) Notable: JC IS C_A also in the 'club' & has been brain fucked by MK ultra

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933739

>>>/qresearch/13933720

JC IS C_A also in the 'club' & has been brain fucked by MK ultra

His own TWAT PROFILE PIC SAYS alot.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65136

File: c299e90d1e93145⋯.png (263.18 KB,643x611,643:611,Clipboard.png)

Originally posted at >>>/qresearch/13933805 (182346ZJUN21) Notable: M 3.9 Experimental Explosion - 170 km ENE of Ponce Inlet, Florida

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

M 3.9 Experimental Explosion - 170 km ENE of Ponce Inlet, Florida

2021-06-18 19:48:39 (UTC)29.742°N 79.347°W0.0 km depth

https://earthquake.usgs.gov/earthquakes/eventpage/us7000ee8n/executive

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65137

File: 17e0b2439a70637⋯.jpeg (234.68 KB,1079x1518,1079:1518,Clipboard.jpeg)

File: d44e55fd88dd2bd⋯.jpeg (138.77 KB,1170x1205,234:241,Clipboard.jpeg)

Originally posted at >>>/qresearch/13933932 (190007ZJUN21) Notable: New Scavino FB post - an old newspaper article…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

New Scavino FB post - an old newspaper article…

“News unlocks. You have more than you know.” - Q

April 18??

Q Post 3987 - April 18…

“One if by land, two if by sea”.

The words used by Henry Wadsworth Longfellow in his poem "Paul Revere's Ride” to describe the signal used to guide the "midnight ride of Paul Revere" at the start of the Revolutionary War.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65138

File: ca7f0c363426f94⋯.jpeg (88.98 KB,574x535,574:535,Clipboard.jpeg)

File: 323d2f59ed96ddf⋯.jpeg (38.26 KB,738x415,738:415,Clipboard.jpeg)

File: 9abede9a953a7b9⋯.jpeg (96.36 KB,655x468,655:468,Clipboard.jpeg)

File: d4cbf1a1327f7f2⋯.jpeg (80.71 KB,432x650,216:325,Clipboard.jpeg)

Originally posted at >>>/qresearch/13933937 (190008ZJUN21) Notable: The Gympie, Queensland, Australia pyramid.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The Gympie, Queensland, Australia pyramid.

The site is closed off by the Australian government as "native private property".

26.1690°S 152.6930°E

63 Gympie Connection Rd, Victory Heights QLD 4570, Australia

I think this channel is promoting white supremacy.

Not sure.

It is called Aryan Archeology, Linguistics and Anthropology.

Haven’t looked at it much.

Following it because a friend is heavily into languages and I am sending him language related posts.

https://t.me/AryanAnthropology

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65139

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13933967 (190013ZJUN21) Notable: Kash’s Corner: How a Porous Border Facilitates Narcoterrorism

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Epoch Times

Kash’s Corner: How a Porous Border Facilitates Narcoterrorism

In this episode of Kash’s Corner, Kash and Jan discuss the national security threats at the southern border, the deteriorating situation in Venezuela, and what’s going on with Kash’s Twitter impersonator.

Full epsiode

https://www.theepochtimes.com/kashs-corner-how-a-porous-border-facilitates-narcoterrorism_3864818.html?&utm_medium=KashCorner&utm_source=YouTube&utm_campaign=Border&utm_content=6-18-2021

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65140

File: 0b3370c41070d1a⋯.png (678.75 KB,744x776,93:97,Clipboard.png)

File: c2a0fe2c6ce2388⋯.png (840.64 KB,599x756,599:756,Clipboard.png)

File: 1c49abd146b9594⋯.png (700.44 KB,587x740,587:740,Clipboard.png)

File: e8c8ea1660088f8⋯.png (199.63 KB,548x767,548:767,Clipboard.png)

Originally posted at >>>/qresearch/13934027 (190020ZJUN21) Notable: RE: DONG

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

‼️🔥🔥——BREAKING BOMBSHELL——🔥🔥‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

IF AUTHENTIC, THIS IS WORSE THAN WE FIRST THOUGHT !!

HERE ARE ALL 4 PAGES OF THE ALLEGED LEAKED MEMORANDUM FROM NEIL M. FERGUSON OF IMPERIAL COLLEGE LONDON

PLEASE SHARE THIS LINK FAR AND WIDE

https://t.me/RambaldisEye/2048

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65141

File: f6c18e3d3f7cc87⋯.png (605.98 KB,1706x702,853:351,Clipboard.png)

Originally posted at >>>/qresearch/13934191 (190049ZJUN21) Notable: So the FBI was preparing for an "attack" from a group in which they already had an informant???

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Wait……

So the FBI was preparing for an "attack" from a group in which they already had an informant???

Tell me you're setting up an "attack" by "Trump supporters" without telling me you're setting up an "attack" by “Trump supporters"……

https://www.newsweek.com/exclusive-threat-pro-trump-violence-washington-overshadows-inauguration-security-plans-1558615

https://www.theguardian.com/us-news/2021/jan/27/proud-boys-leader-enrique-tarrio-fbi-informant

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65142

File: 3d04cc075c701b9⋯.png (232.51 KB,442x680,13:20,Clipboard.png)

File: e102cbae2a3a885⋯.png (606.83 KB,822x768,137:128,Clipboard.png)

Originally posted at >>>/qresearch/13934192 (190049ZJUN21) Notable: DJT Can anybody believe this? No wonder our Country is going to hell!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

GEORGENEWS, [18.06.21 17:55]

[ Photo ]

SAVE AMERICA

PRESIDENT DONALD J. TRUMP

JUNE 18, 2021

BEDMINSTER, NJ

Statement by Donald J. Trump, 45th President of the United States of America.

Can anybody believe this? No wonder our Country is going to hell!

###

https://t.me/georgenews/1536

5:55

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65143

File: 0b35c204a82ae29⋯.png (24.17 KB,448x446,224:223,Clipboard.png)

Originally posted at >>>/qresearch/13934196 (190050ZJUN21) Notable: DJT pushing the SHOT

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

GEORGENEWS, [18.06.21 20:08]

SAVE AMERICA

PRESIDENT DONALD J. TRUMP

JUNE 18, 2021

BEDMINSTER, NJ

Statement by Donald J. Trump, 45th President of the United States of America.

When Biden tries to claim credit for vaccine distribution, a distribution system that was set up by the Trump Administration, he should remember that if I didn’t purchase, very early on, billions of dollars worth of the vaccine, bottles, needles, and everything else that goes with it, he and his administration would not have been giving vaccinations until October or November of this year. So let them go on and on with their Fake Campaign and Fake Election results and Fake Media, but without the Trump Administration’s Operation Warp Speed, millions of people would be dying all over the World that will now be saved.

###

https://t.me/georgenews/1537

8:08

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65144

File: 1bbd8d2c7c2f527⋯.jpg (206.96 KB,720x1247,720:1247,Clipboard.jpg)

File: c60168f2149976b⋯.jpg (341.87 KB,1512x2016,3:4,Clipboard.jpg)

Originally posted at >>>/qresearch/13934221 (190052ZJUN21) Notable: General Flynn and Roger Stone trolling

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

I'll post this in here too

https://twitter.com/JosephJFlynn1/status/1406049892238254081?s=19

Hey ⁦@maddow⁩ and ⁦@CNN⁩ we are at a Pardon Party with General Flynn and Roger Stone wishing you were here…😂🇺🇸👍💥 https://t.co/2zcGRshh1F

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65145

File: 44073dd5e7f50da⋯.png (555.12 KB,1016x949,1016:949,Clipboard.png)

Originally posted at >>>/qresearch/13934224 (190052ZJUN21) Notable: Exclusive from Gen. Flynn: This Father's Day, I'm Issuing a Challenge to Every Dad in America

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Exclusive from Gen. Flynn: This Father's Day, I'm Issuing a Challenge to Every Dad in America

If you are a student of American history like me, you have heard President Reagan’s many references to America as a “shining city on a hill.”

As proud patriots, it is easy to relish in the Great Communicator’s bold picture of an America whose destiny is to shine the light of freedom far beyond our own borders. Yet many Americans do not realize that President Reagan did not develop the “city on a hill” concept on his own.

The great Puritan John Winthrop had a vision for the New World to be a city on a hill.

He famously cast this vision in a sermon delivered before he even stepped onto American soil. His inspiration came from the fifth chapter of Matthew’s gospel, which charges that “Ye are the light of the world. A city that is set on a hill cannot be hid.”

As governor of the Massachusetts Bay Colony, Winthrop lived out his vision, and many other colonies followed suit. America grew into her independence and quickly became a beacon of freedom to the rest of the world, just like Matthew wrote, just like Winthrop envisioned and just like Reagan acknowledged.

Our nation’s role as a “city on a hill” has a rich heritage worth being proud of.

However, it is important to note that the challenge of being a city on a hill is not a vague allusion to some watered-down idea of good living. It is a clear and direct call to action.

As Winthrop preached, “We are entered into a covenant with [the Lord] for this work. We have taken out a commission. … If we shall neglect the observation of these articles which are the ends we have propounded … the Lord will surely break out in wrath against us … and make us know the price of the breach of such a covenant.”

Winthrop believed that the settlers of the Massachusetts Bay Colony would be held accountable for their calling to be a city on a hill.

That burden is still in effect, yet today’s America has a serious lack of accountability. A loving father or mother will hold their children accountable for failing to meet expectations.

Why should our loving Heavenly Father turn a blind eye as America falls short of our calling? The world is still watching us.

Yet accountability does not start on a global level. It starts with you.

The great abolitionist Frederick Douglass is often quoted as having said, “It is easier to build strong children than to repair broken men.”

This Father’s Day, it is my challenge to fathers everywhere to be man enough to accept accountability for the rearing of your children. Invest yourself in a treasure without price, and the dividends will be without end.

If America is to continue to be a shining city on a hill, your home must be a shining beacon in your community.

Accept accountability, set an example worth following, and trust in the power of God Almighty to be your strength in trouble.

God Bless America!

https://www.westernjournal.com/exclusive-gen-flynn-fathers-day-issuing-challenge-every-dad-america/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65146

File: 7699df32bb10dbd⋯.png (213.96 KB,535x518,535:518,Clipboard.png)

Originally posted at >>>/qresearch/13934231 (190053ZJUN21) Notable: Former principal admits to filming daughter's friends — after blaming 9-year-old son

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Former principal admits to filming daughter's friends — after blaming 9-year-old son

https://twitter.com/nypost/status/1406047445855916035

>>>/qresearch/13934195

"We´re gonna need more breads."

- anon

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65147

File: 8e384c213ca2f7a⋯.png (364.89 KB,519x859,519:859,Clipboard.png)

Originally posted at >>>/qresearch/13934233 (190053ZJUN21) Notable: ARIZONA: Katie Hobbs Crushes Recall Petition Against House Speaker Rusty Bowers

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

ARIZONA: Katie Hobbs Crushes Recall Petition Against House Speaker Rusty Bowers

Hobbs "voided the voices of 24,551 citizens" according to America Restored

Katie Hobbs, Arizona’s Secretary of State, has rejected a recall petition against RINO House Speaker Rusty Bowers, despite there being well over the number of signatures required.

The recall petition for Arizona House Speaker Rusty Bowers had gathered 24,551 signatures, after being organised by the Arizona Patriot Party and coalition partners in the America Restored movement, 10% over the required number of 22,331. Bowers had been slammed by more conservative Arizonans for being against the America First movement and President Trump, and part of the swamp within the state’s legislature.

Katie Hobbs, Arizona’s Secretary of State, has rejected a recall petition against RINO House Speaker Rusty Bowers, despite there being well over the number of signatures required.

The recall petition for Arizona House Speaker Rusty Bowers had gathered 24,551 signatures, after being organised by the Arizona Patriot Party and coalition partners in the America Restored movement, 10% over the required number of 22,331. Bowers had been slammed by more conservative Arizonans for being against the America First movement and President Trump, and part of the swamp within the state’s legislature.

“The people have spoken,” said Steve Daniels, the President of the Arizona Patriot Party, “but they continue to silence our voices.” He added that despite the shutdown, the fact that they had gathered well over 24,000 signatures was “unmatched” because of the resistance they faced throughout the process. National File reported on Daniel’s recent arrest at a Chandler School Board meeting in front of hundreds of parents, which he believes was “politically motivated.”

Bowers had been conviced that he would be facing a recall in the upcoming election cycle, according to Arizona Central, and that he was “stunned” at the rejection of the signatures. “I should ask for an audit of these signatures,” he said. “There could be bamboo in those [signature] papers, there could be blue Sharpies,” mocking the current forensic audit taking place in Maricopa County of the results of the 2020 election, which he categorically refused to support.

As evidenced by his above remarks, Bowers is not a fan of election integrity. National File reported last December that Bowers in his position as Speaker refused to commit to a legislative hearing over the results of the 2020 presidential election, claiming that he couldn’t enforce the Constitution regarding presidential electors. He was also not that publically upset when Trump-hating Governor Doug Ducey vetoed 22 critical bills last month, including some on election integrity and banning critical race theory, claiming it was merely “an important civics lesson” to not ignore the Governor when creating legislature.

https://nationalfile.com/arizona-katie-hobbs-crushes-recall-petition-against-house-speaker-rusty-bowers/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65148

File: 03530fa67edaaa4⋯.png (160.32 KB,466x443,466:443,Clipboard.png)

Originally posted at >>>/qresearch/13934234 (190053ZJUN21) Notable: Exclusive from Gen. Flynn: This Father's Day, I'm Issuing a Challenge to Every Dad in America

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.westernjournal.com/exclusive-gen-flynn-fathers-day-issuing-challenge-every-dad-america/

The Western Journal (https://www.westernjournal.com/exclusive-gen-flynn-fathers-day-issuing-challenge-every-dad-america/)

Exclusive from Gen. Flynn: This Father's Day, I'm Issuing a Challenge to Every Dad in America

'Why should our loving Heavenly Father turn a blind eye as America falls short of our calling? The world is still watching us.'

https://t.me/RealGenFlynn/202

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65149

File: d44928591d741a2⋯.png (8.38 KB,545x272,545:272,Clipboard.png)

File: 6fda81afcfe57c2⋯.png (9.5 KB,1096x263,1096:263,Clipboard.png)

File: 3abd674825eb1c9⋯.png (76.28 KB,1211x489,1211:489,Clipboard.png)

Originally posted at >>>/qresearch/13934245 (190055ZJUN21) Notable: BOTH CHAMBERS (HOUSE / SENATE) IN SESSION ON TUES.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13934176

>8:35

20:35

2035

>BOTH CHAMBERS (HOUSE / SENATE) IN SESSION ON TUES.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65150

File: b165a81e7baf3fd⋯.png (13.11 KB,453x180,151:60,Clipboard.png)

Originally posted at >>>/qresearch/13934252 (190056ZJUN21) Notable: Florida prevailed in our lawsuit against the unlawful CDC order that shut down the cruise industry

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Gov. Ron DeSantis, [18.06.21 18:19]

Today, Florida prevailed in our lawsuit against the unlawful CDC order that shut down the cruise industry. This is a defeat for bureaucratic overreach, and a win for Florida jobs and tourism.

https://t.me/RonDeSantisChannel/333

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65151

File: b652039a55ebe28⋯.png (646.14 KB,856x488,107:61,Clipboard.png)

File: 0e72db4fc6b4ebe⋯.png (72.74 KB,644x823,644:823,Clipboard.png)

File: 9c53f18c835cd9a⋯.png (20.83 KB,645x594,215:198,Clipboard.png)

File: 72e377da7c1e56b⋯.png (241.98 KB,646x527,38:31,Clipboard.png)

File: 4a4cf1ff9058581⋯.png (222.3 KB,683x588,683:588,Clipboard.png)

Originally posted at >>>/qresearch/13934266 (190057ZJUN21) Notable: DHS chief claims reports of VP Harris laughing at border question are 'untrue,' calls GOP criticism of veep 'unfair and disrespectful'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

DHS chief claims reports of VP Harris laughing at border question are 'untrue,' calls GOP criticism of veep 'unfair and disrespectful'

Homeland Security Secretary Alejandro Mayorkas went after at least one Republican congressman this week for being "unfair and disrespectful" toward Vice President Kamala Harris for daring to suggest that she had laughed off questions about visiting the U.S.-Mexico border, going so far as to claim that such reports were "absolutely, unequivocally untrue."

Harris' awkward and uncomfortable cackle-tinged responses to uncomfortable questions have long been a source of criticism, even before she was President Joe Biden's No. 2.

Most recently, Harris' critics have been on her case for laughing inappropriately at questions about what is probably the biggest assignment Biden has given — and may ever give — her: Handling the border crisis that has seen hundreds of thousands of migrants swarming into the southern United States.

For example, in March, Harris was condemned by critics for laughing off a question about visiting the border. "Not today," she quipped before laughing. "But I have before, and I'm sure I will again."

And on June 7, Harris got dinged for laughing at NBC anchor Lester Holt's question about visiting the border as she was conducting her first foreign trip as vice president — a trip designed to talk to the presidents of Guatemala and Mexico about the border crisis.

After Holt pressed her multiple times about whether a border visit would ever happen, Harris tried to claim that "we've been to the border."

Holt, unmoved, pointed out, that she had not been to the border.

"And I haven't been to Europe!" Harris exclaimed, laughing. "And I mean — I don't understand the point that you're making."

https://youtu.be/0OsBHzBs8Y8

https://www.theblaze.com/news/dhs-chief-harris-laughing-untrue-unfair-disrespectful

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65152

File: d1b5945af2e0f38⋯.png (198.54 KB,300x417,100:139,Clipboard.png)

Originally posted at >>>/qresearch/13934272 (190058ZJUN21) Notable: University chancellor resigns after questionable photos surface | Follow the resignations

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Posted in the other bread, but anon would like to see a dig for these pics

University chancellor resigns after questionable photos surface

https://flipboard.com/article/university-of-arkansas-chancellor-resigns-after-questionable-photos-surface-on-/f-a1bc565caf%2Fnwahomepage.com

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65153

File: 18734fd03d11b20⋯.png (75.91 KB,604x599,604:599,Clipboard.png)

Originally posted at >>>/qresearch/13934286 (190059ZJUN21) Notable: So the head of Chinese counter intel efforts in America has defected to USA. He's in the hands of DIA right now. His name is Dong Jingwei.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/EmeraldRobinson/status/1405939127955210242

Emerald Robinson Latin cross

@EmeraldRobinson

·

9h

So the head of Chinese counter intel efforts in America has defected to USA. He's in the hands of DIA right now. His name is Dong Jingwei.

He's provided DIA with the contents of Hunter Biden's laptop.

He has confirmed that a THIRD of all Chinese students in US are spies.

Emerald Robinson Latin cross

@EmeraldRobinson

·

9h

According to multiple media outlets, this high level Chinese detector gave info to DIA:

1) Financial records on US govt officials & business people who took money from CCP.

2) US citizens who gave intel to China.

3) Names of Chinese spies currently in USA.

Emerald Robinson Latin cross

@EmeraldRobinson

·

9h

According to Townhall & Red State, Dong "has extremely embarrassing and damaging information about our intelligence community" in the data he has given to DIA.

You Retweeted

Emerald Robinson Latin cross

@EmeraldRobinson

CCP defector Dong has also provided DIA with:

4) early studies on COVID.

5) computer models of how COVID would spread & damage assessments to USA & Western nations.

6) Financial records of orgs that funded COVID & other bio weapons research.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65154

File: a755fd721cd21b1⋯.png (355.57 KB,862x668,431:334,Clipboard.png)

Originally posted at >>>/qresearch/13934297 (190101ZJUN21) Notable: International Auditor: Maricopa County Audit Report Not Expected for 8 Weeks – A Potential Sign There Are Numerous Issues to Inventory and Report

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/arizona-maricopa-county-audit-report-not-expected-8-weeks-potential-sign-numerous-issues-inventory-report/

International Auditor: Maricopa County Audit Report Not Expected for 8 Weeks – A Potential Sign There Are Numerous Issues to Inventory and Report

By Joe Hoft

Published June 18, 2021 at 7:45pm

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65155

File: ff2f1e55ff31532⋯.png (143.67 KB,796x614,398:307,Clipboard.png)

File: 0c63a445d69b486⋯.png (157.01 KB,821x810,821:810,Clipboard.png)

File: b96f4bcafbab879⋯.png (164.98 KB,780x701,780:701,Clipboard.png)

Originally posted at >>>/qresearch/13934325 (190105ZJUN21) Notable: Lawsuit: Ex-Calif. Sec. of State Conspired With Twitter to Silence Critics, Secure His Path to the Senate

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lawsuit: Ex-Calif. Sec. of State Conspired With Twitter to Silence Critics, Secure His Path to the Senate

On Thursday, a former lawyer and conservative commentator sued Twitter, former California Secretary of State (and current U.S. Senator) Alex Padilla, and others, alleging that these people conspired to suppress free speech and discriminate against conservative critics of Padilla in the name of fighting “misinformation” about the 2020 presidential election. Rogan O’Handley, the commentator in question, amassed 440,000 followers on Twitter as he shared his concerns about the 2020 election, but Twitter permanently booted him from the platform.

Padilla, as secretary of State, ran the newly created Office of Election Cybersecurity (OEC), which “devolved into a political weapon for censorship of disfavored speech by an overtly partisan Secretary of State’s office, more resembling an Orwellian ‘Ministry of Approved Information’ than a constitutionally restrained state agency,” the lawsuit states.

Padilla and the OEC worked with the Democratic firm SKDKnickerbocker (SKDK), the National Association of Secretaries of State (NASS), and Twitter to silence election integrity concerns and criticisms of Padilla’s office. According to the lawsuit, “the California censorship scheme included supporting the victory of SKDK’s client Joe Biden, the elevation of California Senator Kamala Harris to the Vice Presidency, and creating an opening for Padilla himself to be elevated to the position of United States Senator from California.”

To make matters worse, Padilla sidestepped state regulations on government contracts, claiming he had “emergency authority” to create the contract that would go to SKDK in private. He awarded the $35-million contract to SKDK, which publicly boasted of its involvement in Biden’s campaign. At the time, Democrats were considering Padilla as a replacement for Harris in the U.S. Senate, creating an obvious conflict of interest.

Padilla’s lack of budgetary authority to award the contract led California State Controller Betty Yee to reject paying SKDK. In February 2021, the California legislature belatedly agreed to pay Padilla’s past-due bills.

Meanwhile, NASS and OEC had a direct reporting channel to Twitter, which allowed the government bodies to flag certain messages for “misinformation.”

“We worked in partnership with social media platforms to develop more efficient reporting procedures for potential misinformation,” Padilla boasted at an NASS meeting. “Misinformation identified by our office or voters was promptly reviewed and, in most cases, removed by the social media platforms.”

Enter Rogan O’Handley, a former corporate and entertainment lawyer who put law behind him in order to engage in the political process as a commentator. He did well, too, with over 75 appearances on national news networks in the last year and a half. President Donald Trump even invited O’Handley to his summit on social media censorship.

As the lawsuit explains, “Mr. O’Handley’s speech infraction was his expression of the opinion that California, along with the rest of the nation, should audit its elections to protect against voter fraud.”

https://pjmedia.com/news-and-politics/tyler-o-neil/2021/06/18/lawsuit-twitter-conspired-with-democrats-on-orwellian-censorship-of-election-concerns-n1455569

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65156

File: 56e40a5b407e7e8⋯.png (37.91 KB,335x230,67:46,Clipboard.png)

Originally posted at >>>/qresearch/13934332 (190107ZJUN21) Notable: Rising star Conservative MP Imran Ahmad Khan, 47, elected in 2019 faces trial for sexually assaulting 15-year-old boy in 2008

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Rising star Conservative MP Imran Ahmad Khan, 47, elected in 2019 faces trial for sexually assaulting 15-year-old boy in 2008

Conservative MP for Wakefield Imran Ahmad Khan, 47, is facing trial

He appeared at Westminster Magistrates' Court on Thursday by video-link

He could be named on Friday after reporting restrictions were lifted

Khan has denied 'in the strongest terms' an allegation he groped a teenager

https://www.dailymail.co.uk/news/article-9701637/Rising-star-Conservative-MP-Imran-Ahmad-Khan-47-elected-2019-faces-tria.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65157

File: 48dce2d387b0943⋯.png (85.05 KB,1495x569,1495:569,Clipboard.png)

File: 91143bb9e2cb0f9⋯.png (173.01 KB,1479x779,1479:779,Clipboard.png)

File: f64f92cba4ace8b⋯.png (109.81 KB,997x935,997:935,Clipboard.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65158

File: 185344ee149f38d⋯.png (2.25 MB,1160x773,1160:773,Clipboard.png)

File: 1fd850d08fa7f12⋯.png (1.52 MB,1160x773,1160:773,Clipboard.png)

File: 5c7d9d54ec16fe0⋯.png (784.51 KB,830x873,830:873,Clipboard.png)

Originally posted at >>>/qresearch/13934347 (190109ZJUN21) Notable: White House freezes Ukraine military package that includes lethal weapons

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

1/2

White House freezes Ukraine military package that includes lethal weapons

Officials prepped $100 million worth of arms as Russia massed troops on the border, then put it on pause as the Biden-Putin summit approached.

Pictured is a closer view of equipment at Pogonovo training area in Voronezh, Russia.

06/18/2021 01:00 PM EDT

Updated: 06/18/2021 06:53 PM EDT

The Biden White House has temporarily halted a military aid package to Ukraine that would include lethal weapons, a plan originally made in response to aggressive Russian troop movements along Ukraine’s border this spring.

The aid package would be worth up to $100 million, according to four people familiar with internal deliberations.

The National Security Council directed officials to put the package together, as Washington grew increasingly concerned over a massive Russian military buildup near the border with Ukraine and in the Crimean Peninsula, according to three of the people, who like the others asked not to be named in order to speak candidly about internal discussions. Officials at the State Department and Pentagon worked to assemble the proposal.

But officials on the National Security Council ended up putting the proposal on hold after Russia announced it would draw down troops stationed near Ukraine and in the lead-up to President Joe Biden’s high-stakes summit with Russian President Vladimir Putin.

One of the sources said the package is still intact, and could be sent to Ukraine quickly. The Washington Post first reported that the administration considered and has now frozen the package. The fact that National Security Council officials froze the aid and the specific weapons discussed for inclusion in the aid package have not been previously reported.

Key items under consideration for the package include short-range air defense systems, small arms and more anti-tank weapons, according to two people with knowledge of the discussions.

In a statement after this article was published, White House press secretary Jen Psaki took issue with the characterization that aid to Ukraine was lacking: "The idea that we have held back security assistance to Ukraine is nonsense. Just last week—in the run-up to the U.S.-Russia Summit—we provided a $150 million package of security assistance, including lethal assistance."

The White House statement also acknowledged that additional security assistance had been made ready, but would be contingent upon Russia crossing territorial red lines: "We have also prepared contingency funds in the event of a further Russian incursion into Ukraine. As President Biden told President Putin directly, we will stand unwavering in support for Ukraine’s sovereignty and territorial integrity."

Since Russia’s 2014 invasion of Ukraine and annexation of Crimea, the United States has provided some $2.5 billion in military aid to Kyiv, including unarmed drones, radios and Javelin anti-tank missiles.

The latest proposal came about after Russia staged more than 100,000 troops, along with rocket battalions and heavy armor units, near Ukraine’s border this spring, according to estimates. In late April, Russia’s defense ministry announced that it would begin withdrawing some of the troops.

Past discussions over lethal military aid to Ukraine have been politically fraught, given concern over provoking Russia, issues with training the Ukrainian forces themselves and ongoing uneasiness over corruption in the Ukrainian government and military.

But despite Russia’s announcement, a top Ukrainian official said in May that about 100,000 Russian troops were still near its border and in Crimea, Al Jazeera reported. That same month, Biden officials told The New York Times that the number was closer to 80,000.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65159

File: 7eb19dbc4f19b2e⋯.png (124.4 KB,485x585,97:117,Clipboard.png)

File: 78cbe6ce5ad1901⋯.png (123.32 KB,478x410,239:205,Clipboard.png)

Originally posted at >>>/qresearch/13934353 (190110ZJUN21) Notable: White House contradicts the Politico story on the "freezing" of military assistance package for Ukraine as "nonsense" in a statement just released.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

White House contradicts the Politico story on the "freezing" of military assistance package for Ukraine as "nonsense" in a statement just released.

https://t.me/disclosetv/2963

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65160

File: 83880f30ce3e005⋯.png (135.26 KB,442x379,442:379,Clipboard.png)

Originally posted at >>>/qresearch/13934359 (190111ZJUN21) Notable: Magnitude 3.9 quake registered off Daytona beach as US Navy conducts "shock trials" on the USS Gerald R. Ford.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Magnitude 3.9 quake registered off Daytona beach as US Navy conducts "shock trials" on the nuclear aircraft carrier USS Gerald R. Ford.

https://t.me/disclosetv/2960

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65161

File: b93ef8a608d6385⋯.png (788.31 KB,2880x1516,720:379,Clipboard.png)

Originally posted at >>>/qresearch/13934377 (190114ZJUN21) Notable: Magnitude 3.9 quake registered off Daytona beach as US Navy conducts "shock trials" on the USS Gerald R. Ford.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65160

Pretty cool how USGS website shows the artificial earthquake from the explosion as a diamond instead of a circle.

Besides that there's also a lot of earthquakery last couple of days.

https://earthquake.usgs.gov/earthquakes/map/?currentFeatureId=us7000ee8n&extent=12.03932,-144.31641&extent=57.79794,-45.87891

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65162

File: 4e8146085b7ea9f⋯.png (23.79 KB,277x235,277:235,Clipboard.png)

Originally posted at >>>/qresearch/13934391 (190117ZJUN21) Notable: Magnitude 3.9 quake registered off Daytona beach as US Navy conducts "shock trials" on the USS Gerald R. Ford.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65161

what could possibly go wrong?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65163

File: fb5ed11d9638e44⋯.png (1.14 MB,1169x1557,1169:1557,Clipboard.png)

File: 65867daca6ea4a4⋯.png (321.08 KB,789x992,789:992,Clipboard.png)

File: c8fa54576299fd0⋯.png (425.73 KB,1046x1283,1046:1283,Clipboard.png)

File: 7978db3d58f6c94⋯.mp4 (257.93 KB,640x1136,40:71,Clipboard.mp4)

Originally posted at >>>/qresearch/13934413 (190121ZJUN21) Notable: Dan Scavino’s U2 “Beautiful Day” Instagram story

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13933364 (pb)

From Dan Scavino’s U2 “Beautiful Day” Instagram story

BEAUTIFUL DAY (song lyrics)

“The heart is a bloom, shoots up through stony ground

But there's no room, no space to rent in this town

You're out of luck and the reason that you had to care,

The traffic is stuck and you're not moving anywhere.

You thought you'd found a friend to take you out of this place

Someone you could lend a hand in return for grace

It's a beautiful day, the sky falls

And you feel like it's a beautiful day

It's a beautiful day

Don't let it get away

You're on the road but you've got no destination

You're in the mud, in the maze of her imagination

You love this town even if it doesn't ring true

You've been all over and it's been all over you

It's a beautiful day

Don't let it get away

It's a beautiful day

Don't let it get away

Touch me, take me to that other place

Teach me, I know I'm not a hopeless case

See the world in green and blue

See China right in front of you

See the canyons broken by cloud

See the tuna fleets clearing the sea out

See the bedouin fires at night

See the oil fields at first light

See the bird with a leaf in her mouth

After the flood all the colours came out

It was a beautiful day

A beautiful day

Don't let it get away

Touch me, take me to that other place

Reach me, I know Iím not a hopeless case

What you don't have you don't need it now

What you don't know you can feel it somehow

What you don't have you don't need it now

You don't need it now, you don't need it now

Beautiful day”

https://www.u2.com/lyrics/22

https://instagram.com/stories/danscavino/2599049937488505776?utm_source=ig_story_item_share&utm_medium=copy_link

https://instagram.com/danscavino?utm_medium=copy_link

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65164

File: b0eab932945ac86⋯.png (166.63 KB,442x425,26:25,Clipboard.png)

File: ea43bdabda9cce3⋯.png (535.1 KB,1029x614,1029:614,Clipboard.png)

Originally posted at >>>/qresearch/13934418 (190122ZJUN21) Notable: Truth About November 3rd You Won't See on CNN

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [18.06.21 12:29]

Truth About November 3rd You Won't See on CNN

Arizona here and definitely skeptical about Ducey's leaning. Like the Maricopa Sheriff, we're thinking he's been paid off by Democrat criminals to rock the Republican boat…

https://rumble.com/viozj1-truth-about-november-3rd-you-wont-see-on-cnn-seth-keshel-flyover-conservati.html

https://t.me/linwoodspeakstruth/3266

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65165

File: 468436940df1e1b⋯.png (13.16 KB,446x547,446:547,Clipboard.png)

Originally posted at >>>/qresearch/13934454 (190128ZJUN21) Notable: Lin Wood, [18.06.21 18:08] "The past 3 days have been a distraction"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [18.06.21 18:08]

The past 3 days have been a distraction as I have more meaningful things I want to do with my life than dealing with the shenanigans of lawyers who do not respect the rule of law.

But I will not stand idly on the sidelines and take no action in the face of injustice.

Our court system, too many lawyers, and the State Bar of Georgia leaders are corrupt. I am not the only pro-Trump lawyer being wrongfully persecuted. It is happening all over the nation.

I fight back for myself. And I know that in doing so, I am fighting back for many lawyers who raised legitimate legal questions about the November 2020 election. I am fighting back for We The People.

We cannot accept the illegal and fraudulent November 2020 election.

We must fight back. Our freedom depends on honest elections.

As time passes, we are identifying those who love America and freedom. And in so doing, we are identifying the Communists and Globalists who hate our country and our freedom.

We shall prevail.

Keep fighting.

https://t.me/linwoodspeakstruth/3274

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65166

Originally posted at >>>/qresearch/13934519 (190136ZJUN21) Notable: International Auditor: Maricopa County Audit Report Not Expected for 8 Weeks – A Potential Sign There Are Numerous Issues to Inventory and Report

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

International Auditor: Maricopa County Audit Report Not Expected for 8 Weeks – A Potential Sign There Are Numerous Issues to Inventory and Report

The audit work in the Arizona Senate’s audit of Maricopa County’s 2020 Election results is winding down. The audit report is not expected for another eight weeks.

Citizen’s Press linked to an article at the Epoch Times about the timeline in the Arizona 2020 Election audit. Here are some highlights from the article:

The final report for the 2020 election audit taking place in Arizona’s largest county is not expected to be out until mid-August, an official involved with the work says. Led by Cyber Ninjas, which was hired by the Arizona Senate, auditors are working on evaluating ballots after finishing their ballot recount.

The ballot evaluation is supposed to wrap up by the end of June—the Senate is slated to vacate the Veterans Memorial Coliseum, where the audit is taking place, by July 1—but there will be a few weeks worth of additional work after that, Ken Bennett, a former Arizona Republican secretary of state, told The Epoch Times.

“We’ve got the remainder of June to do what we’re doing here at the coliseum. Then there’s a few weeks probably of work on checking the envelope signatures, and looking at voter registration anomalies, and this work that we want to do on the retabulation, so maybe that takes up some or most of July, and then the auditors are going to need a few to several weeks to put the report together,” said Bennett, the Arizona Senate’s liaison for the audit.

Maricopa County is not just Arizona’s largest county in population but it is reportedly one of the largest counties in the country. The 2.1 ballots from the 2020 Election in Maricopa County represent around 60% of the state’s votes.

The reason the report from the audit might take some eight weeks to complete is that there may be many issues to address. If there was nothing wrong and the results of the audit matched the results reported in the 2020 election then the report could be done in a day, and ba-boom ba-boom, be finished and out the door.

If there are lots of issues, which we expect there will be (i.e. missing ballots, fraudulent ballots, missing chain of custody documentation, etc…) the audit report and any exhibits will take some time to formalize and review. The Arizona auditors may need a lot of time to draft a final report.

It’s likely there will be lots of issues identified in the Maricopa County audit report and the audit team will need as much time as possible to complete their final audit. Stay tuned.

https://www.thegatewaypundit.com/2021/06/arizona-maricopa-county-audit-report-not-expected-8-weeks-potential-sign-numerous-issues-inventory-report/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65167

File: aa266ce499e4e79⋯.png (192.58 KB,460x442,230:221,Clipboard.png)

Originally posted at >>>/qresearch/13934532 (190138ZJUN21) Notable: General Flynn at the Tampa Health & Freedom Conference. [Video]

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

KanekoaTheGreat, [18.06.21 17:06]

[Forwarded from TheStormHasArrived17💀 (TheStormHasArrived17)]

[ Video ]

General Flynn at the Tampa Health & Freedom Conference.

The underlying theme of his message was GET INVOLVED.

“Local action has a national impact.” 🇺🇸

(14:43)

https://t.me/KanekoaTheGreat/507

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65168

File: d260b5f03c99e11⋯.png (143.78 KB,348x789,116:263,Clipboard.png)

File: aba4513c173a01a⋯.png (668.89 KB,920x1280,23:32,Clipboard.png)

Originally posted at >>>/qresearch/13934547 (190141ZJUN21) Notable: Maricopa County Supervisors Holding Special Monday Meeting For Legal Advice Re: Election Audit

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Arizona Conservatives Take Action, [18.06.21 15:29]

[ Photo ]

Maricopa County Supervisors Holding Special Monday Meeting For Legal Advice Re: Election Audit

The Supervisors are slated to get legal advice about four different election-related topics, including "election authority and responsibility re: compliance with Senate subpoena.”

The purpose of the meeting appears be to prepare for different case scenarios, depending on Cyber Ninjas’ findings.

- AZ Law Twitter (https://twitter.com/arizonaslaw/status/1405935798986317825?s=12)

Read 👉🔗 AZ Law Blog (https://arizonaslaw.blogspot.com/2021/06/release-krakenattorney-alex-kolodin.html)

https://t.me/ArizonaConservatives/2114

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65169

File: d53748ee8378f79⋯.png (14.16 KB,425x242,425:242,Clipboard.png)

Originally posted at >>>/qresearch/13934562 (190143ZJUN21) Notable: CM Pence threw Trump under the bus in exchange for support from GOP super donors.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CodeMonkeyZ, [18.06.21 21:35]

Pence threw Trump under the bus in exchange for support from GOP super donors.

Super donors promised to back Pence for a 2024 presidential run.

Pence now goes around doing talks on a pseudo-campaign trail.

He thinks he has a chance. 🤣

Judas returned the silver he took for throwing Jesus under the bus.

Comparing Pence to Judas is disrespectful of Judas.==

https://t.me/CodeMonkeyZ/517

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65170

File: 3f2ced95cceb8f9⋯.mp4 (1.83 MB,480x368,30:23,Clipboard.mp4)

Originally posted at >>>/qresearch/13934618 (190150ZJUN21) Notable: Australian Military going door-to-door to ‘encourage‘ all Aussies to vaccinate.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The Australian Miliratry has now been given the task of going door-to-door to ‘encourage‘ all Aussies to submit to the COVID death-shot!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65171

File: 84bd7b0e32e5308⋯.png (121.3 KB,712x615,712:615,Clipboard.png)

Originally posted at >>>/qresearch/13934762 (190210ZJUN21) Notable: US to Withdraw Patriot Systems From Middle East, Repair Them for Use Against China, Report Says

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

US to Withdraw Patriot Systems From Middle East, Repair Them for Use Against China, Report Says

Just weeks ago, the Saudi government asked the US to help defend them against the Houthis or a potential attack by Iran; now the Pentagon has said the Saudis are capable of shouldering most of their defensive needs in their war in Yemen.

The US has already begun withdrawing some of its air defense forces from several Middle Eastern countries as it shifts them back to the US for maintenance, according to a Friday report by the Wall Street Journal (WSJ).

Citing administration officials, the report notes that several MIM-104 Patriot air defense batteries have been pulled out of Iraq, Kuwait, Jordan and Saudi Arabia, and that at least one Terminal High Altitude Area Defense (THAAD) system is also being pulled out of Saudi Arabia. Fighter squadrons are also being pulled out.

In all, the withdrawal amounts to hundreds of troops who crew and maintain the batteries, which for Patriots can include a radar, engagement control station, antenna mast group, electric power plant, and up to 16 separate missile launchers. For THAAD, each battery includes two mobile tactical operations centers, a powerful ground-based radar, and at least six missile launch systems.

Movement of the air defense sets was reportedly being considered in April, with the WSJ noting at the time that the Pentagon hoped to convince the Saudis to assume more responsibility for their own defense.

A senior defense official said on Friday that the pullout returns the US to a more typical deployment in the region after years of tensions with Iran stoked by the Trump administration and a raging war in Yemen by the Saudis and their allies. While Riyadh’s war against the rebel Houthi movement in Yemen continues, in recent weeks significant progress has been made by the Biden administration in negotiations to return to the 2015 Joint Comprehensive Plan of Action (JCPOA), a deal with Iran and six other nations.

The deal required Iran to give up its nuclear program in exchange for the lowering of international sanctions against its economy; then-US President Donald Trump unilaterally withdrew from the agreement in 2018, claiming that Iran was secretly violating it, and he reimposed the sanctions and forced US allies to respect them. In response, Iran began to back away from the treaty’s limitations, increasing the quality and quantity of uranium it was refining.

In Iran, presidential elections were held on Friday in which President Hassan Rouhani, the leader who signed the JCPOA with Germany, the EU, and the UN Security Council permanent members, was no longer eligible to run. The man projected to win, Ebrahim Raisi, Iran’s chief justice, is a conservative seen as closer to Ayatollah Khamenei than Rouhani, a moderate. Biden said Friday he wants the JCPOA to be back in operation before Raisi takes office in six weeks’ time.

https://sputniknews.com/middleeast/202106181083186861-us-to-withdraw-patriot-systems-from-middle-east-repair-them-for-use-against-china-report-says/

Hey china these are our plans

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65172

File: 37a2b6f7d9379ee⋯.png (592.86 KB,653x598,653:598,Clipboard.png)

File: 4a174792e9b639b⋯.png (557.66 KB,648x579,216:193,Clipboard.png)

Originally posted at >>>/qresearch/13934828 (190221ZJUN21) Notable: ‘Pee-wee’ star John Paragon’s cause of death revealed by coroner

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

‘Pee-wee’ star John Paragon’s cause of death revealed by coroner

Severe alcohol abuse played a role in the death of John Paragon, who was known as the beloved blue-faced genie Jambi on “Pee-wee’s Playhouse,” The Post has learned.

According to the Riverside County Coroner, Paragon died on April 3 from “cardiovascular disease with other significant conditions of chronic alcohol abuse.”

He was 66 years old.

The actor, who was known for his genie chant of the iconic magic words: “Meka leka hi meka hiney ho,” was found dead in his Palm Springs, Calif. residence around 6 p.m.

He played the role for nearly five years, from 1986 to 1991, and wrote several episodes, earning an Emmy nomination for Best Writing in a Children’s Special.

Born in Anchorage, Alaska, Paragon got his big break as a member of the groundbreaking Groundlings improv group, which made stars out of fellow “Pee-wee” alumni Paul Reubens as well as Melissa McCarthy, Kristen Wiig, Will Ferrell, Maya Rudolph and many more.

https://nypost.com/2021/06/18/pee-wee-star-john-paragons-cause-of-death-revealed/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65173

Originally posted at >>>/qresearch/13935006 (190252ZJUN21) Notable: , >>13935173 Ty Anon Bun…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Notables Are Not Endorsements

#17634

>>65016 Oped: ‘Exodus of the rich’ to Florida threatens disaster for NYC

>>65017 Colorado Secretary of State will have no 'fraudits' in her State

>>65018 Earthquake in Indiana yesterday (West of Bloomingdale)

>>65019 Planefag reports

>>65020 Joe Rogan slams CNN's Stelter: 'Your show is f—ing terrible'

>>65021 USSOCOM: Didn't a Q drop have a picture of an old guy wearing the 5 diamond patch?

>>65022 "Where the pedovores roam"

>>65023 EXPLOSIVE DEVELOPMENT: Election Worker Ralph Jones Is Now Second Worker Caught Double-Counting Ballots at the State Farm Center on Election Night!

>>65024 "Giant Mistake" - CDC Delays Emergency Meeting On Post-Vax Heart Inflammation Due To Juneteenth

>>65025 Soros Spending in Colorado Elections

>>65026 Human body activity associated with a task provided to a user may be used in a mining process of a cryptocurrency system.

>>65027 Illinois governor signs law expanding curbside voting, permanent vote by mail

>>65028 BREAKING: Congressman Gaetz Issues Letter to FBI Requesting Briefing on Wuhan Lab Whistleblower Investigation

>>65029, >>65030 HOT auditing review in August?

>>65031 Four Young Pilots have Mysteriously Died, but NOT from the Vaccine

>>65032, >>65033 Col. Dr. Lawrence Sellin: we need to transition from COVID-19 detectives to CCP-Hunters

>>65034 Osama Bin Laden’s Niece Trolls Biden With ‘Trump Won’ Sign At Geneva Summit

>>65035 Liz Cheney Puts The ‘Forever’ In ‘Forever War’

>>65036 #17634

#17633

>>64981 @Cernovich finds out California Democrats have a hotline to Twitter Thought Police?

>>64982 Reminder that while Newsbot self-doxxed, this doesn't mean BakerTools is comped.

>>64983 2.54 Billion Vaccine Shots administered around the world

>>64984 Two More Months: Maricopa County Audit Report 'expected in August'

>>64985 Former WH Physician called on President Biden to immediately undergo a cognitive test to prove he has 'sound mental capabilities'

>>64986 Michigan Senate Passes Legislation to Add Voter ID Requirements: ‘Overwhelmingly Popular’

>>64987 Based Black Clinician gives strong rebuke of critical race theory at school meeting

>>64988 New Congress Bills, >>64989, >>64990

>>64991 Why hasn't Federal Agent Ray Epps (Capitol Hill Riot instigator) been indicted?, >>64993 Is it because of this?

>>64992 Chucky 'Cheese Pizza' Schumer warns of Threat of 'Qanon' to 'Peace' in United States

>>64994 Child Modelling Agencies: a deep swamp of systematic and horrific phsyical, mental and sexual abuse

>>64996 North Carolina Senate just passed a bill banning private money from being used to administration elections

>>64995 Israel says it's willing to transfer 1 million vaccines to Palestine, if Palestine is willing to return 1 million vaccines later

>>64997 House Republicans Demand Answers After Biden Admin Lifts Iran Sanctions Without Consulting Congress

>>64998 Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others, >>64999, >>65000, >>65002, >>65006, >>65005, >>65007

>>65001 CNN's Chris Cuomo dares 'the Internet' to call him a fact-denier.

>>65003 Election Fraud: 2nd Atlanta official caught double scanning ballots

>>65004 Reminder why PCR tests are untrustworthy to begin with

>>65008 On the Geostate: Jeffrey Prather interview: Deep dive into USA, China and Russia military capabilities and vulnerabilities.

>>65009 PF Update: AF2 on the move

>>65010 (Source needed) Colorado Secretary of State has just moved to ban any election audit in the state of Colorado

>>65011 Meet California's Board of Behavioral Sciences, >>65012, >>65013

>>65014 Kind reminder for newfrens.

>>65015 #17633

#17632

>>64957 HUUUUGE. Chinese defector held at DIA is fount of intel

>>64958 DIG INTO MUSIC AND THE CONNECTIONS TO THE CULT - POSTED OR ARCHIVE

>>64959 Something is in the food, water and air that's holding everyone in a trance

>>64960, >>64961, >>64962 Witnessed

>>64963, >>64965 Qclockwork?

>>64964 Biden gave Vladimir Putin A pair of Randolph Aviator Sunglasses, in the Concord style

>>64966 Live Bats in Wuhan Lab & “Intense Clashes” Between China & France

Baker change

>>64967 Recap of last weeks covert wins

>>64968 (?) Newsbot self-doxxes + an explanation why this is of importance, >>64976

>>64969 More about Richard BEEBO Russell

>>64970 Predictive programming? Large swarts of the American Watersupply is a security disaster waiting to happen.

>>64971 Voice of Reason: Greenwich parents protest child-masking, 'critical race theory' & the school curriculum.

>>64972 The 'maybe' line: US-produced make-up sold in Canada, found high level of a marker for toxic PFAS substances.

>>64973 Gen. Flynn calls Georgian citizens to demand a resignation of their Senator

>>64974 CDC wiping Vaccine Deaths from their databases?

>>64975 'fact-checkrs' got their facts wrong again: it's legal to name an unindicted co-conspirator.

>>64977 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>64978 Corona insurance fraud? Judge orders insures to pay New Hampshire based hotel 100 million dollars in Corona damages.

>>64979 US Senate: ‘Establishment Covid-19 narrative is a lie’

>>64980 #17632

#17631

>>64939, >>64945 SKY KING ACTIVE

>>64946, >>64947 Day of the slave 1776 [Learn].

>>64922, >>64932, >>64934 Literally shaking

>>64923 RE: MAGNETIZING THE MASSES

>>64924 Chinese government now admits damage to fuel rods at the Taishan nuclear plant but said the problem is “common”

>>64925 Joe Biden’s Brother Frank Caught Violating Florida Traffic Law, Case Dismissed Due to Police Officer Out for ‘Training’

>>64927 “Silent Cry: The Darker Side of Trafficking” as we uncover the SATANIC RITUAL ABUSE happening not only under our very noses but in our OWN HOMES!

>>64926 @Dan Scavino >>64928 @Lin Wood >>64930 @Russ_Warrior

>>64931 "Buckle up, kids!" The NSA has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans

>>64933 Anti-Israel protests habbening

>>64936 HRC Body Double Chronological Comparison Chart

>>64937 Tucker takes aim at military's newest required reading

>>64935, >>64938, >>64940 Do not try to shrink me, [Gyp]sy

>>64941 New: An Army judge has been named the new chief of the Guantanamo war court judiciary!

>>64948 Chinese head of Intelligence defects to US with Intel on covid

>>64949 時間です, it is time

>>64950, >>64951, >>64952 Noteworthy Images

>>64953 IRS Denies Tax Exemption to Christian Group, Associates Bible With GOP

>>64954 RE: The 246th anniversary of Bunker Hill

>>64942, >>64943, >>64944, >>64955 Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

>>64956 #17631

>>64892, >>64896, >>64899

#17630

>>64894 We love you Dan 🇺🇸🦅 @DanScavino

>>64893, >>64895, >>64897, U.S. Attorney’s Office

>>64898, >>64900 Wannabe Vax Mandates RE: Pop Music

>>64901 FBI Ignored Its Own Warrant And Search Policies To Seize Millions From People's Safety Deposit Boxes

>>64902, >>64907 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>64903 Former Army Major Apache Pilot Convicted for Murder

>>64904 US Space Force operations chief: reveals DEWs to the public

>>64905, >>64906, >>64908 Potential Q Proof Incoming

>>64909 Top Doctor Issues Warning: COVID Vaccine ‘Spike Protein Shedding’ Damages Placenta, ‘We Are Being Experimented On’

>>64910 PREPARATION FOR WAR GAMES (FT. GENERAL MICHAEL FLYNN & ADMIRAL ROGERS)

>>64911 Vampires Exist

>>64913, >>64912 Cyber Polygon Exercise

>>64914 FOUR BA Pilots Dead, Potentially From Vaxx Complications

>>64915 Farmers vs Feds. The “Government Stole Our Water!”

>>64916 @DARPA high-res multi-waveform implantable stimulator chip and multi-scale electrodes for providing high-res therapy

>>64917, >>64920 CDC is holding an(other?) “emergency meeting” RE: Bloodclots

>>64918 Biden Attacks Voting Integrity Laws at Juneteenth Federal Holiday Signing Ceremony

>>64919 Remember Anons, just filter, do not reply!!!

>>64921 #17630

#17629

>>64867,>>64878 Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a 13 month battle with COVID-19

>>64868 Boston terror suspects uncle was married to CIA officer's daughter and even shared a home with the agent

>>64869, >>64870 RSBN Dan The Man On!

>>64871, >>64874 "Fraudits no place colorado" democrat colorado secretary state issues emergency rules prohibiting election audits

>>64872 PF

>>64873 @JSolomonReports says: GA Sec. of State Raffensperger sent a contractor to Fulton County, who found "twenty-nine pages of errors, mismanagement, mistakes, grotesque running of an election…"

>>64875 Fauci Denies Scientists 'Deliberately Suppressed' COVID Lab Theory

>>64876, >>64881, >>64883 Crimes against children, Pedo Roundup News.

>>64877 Crime boss Bilal Hamze shot dead in Sydney’s CBD

>>64879 Army Battalion Commander Under Inquiry After Allegedly Telling Soldiers ‘White People Are the Problem’

>>64880 Ted Cruz Slams the Democrat Election Takeover Bill: ‘Single Most Dangerous Piece of Legislation’ in Congress

>>64882 Kushner snags book deal with Harper Collins; no deal yet for Trump

>>64884 Portland's entire riot squad resigns in protest after a colleague is indicted for striking a rioter/activist/photographer.

>>64885 M Pompeo: "Never give an inch. Period."

>>64886 CM: Colorado Secretary of State just banned election audits.Why is she scared of an election audit? Surely unrelated: Dominion has (had?) offices in Colorado.

>>64887 CM: Soros’ biggest mistake this last election was not buying a majority on all the state legislatures.He won’t make the same mistake twice.

>>64888 CM: A “conspiracy theory” that is proven is called a fact.

>>64889 Lin Wood: President Trump won re-election by a historic landslide. Just sayin.’

>>64890 @RealGenFlynn: Fernando Mateo Receives Matching Funds For His Campaign Creating An Even Clearer Path To Victory in November

>>64891 #17629

#17628 (Anon Bun)

>>64842 CLIMATE LOCKDOWN?: Globalist Elite Call For Extreme Measures To Tackle ‘Climate Change’

>>64843 Rep Jackson: When I was Physician to President Trump, the media relentlessly pushed a narrative that he needed a cognitive test.

>>64844 USPacificFleet: #USNavy's Carrier Strike Group One arrives in Hawaiian Islands Operating Area: #CVN70 #US3rdFleet #NavyReadiness

>>64845 What If the Media Had Told the Truth? Five MSM Lies for Which Trump Has Been Vindicated, and the Damage They Caused

>>64846 Watch this parent absolutely obliterate Critical Race Theory at an Illinois school board meeting:

>>64847 Massive 700-pound George Floyd statue erected at Newark City Hall

>>64848 Ghislaine Maxwell is awarded just $13.70 compensation after pursuing 'child sex abuse victim' who sued her then dropped case to join Jeffrey Epstein compensation fund instead

>>64849 JUST IN - Mayor Lori Lightfoot officially declared racism a "public health emergency" today. Chicago to divert nearly $10 million in COVID funds to address the issue.

>>64850 Louisiana to offer cash prizes, scholarships for vaccinations

>>64851 Entire Portland Police Riot Squad Quits En Masse, As DA Begins Criminal Investigations Into Officers’ Conduct

>>64852 Dr. Kelli Ward: Arizona Case on Democrat Ballot Harvesting Will Be Decided by Supreme Court this Month – “We Are Hoping for a Victory”

>>64853 PEDO BUN 17June 21

>>64854 IDF Chief of Staff Lt.-Gen. Aviv Kohavi will fly to #Washington on Sunday to discuss a range of regional challenges with his #US counterparts, more than a month after he was set to go to discuss #Iran and other challenges.

>>64855 Hunter Biden was "BLACKLISTED" from Chateau Marmont, a swanky hotel and celebrity hangout in Los Angeles.

>>64856 HSBC to announce sale of French retail banking operations on Friday

>>64857 Revolver's Darren Beattie called out Chris Cuomo for smearing him as a "dirtbag" in relation to Revolver News's groundbreaking story about the FBI's involvement in January 6.

>>64858 NKorea's Kim says must prepare for 'dialogue and confrontation' with US: KCNA

>>64859 Swiss police reportedly evacuate train in Daeniken city due to 'situation that could pose threat'

>>64860 'Dawson's Creek' writer Heidi Ferrer dies by suicide after contracting COVID

>>64861 Temp Firm Financed By Stacey Abrams Infiltrated All Levels Of GA Government, Including Governor’s Office

>>64862 Michigan SOS Candidate Kristina Karamo Delivers +7,500 Affidavits Demanding Forensic Audit to Dishonest Jocelyn Benson – BUT HER OFFICE WON’T ACCEPT THEM!

>>64863 Criminal Charges Filed Against US Marshals For Refusing To Disclose Vaccination Status In Court.

>>64864 USNG: "I don't think we can do this enough," Lt. Col. Roger Brooks said. "#Patriot21 prepares service members and civilian partners to respond to situations as in the case of a pandemic, earthquake, or overseas in a warfight.

>>64865 GOP lawmakers, led by ex-White House doc, ask Biden to take cognitive test

>>64866 Child-care employee at Stepping Stones Daycare arrested on multiple charges of sex abuse

>>64929 #17628 (anon bun)

#17627

>>64813 Ex-Trump doctor turned GOP lawmaker wants Biden to take cognitive test

>>64814 Netanyahu reportedly shredded docs before handing office over to Bennett

>>64815 IDF Chief of Staff Kohavi to fly to Washington to discuss Iran, Gaza

>>64816 PF Reports

>>64817, >>64836 This texting is between Hunter and his cousin who is really not a high dollar “Madame”.

>>64820 Rep. Devin Nunes: Republicans Must Stop Talking to Establishment Media

>>64823 A red shoe a mile from Camp David.

>>64825 New Report Shows How Lockdowns Destroyed The Middle Class

>>64818, >>64819, >>64821, >>64822, >>64824 November 2019, the little fauci piece

>>64827 MSNBC’s Nicolle Wallace Lost 80% of Her Audience Since Trump Left Office

>>64826 (FROM JUNE 11th) FCC Announces Nationwide Emergency Alerting Test on August 11, 2021

>>64828 Need eyes on, please

>>64811 St. Louis couple who pointed guns at protesters last summer plead guilty to misdemeanor charges, agree to forfeit their weapons

>>64812 Fauci-Funded Researchers Including Ralph Baric Attended Chinese Government ‘Gain-Of-Function’ Conference With Military Scientists.

>>64829, >>64840 Reports coming in of British Airways pilots dying after being vaccinated+flying. Seeking confirmation.

>>64830, >>64835 Could it be 11. 3 ? I LIE coding in the books behind biden in Geneva

>>64832 Herschel Fink, the director of the AZ Democrat Party, says Stacey Abrams helped the Dems “win” in Arizona.

>>64833 Rep. Marjorie Taylor Greene, R-Ga., planned to introduce a bill Thursday morning that would abolish the Bureau of Alcohol, Tobacco, Firearms and Explosives

>>64834 President Trump to join Bo Snerdley on his hot new NYC radio show

>>64837 Former Pfizer VP: “The thing to be terrified of is your government’

>>64838 RSBN will also be airing Dan Scavino’s interview with Lara Lea Trump, tonight at 8PM EST

>>64839 Thomas Massie responds to reporter who wants to know his vaccination status…

>>64841 #17627

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65174

File: 4a636e6e0fca010⋯.png (404.29 KB,959x541,959:541,Clipboard.png)

Originally posted at >>>/qresearch/13935011 (190252ZJUN21) Notable: Pennsylvania poised to begin Arizona-style election audit with subpoena power

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Pennsylvania poised to begin Arizona-style election audit with subpoena power

Pennsylvania appears to beon the precipiceof initiating an Arizona-style audit of the 2020 election.

State Sen. David Argall, who heads a committee that oversees elections, told local news outlets he favors a forensic audit of the contest that state and federal officials insist was secure.

The Republican, under pressure by former President Donald Trump to take action, told the Capital-Star the audit is now a “very real possibility." The report said he is considering subpoenas for ballot information and which jurisdictions to send them.

“There are a lot of things under consideration right now, and I told them to check back in a week or two, and we hope to have some more detail,” he told the outlet after meeting with audit-supporting activists on Thursday.

Pennsylvania and Arizona are two states won by President Joe Biden last year in which post-election audits showed no widespread fraud.

But after dozens of lawsuits with election fraud allegations and voting irregularities were rejected by courts around the country, the audit in Maricopa County, commissioned by the GOP-led Arizona Senate, has become a beacon of hope for Trump and his supporters who herald the legislature-backed review as a model for other states to replicate.

Yet, just like Arizona Senate President Karen Fann — who has said the Maricopa County audit is not meant to overturn the 2020 election results but rather to restore trust in the system and influence possible changes to voting laws — Argall seems to acknowledge there will be no effort geared toward trying to change the results of the November contest, even if critics peg it as an effort meant to undermine confidence in the outcome, including Democratic Gov. Tom Wolf.

“The Electoral College has spoken. You know the president has been sworn in. I understand that’s a reality," he said Friday during Spotlight PA’s Capitol Live event.

Similar to efforts in other states, GOP lawmakers in Pennsylvania are pursuing a raft of voting reforms, and Argall argued an audit of the 2020 election would only help shore up the process.

“Do I have 100% confidence … that everything was perfect? No, I’d really like us to take a detailed review of that,” Argall said. “That’s why we’re looking at changing pieces of the election legislation, and it’s also why I think it wouldn’t hurt at all to go back, do that audit, and say, ‘How exactly did that work out?'"

Republican lawmakers from several states, including Pennsylvania, have made the pilgrimage to Veterans Memorial Coliseum in Phoenix, where the Maricopa County audit is stationed, to learn more about the process. With this in mind, Trump issued a statement this month urging the Pennsylvania Legislature to follow suit with an audit of its own and warned Argall by name he risks losing his position if he doesn't comply.

"Great patriots led by State Senator Doug Mastriano, Senator Cris Dush, and State Representative Rob Kauffman went to Maricopa County, Arizona, to learn the best practices for conducting a full Forensic Audit of the 2020 General Election. Now the Pennsylvania Senate needs to act," Trump said in a tweemail. "Senate President Jake Corman needs to fulfill his promise to his constituents to conduct a full Forensic Audit. Senator Dave Argall, Chairman of the State Government Committee, has to authorize the subpoenas, if necessary. The people of Pennsylvania and America deserve to know the truth. If the Pennsylvania Senate leadership doesn’t act, there is no way they will ever get re-elected!"

Argall, whose district covers part of Berks County and all of Schuylkill County in eastern Pennsylvania, won reelection for another four-year term in 2020.

All this is playing out as the Justice Department appears poised to crack down on the Maricopa County audit before releasing its findings and any copycats before they get started.

The Justice Department is setting its focus on the GOP-backed voting laws being passed in states across the country in the wake of the 2020 election, Attorney General Merrick Garland said in a speech last Friday. He added that the agency "will apply the same scrutiny to post-election audits to ensure they abide by federal statutory requirements to protect election records and avoid the intimidation of voters. In that regard, we will publish guidance explaining the civil and criminal statutes that apply to post-election audits."

https://www.washingtonexaminer.com/news/pennsylvania-arizona-style-election-audit-subpoena-power

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65175

File: 33288713778b287⋯.png (2.93 MB,1512x2016,3:4,Clipboard.png)

Originally posted at >>>/qresearch/13935021 (190255ZJUN21) Notable: Our Guys Godspeed

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65177

File: 9a1da0a236098c6⋯.mp4 (8.26 MB,1280x720,16:9,Clipboard.mp4)

File: fdc65b06cd376bd⋯.mp4 (1.74 MB,384x288,4:3,Clipboard.mp4)

File: c79bfcc3f5f68a6⋯.mp4 (4.74 MB,384x288,4:3,Clipboard.mp4)

Originally posted at >>>/qresearch/13935027 (190256ZJUN21) Notable: Baker Change

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BAKER LOOKING FOR HANDOFF

In the meantime, let's watch some golden oldies!

**

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65178

Originally posted at >>>/qresearch/13935031 (190256ZJUN21) Notable: Baker Change

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65177

Confirmed?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65179

Originally posted at >>>/qresearch/13935043 (190258ZJUN21) Notable: Another Dough Ty anon!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13934978

>>>/qresearch/13934991

UNFUCKED DOUGH

https://controlc.com/8affd408

Notables Are Not Endorsements

#17638

>>65148, >>65145 Exclusive from Gen. Flynn: This Father's Day, I'm Issuing a Challenge to Every Dad in America

>>65149 BOTH CHAMBERS (HOUSE / SENATE) IN SESSION ON TUES.

>>65152, >>65157 University chancellor resigns after questionable photos surface | Follow the resignations

>>65160, >>65162, >>65161 Magnitude 3.9 quake registered off Daytona beach as US Navy conducts "shock trials" on the USS Gerald R. Ford.

>>65156 Rising star Conservative MP Imran Ahmad Khan, 47, elected in 2019 faces trial for sexually assaulting 15-year-old boy in 2008

>>65167 General Flynn at the Tampa Health & Freedom Conference. [Video]

>>65166, 13934547 International Auditor: Maricopa County Audit Report Not Expected for 8 Weeks – A Potential Sign There Are Numerous Issues to Inventory and Report

>>65165 Lin Wood, [18.06.21 18:08] "The past 3 days have been a distraction"

>>65163 Dan Scavino’s U2 “Beautiful Day” Instagram story

>>65164 Truth About November 3rd You Won't See on CNN

>>65159 White House contradicts the Politico story on the "freezing" of military assistance package for Ukraine as "nonsense" in a statement just released.

>>65158 White House freezes Ukraine military package that includes lethal weapons

>>65058 (pb) Suspicious package at #CIA's headquarters in McLean, Virginia. Parameter closed down. Bomb squad at the site.

>>65114 (pb) RIDERS OF JUSTICE (2020), COVERS A LOT OF UNCOMFORTABLE TOPICS, INCLUDING AUTISTISM SIDE

>>65170 Australian Military going door-to-door to ‘encourage‘ all Aussies to vaccinate.

>>65171 US to Withdraw Patriot Systems From Middle East, Repair Them for Use Against China, Report Says

>>65172 ‘Pee-wee’ star John Paragon’s cause of death revealed by coroner

Dual Baker/Notaker Contribs

>>65141 So the FBI was preparing for an "attack" from a group in which they already had an informant???

>>65142 DJT Can anybody believe this? No wonder our Country is going to hell!

>>65143 DJT pushing the SHOT

>>65144 General Flynn and Roger Stone trolling

>>65146 Former principal admits to filming daughter's friends — after blaming 9-year-old son

>>65147 ARIZONA: Katie Hobbs Crushes Recall Petition Against House Speaker Rusty Bowers

>>65150 Florida prevailed in our lawsuit against the unlawful CDC order that shut down the cruise industry

>>65151 DHS chief claims reports of VP Harris laughing at border question are 'untrue,' calls GOP criticism of veep 'unfair and disrespectful'

>>65153 So the head of Chinese counter intel efforts in America has defected to USA. He's in the hands of DIA right now. His name is Dong Jingwei.

>>65154 International Auditor: Maricopa County Audit Report Not Expected for 8 Weeks – A Potential Sign There Are Numerous Issues to Inventory and Report

>>65155 Lawsuit: Ex-Calif. Sec. of State Conspired With Twitter to Silence Critics, Secure His Path to the Senate

>>65168 Maricopa County Supervisors Holding Special Monday Meeting For Legal Advice Re: Election Audit

>>65169 CM Pence threw Trump under the bus in exchange for support from GOP super donors.

>>>/qresearch/13934982 #17638

#17637

TBC

#17636

TBC

#17635

TBC

#17634

>>65016 Oped: ‘Exodus of the rich’ to Florida threatens disaster for NYC

>>65017 Colorado Secretary of State will have no 'fraudits' in her State

>>65018 Earthquake in Indiana yesterday (West of Bloomingdale)

>>65019 Planefag reports

>>65020 Joe Rogan slams CNN's Stelter: 'Your show is f—ing terrible'

>>65021 USSOCOM: Didn't a Q drop have a picture of an old guy wearing the 5 diamond patch?

>>65022 "Where the pedovores roam"

>>65023 EXPLOSIVE DEVELOPMENT: Election Worker Ralph Jones Is Now Second Worker Caught Double-Counting Ballots at the State Farm Center on Election Night!

>>65024 "Giant Mistake" - CDC Delays Emergency Meeting On Post-Vax Heart Inflammation Due To Juneteenth

>>65025 Soros Spending in Colorado Elections

>>65026 Human body activity associated with a task provided to a user may be used in a mining process of a cryptocurrency system.

>>65027 Illinois governor signs law expanding curbside voting, permanent vote by mail

>>65028 BREAKING: Congressman Gaetz Issues Letter to FBI Requesting Briefing on Wuhan Lab Whistleblower Investigation

>>65029, >>65030 HOT auditing review in August?

>>65031 Four Young Pilots have Mysteriously Died, but NOT from the Vaccine

>>65032, >>65033 Col. Dr. Lawrence Sellin: we need to transition from COVID-19 detectives to CCP-Hunters

>>65034 Osama Bin Laden’s Niece Trolls Biden With ‘Trump Won’ Sign At Geneva Summit

>>65035 Liz Cheney Puts The ‘Forever’ In ‘Forever War’

>>65036 #17634

#17633

>>64981 @Cernovich finds out California Democrats have a hotline to Twitter Thought Police?

>>64982 Reminder that while Newsbot self-doxxed, this doesn't mean BakerTools is comped.

>>64983 2.54 Billion Vaccine Shots administered around the world

>>64984 Two More Months: Maricopa County Audit Report 'expected in August'

>>64985 Former WH Physician called on President Biden to immediately undergo a cognitive test to prove he has 'sound mental capabilities'

>>64986 Michigan Senate Passes Legislation to Add Voter ID Requirements: ‘Overwhelmingly Popular’

>>64987 Based Black Clinician gives strong rebuke of critical race theory at school meeting

>>64988 New Congress Bills, >>64989, >>64990

>>64991 Why hasn't Federal Agent Ray Epps (Capitol Hill Riot instigator) been indicted?, >>64993 Is it because of this?

>>64992 Chucky 'Cheese Pizza' Schumer warns of Threat of 'Qanon' to 'Peace' in United States

>>64994 Child Modelling Agencies: a deep swamp of systematic and horrific phsyical, mental and sexual abuse

>>64996 North Carolina Senate just passed a bill banning private money from being used to administration elections

>>64995 Israel says it's willing to transfer 1 million vaccines to Palestine, if Palestine is willing to return 1 million vaccines later

>>64997 House Republicans Demand Answers After Biden Admin Lifts Iran Sanctions Without Consulting Congress

>>64998 Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others, >>64999, >>65000, >>65002, >>65006, >>65005, >>65007

>>65001 CNN's Chris Cuomo dares 'the Internet' to call him a fact-denier.

>>65003 Election Fraud: 2nd Atlanta official caught double scanning ballots

>>65004 Reminder why PCR tests are untrustworthy to begin with

>>65008 On the Geostate: Jeffrey Prather interview: Deep dive into USA, China and Russia military capabilities and vulnerabilities.

>>65009 PF Update: AF2 on the move

>>65010 (Source needed) Colorado Secretary of State has just moved to ban any election audit in the state of Colorado

>>65011 Meet California's Board of Behavioral Sciences, >>65012, >>65013

>>65014 Kind reminder for newfrens.

>>65015 #17633

#17632

>>64957 HUUUUGE. Chinese defector held at DIA is fount of intel

>>64958 DIG INTO MUSIC AND THE CONNECTIONS TO THE CULT - POSTED OR ARCHIVE

>>64959 Something is in the food, water and air that's holding everyone in a trance

>>64960, >>64961, >>64962 Witnessed

>>64963, >>64965 Qclockwork?

>>64964 Biden gave Vladimir Putin A pair of Randolph Aviator Sunglasses, in the Concord style

>>64966 Live Bats in Wuhan Lab & “Intense Clashes” Between China & France

Baker change

>>64967 Recap of last weeks covert wins

>>64968 (?) Newsbot self-doxxes + an explanation why this is of importance, >>64976

>>64969 More about Richard BEEBO Russell

>>64970 Predictive programming? Large swarts of the American Watersupply is a security disaster waiting to happen.

>>64971 Voice of Reason: Greenwich parents protest child-masking, 'critical race theory' & the school curriculum.

>>64972 The 'maybe' line: US-produced make-up sold in Canada, found high level of a marker for toxic PFAS substances.

>>64973 Gen. Flynn calls Georgian citizens to demand a resignation of their Senator

>>64974 CDC wiping Vaccine Deaths from their databases?

>>64975 'fact-checkrs' got their facts wrong again: it's legal to name an unindicted co-conspirator.

>>64977 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>64978 Corona insurance fraud? Judge orders insures to pay New Hampshire based hotel 100 million dollars in Corona damages.

>>64979 US Senate: ‘Establishment Covid-19 narrative is a lie’

>>64980 #17632

#17631

>>64939, >>64945 SKY KING ACTIVE

>>64946, >>64947 Day of the slave 1776 [Learn].

>>64922, >>64932, >>64934 Literally shaking

>>64923 RE: MAGNETIZING THE MASSES

>>64924 Chinese government now admits damage to fuel rods at the Taishan nuclear plant but said the problem is “common”

>>64925 Joe Biden’s Brother Frank Caught Violating Florida Traffic Law, Case Dismissed Due to Police Officer Out for ‘Training’

>>64927 “Silent Cry: The Darker Side of Trafficking” as we uncover the SATANIC RITUAL ABUSE happening not only under our very noses but in our OWN HOMES!

>>64926 @Dan Scavino >>64928 @Lin Wood >>64930 @Russ_Warrior

>>64931 "Buckle up, kids!" The NSA has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans

>>64933 Anti-Israel protests habbening

>>64936 HRC Body Double Chronological Comparison Chart

>>64937 Tucker takes aim at military's newest required reading

>>64935, >>64938, >>64940 Do not try to shrink me, [Gyp]sy

>>64941 New: An Army judge has been named the new chief of the Guantanamo war court judiciary!

>>64948 Chinese head of Intelligence defects to US with Intel on covid

>>64949 時間です, it is time

>>64950, >>64951, >>64952 Noteworthy Images

>>64953 IRS Denies Tax Exemption to Christian Group, Associates Bible With GOP

>>64954 RE: The 246th anniversary of Bunker Hill

>>64942, >>64943, >>64944, >>64955 Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

>>64956 #17631

>>64892, >>64896, >>64899

#17630

>>64894 We love you Dan 🇺🇸🦅 @DanScavino

>>64893, >>64895, >>64897, U.S. Attorney’s Office

>>64898, >>64900 Wannabe Vax Mandates RE: Pop Music

>>64901 FBI Ignored Its Own Warrant And Search Policies To Seize Millions From People's Safety Deposit Boxes

>>64902, >>64907 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>64903 Former Army Major Apache Pilot Convicted for Murder

>>64904 US Space Force operations chief: reveals DEWs to the public

>>64905, >>64906, >>64908 Potential Q Proof Incoming

>>64909 Top Doctor Issues Warning: COVID Vaccine ‘Spike Protein Shedding’ Damages Placenta, ‘We Are Being Experimented On’

>>64910 PREPARATION FOR WAR GAMES (FT. GENERAL MICHAEL FLYNN & ADMIRAL ROGERS)

>>64911 Vampires Exist

>>64913, >>64912 Cyber Polygon Exercise

>>64914 FOUR BA Pilots Dead, Potentially From Vaxx Complications

>>64915 Farmers vs Feds. The “Government Stole Our Water!”

>>64916 @DARPA high-res multi-waveform implantable stimulator chip and multi-scale electrodes for providing high-res therapy

>>64917, >>64920 CDC is holding an(other?) “emergency meeting” RE: Bloodclots

>>64918 Biden Attacks Voting Integrity Laws at Juneteenth Federal Holiday Signing Ceremony

>>64919 Remember Anons, just filter, do not reply!!!

>>64921 #17630

#17629

>>64867,>>64878 Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a 13 month battle with COVID-19

>>64868 Boston terror suspects uncle was married to CIA officer's daughter and even shared a home with the agent

>>64869, >>64870 RSBN Dan The Man On!

>>64871, >>64874 "Fraudits no place colorado" democrat colorado secretary state issues emergency rules prohibiting election audits

>>64872 PF

>>64873 @JSolomonReports says: GA Sec. of State Raffensperger sent a contractor to Fulton County, who found "twenty-nine pages of errors, mismanagement, mistakes, grotesque running of an election…"

>>64875 Fauci Denies Scientists 'Deliberately Suppressed' COVID Lab Theory

>>64876, >>64881, >>64883 Crimes against children, Pedo Roundup News.

>>64877 Crime boss Bilal Hamze shot dead in Sydney’s CBD

>>64879 Army Battalion Commander Under Inquiry After Allegedly Telling Soldiers ‘White People Are the Problem’

>>64880 Ted Cruz Slams the Democrat Election Takeover Bill: ‘Single Most Dangerous Piece of Legislation’ in Congress

>>64882 Kushner snags book deal with Harper Collins; no deal yet for Trump

>>64884 Portland's entire riot squad resigns in protest after a colleague is indicted for striking a rioter/activist/photographer.

>>64885 M Pompeo: "Never give an inch. Period."

>>64886 CM: Colorado Secretary of State just banned election audits.Why is she scared of an election audit? Surely unrelated: Dominion has (had?) offices in Colorado.

>>64887 CM: Soros’ biggest mistake this last election was not buying a majority on all the state legislatures.He won’t make the same mistake twice.

>>64888 CM: A “conspiracy theory” that is proven is called a fact.

>>64889 Lin Wood: President Trump won re-election by a historic landslide. Just sayin.’

>>64890 @RealGenFlynn: Fernando Mateo Receives Matching Funds For His Campaign Creating An Even Clearer Path To Victory in November

>>64891 #17629

#17628 (Anon Bun)

>>64842 CLIMATE LOCKDOWN?: Globalist Elite Call For Extreme Measures To Tackle ‘Climate Change’

>>64843 Rep Jackson: When I was Physician to President Trump, the media relentlessly pushed a narrative that he needed a cognitive test.

>>64844 USPacificFleet: #USNavy's Carrier Strike Group One arrives in Hawaiian Islands Operating Area: #CVN70 #US3rdFleet #NavyReadiness

>>64845 What If the Media Had Told the Truth? Five MSM Lies for Which Trump Has Been Vindicated, and the Damage They Caused

>>64846 Watch this parent absolutely obliterate Critical Race Theory at an Illinois school board meeting:

>>64847 Massive 700-pound George Floyd statue erected at Newark City Hall

>>64848 Ghislaine Maxwell is awarded just $13.70 compensation after pursuing 'child sex abuse victim' who sued her then dropped case to join Jeffrey Epstein compensation fund instead

>>64849 JUST IN - Mayor Lori Lightfoot officially declared racism a "public health emergency" today. Chicago to divert nearly $10 million in COVID funds to address the issue.

>>64850 Louisiana to offer cash prizes, scholarships for vaccinations

>>64851 Entire Portland Police Riot Squad Quits En Masse, As DA Begins Criminal Investigations Into Officers’ Conduct

>>64852 Dr. Kelli Ward: Arizona Case on Democrat Ballot Harvesting Will Be Decided by Supreme Court this Month – “We Are Hoping for a Victory”

>>64853 PEDO BUN 17June 21

>>64854 IDF Chief of Staff Lt.-Gen. Aviv Kohavi will fly to #Washington on Sunday to discuss a range of regional challenges with his #US counterparts, more than a month after he was set to go to discuss #Iran and other challenges.

>>64855 Hunter Biden was "BLACKLISTED" from Chateau Marmont, a swanky hotel and celebrity hangout in Los Angeles.

>>64856 HSBC to announce sale of French retail banking operations on Friday

>>64857 Revolver's Darren Beattie called out Chris Cuomo for smearing him as a "dirtbag" in relation to Revolver News's groundbreaking story about the FBI's involvement in January 6.

>>64858 NKorea's Kim says must prepare for 'dialogue and confrontation' with US: KCNA

>>64859 Swiss police reportedly evacuate train in Daeniken city due to 'situation that could pose threat'

>>64860 'Dawson's Creek' writer Heidi Ferrer dies by suicide after contracting COVID

>>64861 Temp Firm Financed By Stacey Abrams Infiltrated All Levels Of GA Government, Including Governor’s Office

>>64862 Michigan SOS Candidate Kristina Karamo Delivers +7,500 Affidavits Demanding Forensic Audit to Dishonest Jocelyn Benson – BUT HER OFFICE WON’T ACCEPT THEM!

>>64863 Criminal Charges Filed Against US Marshals For Refusing To Disclose Vaccination Status In Court.

>>64864 USNG: "I don't think we can do this enough," Lt. Col. Roger Brooks said. "#Patriot21 prepares service members and civilian partners to respond to situations as in the case of a pandemic, earthquake, or overseas in a warfight.

>>64865 GOP lawmakers, led by ex-White House doc, ask Biden to take cognitive test

>>64866 Child-care employee at Stepping Stones Daycare arrested on multiple charges of sex abuse

>>64929 #17628 (anon bun)

#17627

>>64813 Ex-Trump doctor turned GOP lawmaker wants Biden to take cognitive test

>>64814 Netanyahu reportedly shredded docs before handing office over to Bennett

>>64815 IDF Chief of Staff Kohavi to fly to Washington to discuss Iran, Gaza

>>64816 PF Reports

>>64817, >>64836 This texting is between Hunter and his cousin who is really not a high dollar “Madame”.

>>64820 Rep. Devin Nunes: Republicans Must Stop Talking to Establishment Media

>>64823 A red shoe a mile from Camp David.

>>64825 New Report Shows How Lockdowns Destroyed The Middle Class

>>64818, >>64819, >>64821, >>64822, >>64824 November 2019, the little fauci piece

>>64827 MSNBC’s Nicolle Wallace Lost 80% of Her Audience Since Trump Left Office

>>64826 (FROM JUNE 11th) FCC Announces Nationwide Emergency Alerting Test on August 11, 2021

>>64828 Need eyes on, please

>>64811 St. Louis couple who pointed guns at protesters last summer plead guilty to misdemeanor charges, agree to forfeit their weapons

>>64812 Fauci-Funded Researchers Including Ralph Baric Attended Chinese Government ‘Gain-Of-Function’ Conference With Military Scientists.

>>64829, >>64840 Reports coming in of British Airways pilots dying after being vaccinated+flying. Seeking confirmation.

>>64830, >>64835 Could it be 11. 3 ? I LIE coding in the books behind biden in Geneva

>>64832 Herschel Fink, the director of the AZ Democrat Party, says Stacey Abrams helped the Dems “win” in Arizona.

>>64833 Rep. Marjorie Taylor Greene, R-Ga., planned to introduce a bill Thursday morning that would abolish the Bureau of Alcohol, Tobacco, Firearms and Explosives

>>64834 President Trump to join Bo Snerdley on his hot new NYC radio show

>>64837 Former Pfizer VP: “The thing to be terrified of is your government’

>>64838 RSBN will also be airing Dan Scavino’s interview with Lara Lea Trump, tonight at 8PM EST

>>64839 Thomas Massie responds to reporter who wants to know his vaccination status…

>>64841 #17627

Previously Collected Notables

>>>/qresearch/13923436 #17624, >>>/qresearch/13924225 #17625, >>64831 #17626

>>64716 1/2 #17623, >>64724 2/2 #17623

>>64629 #17620, >>64668 #17621, >>64698 #17622

>>64628 #17617, >>64512 #17618, >>64593 #17619

>>64419 #17614, >>64446 #17615, >>64472 #17616

>>64335 #17611, >>64365 #17612, >>64395 #17613

>>64252 #17608, >>64279 #17609, >>>/qresearch/13915693 #17610

>>64220 #17605, >>64247 #17606, >>64242 #17607

>>64110 #17602, >>64146 #17603, >>64191 #17604

>>>/qresearch/13909584 #17599, >>64031 #17600, >>64071 #17601

>>63901 #17596, >>63940 #17597, >>63985 #17598

>>63948 #17593, >>63949 #17594, >>63950 #17595

>>63945 #17590, >>63946 #17591, >>63947 #17592

>>63756 #17587, >>63765 #17588, ##13894594 #17589

>>63746 #17584, >>63718 #17585, >>63740 #17586

>>63743 #17581, >>63650 #17582, >>63668 #17583

>>63605 #17578, >>63583 #17579, >>63602 #17580

>>>/qresearch/13893318 #17576, >>63599 #17577, >>63578 #17577

>>63485 #17573, >>>/qresearch/13893283 #17574, >>>/qresearch/13893303 #17575

>>63429 #17570, >>63449 #17571, >>63484 #17572

>>63384 #17567, >>63399 #17568, >>63407 #17569

>>63322 #17564, >>63347 #17565, >>63380 #17566

Notables Aggregators: https://wearethene.ws & https://qnotables.com

>>>/qresearch/13685931 Q Research Notables #7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65180

File: fe8934399edc9f2⋯.png (436.96 KB,1025x628,1025:628,Clipboard.png)

Originally posted at >>>/qresearch/13935061 (190301ZJUN21) Notable: Our Guys Godspeed

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65175

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65181

Originally posted at >>>/qresearch/13935072 (190303ZJUN21) Notable: #176351, >>13935173 #176352

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13935052, >>65179

#17635

>>65037, >>65038, >>65049, >>65088 RE: Covid Vax/Blood cells/Spike Proteins, Is This Verifiable? Contagious?

>>65039, >>65058, Clowns trending for attempting to bomb themselves

>>65040, >>65043 New Details Emerge in Chinese Defector Story

>>65041 Seattle:10 Arrested Thursday, Pro-Palestinian Protesters attempted to block the unloading of a Israeli Cargo Ship

>>65042 Entire Portland riot squad resigns after officer's indictment

>>65045, >>65047 Pence gets drowned out by hecklers at the Faith & Freedom Coalition summit

>>65046 Pennsylvania Audit Prospects

>>65048, >>65080 The Dems. taking each other down

>>65053 @mikepompeo (Probably something)

>>65065, >>65073, >>65077 RE: Think Reflection/Watch the water ( Scavino pics, Symbolism etc.)

>>65067 USSOCOM 3 YEAR Q DELTA (autist contribution?)

>>65074 Katy Perry & Orlando Bloom: Transmissions from the Future

>>65081, >>65084 EU approval of Russia's Sputnik V vaccine delayed, sources say

>>65082 PFIZER ??? PIPELINE

>>65085 'Pee-wee's Playhouse' star John Paragon dead at 66

>>65086 Who was in charge at DIA during Hussein's occupation?

>>65087 Could Chinese Vice-Premier be the Source Of Hunter Bidens Hardrives?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65182

File: 3a3096c175b365d⋯.jpg (79.46 KB,600x335,120:67,Clipboard.jpg)

Originally posted at >>>/qresearch/13935116 (190310ZJUN21) Notable: , >>13935173 Ty Anon Bun…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13934991

thank you e-bakers

Updated Dough

https://controlc.com/7c42062e

Who is up for collecting some notes?

We need notes from:

#17637 TBC

#17636 TBC

#17635 TBC

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65183

Originally posted at >>>/qresearch/13935119 (190310ZJUN21) Notable: #17635…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65182

I will work on #17635 and post as soon as possible.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65184

File: 0c9e7f22bc7c75d⋯.png (109.64 KB,1077x1075,1077:1075,Clipboard.png)

File: 1308785bd2e5817⋯.png (34.31 KB,681x342,227:114,Clipboard.png)

File: e597b8029bb4bcc⋯.png (72.26 KB,225x225,1:1,Clipboard.png)

File: 8cac984283660f4⋯.png (631.2 KB,1920x800,12:5,Clipboard.png)

Originally posted at >>>/qresearch/13935122 (190311ZJUN21) Notable: PB Dig: 2020 Mail-In States w/44 Million Voters - Delany / Runbeck Tie-In

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

2020 Mail-In States w/44 Million Voters - Delany / Runbeck Tie-In

1. In the 2020 election, states with mail-in voting had over 44 million registered voters.

2. Colorado SoS pushed early on for mail-in voting, deploying extensive and highly automated systems from 2013. SoS claims "one box for every 9,400 voters".

https://thefulcrum.us/colorado-vote-by-mail

3.Erin Delanymanaged Colorado's initial, essential mail-in "ballot on demand" rollout for the SoS, in 2012.

-

Tree.

Seedling.

Johnny Appleseed.

-

Plus, from 2019, Erin Delany has been the Runbeck client services manager in the Phoenix office, Maricopa County. Interesting role.

SoS.

–

"Surely this scenario didn't happen:" [image]

-CodeMonkeyZ

https://t.me/CodeMonkeyZ/425

–

Previous posts on Delany:

>>65123 (pb)

>>>/qresearch/13892395 (pb)

>>>/qresearch/13893264 (pb)

>>>/qresearch/13893305 (pb)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65185

File: 2ec8b4d284896f2⋯.jpg (78.99 KB,1280x720,16:9,Clipboard.jpg)

Originally posted at >>>/qresearch/13935123 (190311ZJUN21) Notable: Col. Constance L. Jenkins assumed leadership of the U.S. Army Medical Research Institute of Infectious Diseases during a ceremony held Friday at Fort Detrick, becoming the first female commander of the institute during its 52-year history

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

"Col. Constance L. Jenkins assumed leadership of the U.S. Army Medical Research Institute of Infectious Diseases during a ceremony held Friday at Fort Detrick, becoming the first female commander of the institute during its 52-year history. She succeeds Col. E. Darrin Cox, who has led the institute since July 2019 and will become the command surgeon for the U.S. Army Forces Command Headquarters at Fort Bragg, North Carolina.

During the colonel’s tenure, the institute contributed significantly to the national response to COVID-19, developing multiple animal models for testing vaccines, therapeutics and diagnostics; evaluating novel drugs and antibodies as potential treatments; creating a novel biosurveillance approach to enhance screening for COVID-19 and other diseases; and providing diagnostic testing for mission-critical military personnel, the release states. Early in his tenure, Cox had to deal with the shutdown of research at the facility’s top labs for about eight months by The Centers for Disease Control and Prevention. The order came after the CDC noted lapses in biosafety protocols during a site visit June 2019. The labs were restored to full operations in March 2020. There was never any evidence that any of the breaches were found outside authorized areas, according to previous reports."

https://www.fredericknewspost.com/news/politics_and_government/jenkins-becomes-first-woman-to-lead-usamriid-at-fort-detrick/article_e7143f71-f353-5aca-8d23-dae6b601cc5f.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65186

File: d2367da84ac4832⋯.jpeg (112.39 KB,1170x317,1170:317,Clipboard.jpeg)

File: aaba3785b7df01f⋯.jpeg (431 KB,1170x1210,117:121,Clipboard.jpeg)

Originally posted at >>>/qresearch/13935198 (190324ZJUN21) Notable: HOT August?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

EYES ON…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65187

File: 5cac90f7baf476c⋯.jpg (128.71 KB,1242x667,54:29,Clipboard.jpg)

File: c5697a903706786⋯.jpg (359.76 KB,2048x2048,1:1,Clipboard.jpg)

Originally posted at >>>/qresearch/13935203 (190325ZJUN21) Notable: Dunno if Anons saw these yet. RE Scavino Statuses

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dunno if Anons saw these yet.

https://twitter.com/DanScavino/status/1406079142504939520

Pic 1.

Then later.

https://twitter.com/grandoldmemes/status/1406079200109473795

Pic 2

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65188

File: a198c70e7ff4391⋯.jpg (257.94 KB,800x528,50:33,Clipboard.jpg)

Originally posted at >>>/qresearch/13935281 (190340ZJUN21) Notable: Digital warriors should rebrand all the woke airlines with a chemtrail moniker to publicly shame them

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

"United Airlines is revising its appearance standards for flight attendants and other customer-facing employees to “reflect a more modernized look,” according to the carrier. The changes, which will take effect Sept. 1, will include “significant” and gender-inclusive revisions to the company’s current policies on visible tattoos, nose rings, nails, hair and makeup, according to an announcement provided to the airline’s employees on Wednesday.

“We’ve spent the last several years listening to the feedback we’ve received from our employees and our Business Resource Groups to develop these revised standards. We’re confident that these modernized and more gender-inclusive appearance standards will provide a more authentic representation of the people and cultures that make United the company it is today,” said Kate Gebo, executive vice president of HR and labor relations at United, in a statement shared to employees.

United declined to specify what exactly the revised standards would allow, instead referring to additional details to be released in July. However, a representative for the airline confirmed that previous guidelines prohibited visible tattoos and body piercings (other than earlobe piercings). Men were also not permitted to wear makeup or colored nail polish."

https://www.mychamplainvalley.com/news/united-airlines-to-update-dress-code-for-flight-attendants-relax-rules-on-tattoos-makeup-nose-piercings/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65189

Originally posted at >>>/qresearch/13935283 (190340ZJUN21) Notable: Pence made a deal

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13934999

Say Pence doesn't certify on Jan. 6. Have to think 2020 fraud is then proven and it's obscene. A landslide was stolen. Pence a shoo-in, basically in 2024.

Unless, Pence / GOPe are afraid of a Trump family dynasty, or GOPe doesn't want Pence.

This scenario would indicate Trump would have cleaned up the election fraud in a 2nd term, using the 2020 scam as a springboard. I didn't think Trump would have gotten anything done in a 2nd term, but that is questionable now.

Say, Pence worried about a Don Jr. challenge with a grateful nation behind Trump, accepts a "promise" for a 2024 run in exchange for selling out Trump on Jan. 6. Why accept a promise from an outfit that can steal a landslide? No election going forward will ever be clean.

Only thing that makes sense is that Lin Wood's whistleblower, as outlandish as he seems, is correct; that is, Pence is a closet homosexual/pedophile who is forcec to protect his reputation.

So, Trump cleans up 2nd term, nation wants a continuance of all things Trump and goes with Don Jr,. with Ivanka in the wings as first female POTUS. Jared, staying on through Don Jr., establishes a reputation through his ME policy that further supports Ivanka.

Or:

Pence betrays Trump for a promise that he'll be bankrolled for a 2024 run that he won't win, because elections are all still rigged.

Either way, Pence never becomes POTUS. Tells me the theory that he only sold out to save his own ass has some weight.

His appearance in the batter's box may be coming shortly, if the CM Telegram follows CM's usual patter of shining the spotlight on persons to be watched closely. His downfall will be the end of the GOPe.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65190

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13935313 (190346ZJUN21) Notable: New report explains how Epstein made his friends

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13935208

New report explains how Epstein made his most powerful friends

Jun 18, 2021

Fox News

7.45M subscribers

Attorney Brittany Henderson representing 67 of Jeffrey Epstein's victims joins 'Tucker Carlson Tonight' to discuss how some of Epstein's business connections and friends can help serve justice. #FoxNews #Tucker

https://youtu.be/DgfxUBxxEDQ

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65191

Originally posted at >>>/qresearch/13935384 (190358ZJUN21) Notable: Digital warriors should rebrand all the woke airlines with a chemtrail moniker to publicly shame them

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65188

>United Airlines is revising its appearance standards…gender-inclusive revisions

They're also going to rebrand their airline name to more properly reflect their primary business model: United Chemtrail Airlines

Digital warriors should rebrand all the woke airlines with a chemtrail moniker to publicly shame them for their evil-ness

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65192

File: 2970b9b5c033221⋯.jpg (13.57 KB,255x153,5:3,Clipboard.jpg)

Originally posted at >>>/qresearch/13935415 (190404ZJUN21) Notable: Reminder: FOLLOW HUMA

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13935314

Not just china

Think BO

FOLLOW HUMA

https://www.facebook.com/harvardislamicsociety/posts/the-harvard-muslim-alumni-huma-and-harvard-islamic-society-would-like-to-announc/684177654988617/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65193

File: 59361b791ada397⋯.png (34.65 KB,887x181,887:181,Clipboard.png)

Originally posted at >>>/qresearch/13935438 (190409ZJUN21) Notable: Pennsylvania poised to begin Arizona-style election audit with subpoena power

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.washingtonexaminer.com/news/pennsylvania-arizona-style-election-audit-subpoena-power

Pennsylvania poised to begin Arizona-style election audit with subpoena power

by Daniel Chaitin, Deputy News Editor |

| June 18, 2021 09:07 PM

| Updated Jun 18, 2021, 10:11 PM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65194

File: 081caf3f0ca3fc9⋯.jpg (329.53 KB,1440x1608,60:67,Clipboard.jpg)

File: a38ccec1dfa2de2⋯.jpg (293.03 KB,2120x1294,1060:647,Clipboard.jpg)

Originally posted at >>>/qresearch/13935447 (190410ZJUN21) Notable: Did Ontario Canada get its state of emergency revoked on June 9th 2021 without telling ANYONE?!!!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Can any lawfags help me understand this.

Did Ontario Canada get its state of emergency revoked on June 9th 2021 without telling ANYONE?!!!

Is there a federal one that supercedes?

Are the vaccines even legal now?

SAUCE

https://www.canlii.org/en/on/laws/regu/o-reg-264-21/187018/o-reg-264-21.html

Or does the second pic have something to do with it.

I know we are fucked in Canada but before you remind me know that I have been here with all of you since the beginning.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65195

Originally posted at >>>/qresearch/13935457 (190413ZJUN21) Notable: #17636, #17637, #17638

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13935247

>>>/qresearch/13934991

>>65182

Baker

#17636

>>65089 Atheist activist group wants Bible removed from POW-MIA table at naval facility

>>65090, >>65101, >>65102, >>65104, >>65096 DIA discussion

>>65091 Little Eagle South Dakota Man Indicted for Aggravated Sexual Abuse of Child

>>65092 Large TB Outbreak may because by surgical Bone Repair Product-FiberCel Aziyo Biologics, Inc.

>>65093 Organ Harvesting in China

>>65094 Catholic Bishops Taking Steps to Prevent Biden From Receiving Communion

>>65095 Top Chinese official defected to the US with Wuhan lab secrets

>>65097 Former Chinese general owns 200 square miles in Texas next to Laughlin Air Force Base

>>65119 VaX Remedies Archive Offline

>>65098 Gun Owners Accuse Top NY Police Officers, NYC of Violating 2nd Amendment

>>65099, >>65100 Planefag UFO siting

>>65103 Leading Chinese nuclear scientist Zhang Zhijian dies in fall from building.

>>65105 Sidney Powell summoned to Michigan court hearing next month, facing possible sanctions

>>65106 Stacey Abrams Texting Arizonans To Pass the S.1 Legislation that Gives Democrats More Ability to Cheat

>>65107, >>65108, >>65110 Say His Name - Seth Rich

>>65109 Canada says restrictions on U.S. travel will last until late July

>>65111 Lawsuit Twitter conspired with Dems including Alex Padilla (new CA Senator appointed by Newsome)

>>65112, >>65113 President Trump Endorses Alaska Department of Administration Commissioner Kelly Tshibaka As Primary Challenger to Decepticon Senator Lisa Mukowski

>>65115 Stocks slump as S&P 500 has its worst week since February

>>65116, >>65118, >>65117 Scavino Fakebook Post with Strange Symbol

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65196

File: 373d0a2ee5dba0a⋯.png (400.75 KB,864x626,432:313,Clipboard.png)

Originally posted at >>>/qresearch/13935478 (190418ZJUN21) Notable: Trump Says Critical Race Theory In Schools Is "A Program For National Suicide"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.zerohedge.com/political/former-president-trump-offers-plan-get-divisive-radical-theories-out-our-schools

Trump Says Critical Race Theory In Schools Is "A Program For National Suicide"

Tyler Durden's Photo

by Tyler Durden

Friday, Jun 18, 2021 - 05:00 PM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65197

Originally posted at >>>/qresearch/13935509 (190424ZJUN21) Notable: #17635…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65182, >>65183, >>>/qresearch/13934991

#17635 Notables

>>65037, >>65038 Blood Before and After the mRNA COVID "Vaccine" Shot”

>>>/qresearch/13931663 (HR 3860) to prohibit any requirement for members of the Armed Forces to receive a COVID vaccination.

>>65040 New Details Emerge in Chinese Defector Story

>>>/qresearch/13931704 Off the Grid with Thomas Massie video link

>>>/qresearch/13931720 Scientist ADMITS They LIED About COVID Theories Because They HATED Trump And Didn't Want To Help Him

>>65041, >>>/qresearch/13932055 Block The Boat protest in Seattle

>>65042, >>>/qresearch/13932013 Entire Portland Riot Squad Resigns After Officer's Indictment

>>65044 Protester in MAGA Hat Spotted Next to Antifa’s John Sullivan on Jan. 5 Urged Protesters to Storm US Capitol on 6th — Is Identified — Smells Like Informant??

>>65045, >>>/qresearch/13931871 Mike Pence Drowned Out by Hecklers at Faith & Freedom Coalition Summit with Chants of “Traitor!” >>65046 Pennsylvania Election Audit a ‘Very Real Possibility

>>>/qresearch/13931846 Stop Repeating Unverified Stories - This is what the normies will see.

>>65048 The ethics of Biden hiring so many relatives of senior White House officials.

>>65050 Florida to Send Officers to Texas and Arizona to Assist with Border Crisis

>>>/qresearch/13931897 They love their chains… (Meme)

>>>/qresearch/13931919 Brian Kemp history of covering up voter fraud?

>>65051 November Memo Documented 'Massive' Election Integrity Problems in Atlanta

>>>/qresearch/13931923 Did A Spy Defector From China Prove Trump Right? - The Dan Bongino Show®

>>65055 Twitter Subpoenaed in Georgia Lawsuit Involving Fulton County Elections Supervisor Wandrea Shaye Moss

>>>/qresearch/13931945,>>>/qresearch/13932050, >>>/qresearch/13932051

White House reportedly freezes $100 bln military package to Ukraine

>>65056 Multiple Individuals Push Multiple Ballots through Multiple Tabulators Multiple Times in Georgia. This Is Illegal. Law Enforcement Does Nothing.

>>>/qresearch/13931979 Canadian call for whistleblowers to come forward regarding censorship of doctors and scientists

>>65058 Suspicious package at CIA Headquarters

>>65059 Chinese Defector's Identity Confirmed, Was Top Counterintelligence Official

>>>/qresearch/13931997 Anonymous email says BOMB planted in Moscow government building, demands end to ‘mandatory’ Covid-19 vaccinations, media reports

>>65060 Supreme Court Sides With Megacorps in Child Trafficking Case

>>65062 Senior NASA Scientist Gets Just 30 Days Prison for Lying to FBI About CCP Collaboration.

>>65064 Maricopa County Audit Report Expected in August

>>>/qresearch/13932108 Ohio’s Jane Timken Website Appears to Falsely Claim Trump Endorsement

>>65069 US Senate passes bill to give billions of dollars in funding for human-animal hybrid experiments

>>65070 Hundreds of Indonesian healthcare workers contract COVID-19 despite vaccination, dozens hospitalised

>>65076

Georgia investigator's notes reveal 'massive' election integrity problems in Atlanta

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65198

Originally posted at >>>/qresearch/13935519 (190427ZJUN21) Notable: #17636, #17637, #17638

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13934991

>>>/qresearch/13935461

NOTABLES Are NOT Endorsements

#17637 PREVIOUS BREAD

>>65120, >>65126, >>65131 PCR is completely incapable of diagnosing ANY infection.

>>65121 GA Republican David Belle Isle Formal Request for Election Records from Brad Raffensperger

>>65122 BOOM? Lindell v. Dominion/Smartmatic: Initiating Complaint Summary

>>65123 RE: Delany's Chocolaty Colorado Mail-In Misadventure

>>65124, >>65128 Sidney Powell Summoned to Michigan Court for Sanctions Hearing

>>65125 'Huge' car dealer Billy Fuccillo dies in Florida at 64

>>65127 RE: Theater - Jake Angeli, Phoenix AZ

>>65129 @BarackObama "On Monday, I’m joining @EricHolder for a grassroots conversation with @AllOnTheLine"

>>65130, >>65140 RE: DONG

>>65132 Russell Brand: "Should I Go On FOX News? (after what happened last time!)"

>>65133 Is this legit?

>>65134 Mike Obama talking funny

>>65135 JC IS C_A also in the 'club' & has been brain fucked by MK ultra

>>65136 M 3.9 Experimental Explosion - 170 km ENE of Ponce Inlet, Florida

>>65137 New Scavino FB post - an old newspaper article…

>>65138 The Gympie, Queensland, Australia pyramid.

>>65139 Kash’s Corner: How a Porous Border Facilitates Narcoterrorism

#17637

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65199

File: 32eb0a626ea19a9⋯.png (66.51 KB,1713x656,1713:656,Clipboard.png)

Originally posted at >>>/qresearch/13935580 (190445ZJUN21) Notable: IMAGINE THE COCKSUCKER THAT COMPROMISED Qs BOARD TALKING ABOUT AN ABUSE OF POWER.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Larping_Man big mad.

IMAGINE THE COCKSUCKER THAT COMPROMISED Qs BOARD TALKING ABOUT AN ABUSE OF POWER.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65200

Originally posted at >>>/qresearch/13935603 (190450ZJUN21) Notable: Ty anon suggested notabruhs

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13935547

Additional notables to fill in some gaps

>>65187 Dunno if Anons saw these yet. RE Scavino Statuses

>>65188, >>65191 Digital warriors should rebrand all the woke airlines with a chemtrail moniker to publicly shame them

>>65189 Pence made a deal

>>65192 Reminder: FOLLOW HUMA

>>65193 Pennsylvania poised to begin Arizona-style election audit with subpoena power

>>65194 Did Ontario Canada get its state of emergency revoked on June 9th 2021 without telling ANYONE?!!!

>>65199 IMAGINE THE COCKSUCKER THAT COMPROMISED Qs BOARD TALKING ABOUT AN ABUSE OF POWER.

^^KEK

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65201

File: 2bf3a2bdac62061⋯.png (61.31 KB,535x518,535:518,Clipboard.png)

Originally posted at >>>/qresearch/13935650 (190507ZJUN21) Notable: At least 7 killed, 13 injured after twin-engine plane crash-lands in southwest Siberia

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BREAKING: At least 7 killed, 13 injured after twin-engine plane crash-lands in southwest Siberia

https://twitter.com/RT_com/status/1406115087572779013

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65202

File: a12853050807454⋯.png (1.51 MB,1242x2688,207:448,Clipboard.png)

File: 90db5626663b6c7⋯.png (1.27 MB,1242x2688,207:448,Clipboard.png)

File: 6b8866c3fce0461⋯.png (807.78 KB,1242x2688,207:448,Clipboard.png)

Originally posted at >>>/qresearch/13935674 (190513ZJUN21) Notable: PF Report

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Planefags

Dasting Flight outta Shepard AFB.

Squawking 1200 shows they are flying by their seat 💺 (visual)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65203

File: 67a87d21f4330ca⋯.png (1.1 MB,1080x1192,135:149,Clipboard.png)

Originally posted at >>>/qresearch/13935712 (190522ZJUN21) Notable: #17639, #17640, #17641

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13934991 Dough

Notables Are NOT Endorsements

#17639 Twin Bakers! Edition

>>65173, >>65182, >>>/qresearch/13935173 Ty Anon Bun…

>>65174 Pennsylvania poised to begin Arizona-style election audit with subpoena power

>>65175, >>65180 Our Guys Godspeed

>>65177, >>65178 Baker Change

>>65179 Another Dough Ty anon!

>>65181, >>65183, >>65197 #17635…

>>65184 PB Dig: 2020 Mail-In States w/44 Million Voters - Delany / Runbeck Tie-In

>>65185 Col. Constance L. Jenkins assumed leadership of the U.S. Army Medical Research Institute of Infectious Diseases during a ceremony held Friday at Fort Detrick, becoming the first female commander of the institute during its 52-year history

>>65186 HOT August?

>>65187 Dunno if Anons saw these yet. RE Scavino Statuses

>>65188, >>65191 Digital warriors should rebrand all the woke airlines with a chemtrail moniker to publicly shame them

>>65189 Pence made a deal

>>65190 New report explains how Epstein made his friends

>>65192 Reminder: FOLLOW HUMA

>>65193 Pennsylvania poised to begin Arizona-style election audit with subpoena power

>>65194 Did Ontario Canada get its state of emergency revoked on June 9th 2021 without telling ANYONE?!!!

>>65195 #17636

>>65196 Trump Says Critical Race Theory In Schools Is "A Program For National Suicide"

>>65198 #17637…

>>65199 IMAGINE THE COCKSUCKER THAT COMPROMISED Qs BOARD TALKING ABOUT AN ABUSE OF POWER.

>>65200 Ty anon suggested notabruhs

>>65201 At least 7 killed, 13 injured after twin-engine plane crash-lands in southwest Siberia

>>65202 PF Report

#17639

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65204

File: a3753bd7aeb5050⋯.png (166.2 KB,460x480,23:24,Clipboard.png)

File: 151153f17c0710f⋯.png (120 KB,820x851,820:851,Clipboard.png)

Originally posted at >>>/qresearch/13935852 (190607ZJUN21) Notable: The Real Story - OAN Maricopa Audit Deadline with Christina Bobb

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

One America News Network, [18.06.21 23:28]

The Real Story - OAN Maricopa Audit Deadline with Christina Bobb

https://rumble.com/vipzaf-the-real-story-oan-maricopa-audit-deadline-with-christina-bobb.html

https://t.me/OANNTV/1804

The comments are damming and should scare the shit out of the corrupt 'officials' because people are sick of [their] bullshit.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65205

File: d1770fea8c3dcdd⋯.png (35.24 KB,424x676,106:169,Clipboard.png)

File: c6180922d6a532d⋯.png (155.15 KB,418x666,209:333,Clipboard.png)

File: 02f995a2e4640ef⋯.png (27.1 KB,474x485,474:485,Clipboard.png)

Originally posted at >>>/qresearch/13935858 (190610ZJUN21) Notable: “Supreme Court’s Failure – Completes the Implosion of Each of the Three Branches of Government” – Attorney Sidney Powell Responds to SCOTUS Decision on Election Fraud Cases

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.americanthinker.com/articles/2021/06/the_supreme_courts_day_of_reckoning_is_coming.html

The court seems to have three distinct voting blocs:

The oath keepers

– These are the justices that are willing to stand up and defend the Constitution even if it means they’ll have to endure attacks.

– Justices Thomas, Alito, and Gorsuch make up this bloc.

The jellyfish

– These are the justices that lack the spine to face controversy. They’re more concerned about defending the court than the Constitution.

– Justices Roberts, Barrett, and Kavanaugh make up this bloc.

The subversives

– These are the justices that have been using penumbras and emanations to rewrite the constitution in pursuit of social engineering.

–Justices Kagan, Sotomayor, and Breyer make up this bloc.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65206

Originally posted at >>>/qresearch/13935862 (190614ZJUN21) Notable: “Supreme Court’s Failure – Completes the Implosion of Each of the Three Branches of Government” – Attorney Sidney Powell Responds to SCOTUS Decision on Election Fraud Cases

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65205

“Supreme Court’s Failure – Completes the Implosion of Each of the Three Branches of Government” – Attorney Sidney Powell Responds to SCOTUS Decision on Election Fraud Cases

By Jim Hoft Published March 2, 2021 at 7:30am

Last Monday the United States Supreme Court refused to review the Pennsylvania 2020 Election cases.

The court made the announcement on Monday morning.

Justices Alito, Gorsuch, and Thomas dissented from the denial.

On Monday, following their inaction from last week, the US Supreme Court rejected without comment or explanation, lingering 2020 election challenges by Attorney Sidney Powell in Arizona and Wisconsin.

The Supreme Court refused to secure the integrity of the US elections.

Later on Monday night Attorney Sidney Powell released a statement on the refusal of the court to hear the election fraud cases.

Sidney Powell says the ruling completes the implosion of each of our three branches of government into the rubble of the sinkhole of corruption.

Via Attorney Sidney Powell:

My comment for the press on SCOTUS rulings today: “The Supreme Court’s failure to date to address the massive election fraud and multiple constitutional violations that wrought a coup of the presidency of the greatest country in world history completes the implosion of each of our three branches of government into the rubble of a sinkhole of corruption.

It is an absolute tragedy for the Rule of Law, the future of what was a Republic, and all freedom-loving people around the world.”

https://www.thegatewaypundit.com/2021/03/completes-implosion-three-branches-government-attorney-sidney-powell-responds-scotus-decision-election-fraud-cases/

FUCK YOU! NO DEALS! TRAITORS!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65207

Originally posted at >>>/qresearch/13935863 (190615ZJUN21) Notable: Former cabinet secretary for NM Taxation and Revenue found guilty of 2 felonies

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Former cabinet secretary for NM Taxation and Revenue found guilty of 2 felonies

ALBUQUERQUE, N.M.- Former Taxation and Revenue Department Cabinet Secretary Demesia Padilla was found guilty on two felony counts Friday.

Attorney General Hector Balderas said jurors found Padilla, who served under former Gov. Susana Martinez, guilty of stealing more than $25,000 from Harold’s Grading and Trucking while she was also acting as cabinet secretary.

“Small businesses are undoubtedly the lifeblood of New Mexico’s economy and should not be stifled by internal corruption,” said Balderas. "We are pleased to secure justice for the significant economic harm to the victims, and we will hold any person in a position of power accountable for unlawful conduct."

Balderas said Padilla will be sentenced at a later date.

https://www.kob.com/new-mexico-news/former-cabinet-secretary-for-nm-taxation-and-revenue-found-guilty-of-2-felonies/6146269/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65208

File: f2b8e65846a31e3⋯.png (44.78 KB,459x338,459:338,Clipboard.png)

Originally posted at >>>/qresearch/13935866 (190620ZJUN21) Notable: A Plan to Get Divisive & Radical Theories Out of Our Schools by Donald J. Trump

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

A Plan to Get Divisive & Radical Theories Out of Our Schools by Donald J. Trump

🙏❤️🇺🇲

https://www.realclearpolitics.com/articles/2021/06/18/a_plan_to_get_divisive__radical_theories_out_of_our_schools_145946.html

Realclearpolitics (https://www.realclearpolitics.com/articles/2021/06/18/a_plan_to_get_divisive__radical_theories_out_of_our_schools_145946.html)

A Plan to Get Divisive & Radical Theories Out of Our Schools | RealClearPolitics

As a candidate, Joe Bidens number one promise was to unite America. Yet in his first month

https://t.me/KanekoaTheGreat/508

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65209

Originally posted at >>>/qresearch/13935935 (190701ZJUN21) Notable: Muh BaseLess Conspiracy Theory News Round Up

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13935916

Hmmm that is sorta quiet.

The Virginian-Pilot

Opinion: Reports of QAnon's death aren't exaggerated

That's why QAnon, who made a messiah out of former President Donald Trump, was always bound to lose steam. It will follow the arc of furious, loopy-loo …

8 hours ago

CNA

Commentary: QAnon – how a conspiracy-consuming …

Commentary: QAnon – how a conspiracy-consuming community persists, despite its leader going MIA. From its humble beginnings in drops posted by a prophet- …

8 hours ago

The New York Times

Opinion | Will Christian America Withstand the Pull of QAnon?

He said that for many, QAnon is “taking on all the characteristics of a cult.” … the Southern Baptist Convention calling QAnon “incompatible with the Baptist Faith …

10 hours ago

News.com.au

Four Corners: ABC duped by Scott Morrison QAnon …

A Four Corners investigation has raised concerns over Scott Morrison's friendship with one particular QAnon adherent.

10 hours ago

The Australian

Four Corners and QAnon: horror real or imagined

Contrary to the impression given by the ABC's Four Corners, allegations about satanic child abuse go far beyond QAnon. By Richard Guilliatt. Despite the Wood …

16 hours ago

Newsweek

Southern Baptist Convention Leader Ed Litton Says QAnon …

When asked by Burnett whether he has encountered the QAnon movement, Litton said he has not come across it in his church nor known many pastors who have.

17 hours ago

Hill Reporter

Chicago Tribune Columnist: The Demise of QAnon is Well …

The QAnon conspiracy theory has gripped America as long as Donald Trump has been president. Adherents to the theory, like Marjorie Taylor Greene and …

17 hours ago

VICE

This QAnon Militia of Ex-Cops Is Training 'Patriots' for Revolution

Lewis is a full-fledged QAnon believer and founder of the 1st Amendment Praetorians, named after the elite Roman soldiers who protected the emperor. The group …

17 hours ago

Friendly Atheist

New Southern Baptist Leader: QAnon is Merely a “Fringe …

New Southern Baptist Leader: QAnon is Merely a “Fringe” Belief in the Church. By Hemant Mehta. June 18, 2021. In one of his …

18 hours ago

The New Daily

The Ferguson Report: Australia's QAnon give Satanism a bad …

Australia's 20,000-odd QAnon followers believe the world is run by Satanists who are left-wing but organised. Australian Satanists are Aussie mums and dads who …

18 hours ago

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65210

File: 0dd2a20c460640f⋯.png (539.15 KB,680x454,340:227,Clipboard.png)

File: c81493c5be463d4⋯.png (434.48 KB,635x845,127:169,Clipboard.png)

Originally posted at >>>/qresearch/13936111 (190812ZJUN21) Notable: ARMY Tweets: The work of the #USArmy is a complex combination of missions, tasks and responsibilities — all in constant motion. Every #Soldier knows that their duty is to accomplish their tasks as part of a larger #ArmyTeam!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

U.S. Army

@USArmy

·

7h

The work of the #USArmy is a complex combination of missions, tasks and responsibilities — all in constant motion.

Every #Soldier knows that their duty is to accomplish their tasks as part of a larger #ArmyTeam!

Photo by Capt. Chelsea Hall,

@4thInfDiv

https://twitter.com/USArmy/status/1406056112609271809

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65211

File: a0c134ad12c4e50⋯.png (610.77 KB,1917x1017,213:113,Clipboard.png)

Originally posted at >>>/qresearch/13936209 (190844ZJUN21) Notable: PF Reports

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Three military birds on radar over the U.S at the minute

C130 no call sign at 11,100 blinked off the air with in seconds of the screen grab.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65212

File: f7308c071a35a46⋯.png (83.36 KB,897x736,39:32,Clipboard.png)

File: 466a1f968ea50a5⋯.png (68.24 KB,897x736,39:32,Clipboard.png)

Originally posted at >>>/qresearch/13936226 (190848ZJUN21) Notable: Weatherfag Two Hurricanes near Americas' Coasts

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

How lovely to end Gemini season with

TWIN HURRICANES

on Fathers Day AND

the Spoopy SOLSTICE!!

No coincidences

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65213

File: 628d42717961e2c⋯.jpg (433.08 KB,1080x1396,270:349,Clipboard.jpg)

Originally posted at >>>/qresearch/13936241 (190852ZJUN21) Notable: Someone speculates DJT's Social Media Man, Dan The Man. Didn't POTUS say he handles all that?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

So if dan was in control of trumps twitter. All those zero deltas are shit and dont mean fuck all Q….

https://mobile.twitter.com/wakethesheepnow/status/1406127405840928770

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65214

File: d1871b3a69ced1a⋯.png (898.33 KB,1330x653,1330:653,Clipboard.png)

File: 8d3f61a7db8e09a⋯.png (158.42 KB,601x368,601:368,Clipboard.png)

Originally posted at >>>/qresearch/13936258 (190857ZJUN21) Notable: COMRAD LOGIN: Volunteer kgnnd!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13936235

>>>/qresearch/13936213

Sooooo…

Has anybody tried this?

Volunteer

kgnnd!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65215

Originally posted at >>>/qresearch/13936273 (190904ZJUN21) Notable: Win11 Debut?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Windows 11

06.24.21

11 a.m. Eastern Time

https://www.microsoft.com/en-us/windows/event

https://www.windowscentral.com/windows-11

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65216

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13936463 (191007ZJUN21) Notable: Gen. Mike Flynn | Phyllis Schlafly Collegians 2021

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Gen. Mike Flynn | Phyllis Schlafly Collegians 2021

817 views•Jun 18, 2021

111

0

SHARE

SAVE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65217

File: 74804169753c8f1⋯.png (381.63 KB,827x464,827:464,Clipboard.png)

Originally posted at >>>/qresearch/13936496 (191020ZJUN21) Notable: >>13935712 #17639, #17640, #17641

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Notables Are NOT Endorsements

#17640

>>65204 The Real Story - OAN Maricopa Audit Deadline with Christina Bobb

>>65205, >>65206 “Supreme Court’s Failure – Completes the Implosion of Each of the Three Branches of Government” – Attorney Sidney Powell Responds to SCOTUS Decision on Election Fraud Cases

>>65207 Former cabinet secretary for NM Taxation and Revenue found guilty of 2 felonies

>>65208 A Plan to Get Divisive & Radical Theories Out of Our Schools by Donald J. Trump

>>65209 Muh BaseLess Conspiracy Theory News Round Up

>>65210 ARMY Tweets: The work of the #USArmy is a complex combination of missions, tasks and responsibilities — all in constant motion. Every #Soldier knows that their duty is to accomplish their tasks as part of a larger #ArmyTeam!

>>65211 PF Reports

>>65212 Weatherfag Two Hurricanes near Americas' Coasts

>>65213 Someone speculates DJT's Social Media Man, Dan The Man. Didn't POTUS say he handles all that?

>>65214 COMRAD LOGIN: Volunteer kgnnd!

>>65215 Win11 Debut?

>>65216 Gen. Mike Flynn | Phyllis Schlafly Collegians 2021

#17640

Be Ready, Be Safe.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65218

Originally posted at >>>/qresearch/13936623 (191105ZJUN21) Notable: Dong Jingwei (董经纬) Newsbun

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dong Jingwei (董经纬), top level MSS counterintel agent defected in mid-February, flying from Hong Kong to the United States with his daughter, Dong Yang. Defects to US DIA (Defense Intelligence Agency) in February.

In addition, Dong has provided DIA with the following information:

>Early pathogenic studies of the virus we now know as SARS-CoV-2

>Models of predicted COVID-19 spread and damage to the US and the world

>Financial records detailing which exact organizations and governments funded the research on SARS-CoV-2 and other biological warfare research

>Names of US citizens who provide intel to China

>Names of Chinese spies working in the US or attending US universities

>Financial records showing US businessmen and public officials who’ve received money from the Chinese government

>Details of meetings US government officials had (perhaps unwittingly) with Chinese spies and members of Russia’s SVR

>How the Chinese government gained access to a CIA communications system, leading to the death of dozens of Chinese people who were working with the CIA

https://www.zerohedge.com/political/chinese-defectors-identity-confirmed-was-top-counterintelligence-official-redstate

https://www.spytalk.co/p/high-level-chinese-defection-rumored

https://www.scmp.com/news/china/politics/article/3137958/top-chinese-spy-catcher-dong-jingwei-warns-agents-look-out

https://www.independent.ie/world-news/north-america/chinas-leading-spy-catcher-defected-to-us-reports-claim-40556455.html

https://www.telegraph.co.uk/news/2021/06/18/rumours-swirl-chinas-top-spycatcher-has-defected-us/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65219

Originally posted at >>>/qresearch/13936646 (191112ZJUN21) Notable: Vatican priest-turned-whistleblower pens world’s only Latin news column

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Vatican priest-turned-whistleblower pens world’s only Latin news column

Lucas noah 7 hours ago

He entered the Vatican at age 27 and found himself surrounded by eccentric co-workers. Another Latinist had dated Italian poet and filmmaker Pier Paolo Pasolini in his youth before becoming a priest and had a habit of screaming profanities. Lepore was in heaven, and every day at 11am, he would take tea and chat in Latin with his co-workers.

But the extracurricular activities proved distracting. “Inside the Vatican,” he said, “it got worse.”

He pursued relationships with priests and bishops, some of whom addressed one another with female terms of endearment such as “bella,” he said. Others nicknamed one cardinal Platinette, after a famous Italian drag queen. Lepore became known, he said, as “the star of Hollywood” because he wore a Borsalino hat, cuff links and a pocket watch.

He blames a jealous-whisper campaign for forcing him out of the Latin section. But he landed a spot in the Vatican Library, where he became secretary to powerful French Cardinal Jean-Louis Tauran.

But the excesses of Rome eroded his faith. He stopped celebrating masses, continued dating and started feeling “like a hypocrite”. In a case of self-sabotage, he visited gay pride sites and watched pornography on his office computer. Soon enough, authorities told him he would have to return to Benevento.

“My son, you were too naive,” he recalled the late Tauran telling him.

He announced he would leave the priesthood altogether, and then spent four years, as he put it, in the wilderness. He had a “double coming out” to his parents, about leaving the priesthood and being gay, and they didn’t talk to him for years. He bumped into priests he knew at cruising spots and various bathhouses, including one in a building owned by the Vatican. He said he went to drug-fueled parties at the Abbey of Montecassino, which traces its roots back to St Benedict. He earned some money with private lessons in Latin and religion and some initial reporting jobs, but he felt lost.

In 2013, a cardinal delivered a letter from Lepore explaining his situation to the newly elected Pope Francis. In October, Lepore’s phone rang, with Francis telling him he admired him for his “consistency” and “courage” in not living a double life and that he wanted to help him with his economic travails, according to Lepore.

(A Vatican spokesperson did not return a call for comment.)

But except for an envelope with € 2,000 euros, about $3,170, from a cardinal, no job ever materialised.

Free from the church, Lepore threw himself into activism for gay rights. In February 2019, he became the star witness of Frederic Martel’s buzzy book In the Closet of the Vatican,

where Lepore’s estimate that 80 per cent of the Vatican staff are gay made a splash.

Later that year, Ivan Scalfarotto, a politician who is now an undersecretary in Italy’s Interior Ministry, told the new editor of Linkiesta about a guy who knew everything about the Vatican. The editor, Christian Rocca, was intrigued.

Last year, Rocca floated the idea of a daily column in Latin, which he admitted was not great for search engine optimisation but seemed like it might be fun.

“It seems like madness,” Lepore responded.

And then he immediately got to it.

https://timesnewsexpress.com/news/world/australia/vatican-priest-turned-whistleblower-pens-worlds-only-latin-news-column/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65220

Originally posted at >>>/qresearch/13936649 (191114ZJUN21) Notable: Donald Trump says more American Jews should have voted for him

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Donald Trump says more American Jews should have voted for him

Exit polls election night found Trump scored between 21% and 30.5% of the Jewish vote. He is also correct that an overwhelming majority of Orthodox Jews voted for him.

By RON KAMPEAS/JTA JUNE 19, 2021 03:59

(JTA) — Donald Trump is still trying to figure out why more American Jews didn’t vote for him, arguing in a haredi Orthodox magazine interview this week that they “don’t love Israel enough” and the Israel-related moves he made as president should have earned him a larger share of the Jewish vote.

“You know what really surprised me?” Trump told Ami Magazine. “I did the Heights, I did Jerusalem, and I did Iran — the Iran Deal was a disaster, right? And I also did many other things. Jewish people who live in the United States don’t love Israel enough. Does that make sense to you? I’m not talking about Orthodox Jews. I believe we got 25% of the Jewish vote, and it doesn’t make sense. It just seems strange to me.”

Trump referred to his decisions to recognize Israel’s sovereignty over the Golan Heights, to recognize Jerusalem as Israel’s capital and move the American embassy from Tel Aviv to Jerusalem, and to pull out of the Iran nuclear deal, which Israel’s government loathes.

Exit polls election night found Trump scored between 21% and 30.5% of the Jewish vote. He is also correct that an overwhelming majority of Orthodox Jews voted for him.

Jewish groups slammed Trump in 2019 after he said that Jews were disloyal for voting for Democrats and doubling down on the claim.

https://www.jpost.com/american-politics/donald-trump-says-more-american-jews-should-have-voted-for-him-671444

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65221

File: ce5cff48f0b9406⋯.png (558.69 KB,860x706,430:353,Clipboard.png)

Originally posted at >>>/qresearch/13936661 (191117ZJUN21) Notable: GREEN BERET JEREMY BROWN Calls On Those US Patriots Who Were Asked to Spy on Oath Keepers by the FBI

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/green-beret-jeremy-brown-calls-us-patriots-asked-spy-oath-keepers-fbi-deep-state-step-forward-speak/

GREEN BERET JEREMY BROWN Calls On Those US Patriots Who Were Asked to Spy on Oath Keepers by the FBI and Deep State to Step Forward and Speak Out

By Jim Hoft

Published June 19, 2021 at 5:35am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65222

File: 98b9ab37aafba6e⋯.png (366.71 KB,776x579,776:579,Clipboard.png)

Originally posted at >>>/qresearch/13936665 (191119ZJUN21) Notable: CDC to Postpone Emergency Meeting on Serious COVID-19 Vaccine Side Effects for Juneteenth

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://pjmedia.com/uncategorized/stacey-lennox/2021/06/18/new-juneteenth-holiday-prompts-delay-of-cdc-emergency-covid-19-meeting-n1455134

CDC to Postpone Emergency Meeting on Serious COVID-19 Vaccine Side Effects for Juneteenth Holiday

By Stacey Lennox Jun 18, 2021 9:01 PM ET

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65223

File: a17c7d7b274c237⋯.png (118.12 KB,370x689,370:689,Clipboard.png)

File: ddebc9827a0a5c5⋯.png (226.36 KB,476x680,7:10,Clipboard.png)

Originally posted at >>>/qresearch/13936682 (191126ZJUN21) Notable: ICYMI: Potus45 statement from yesterday

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

ICYMI: Potus45 statement from yesterday

"So let them go on and on with their Fake Campaign and Fake Election results…."

https://twitter.com/RSBNetwork/status/1406048557778546690

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65224

File: 0f4285df9ec02ac⋯.png (252.1 KB,816x1224,2:3,Clipboard.png)

Originally posted at >>>/qresearch/13936715 (191138ZJUN21) Notable: Cestui Que Vie Act 1666 bun

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13936695

>>>/qresearch/13936696

>>>/qresearch/13936697

>>>/qresearch/13936701

>>>/qresearch/13936704

>>>/qresearch/13936706

>>>/qresearch/13936713

Cestui Que Vie Act 1666

https://www.legislation.gov.uk/aep/Cha2/18-19/11

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65225

Originally posted at >>>/qresearch/13936721 (191141ZJUN21) Notable: A Baker checked in

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Notables Are Not Endorsements

#17641

>>65218 Dong Jingwei - top level MSS counterintel agent defected in mid-February

>>65219 Vatican priest-turned-whistleblower pens world’s only Latin news column

>>65221 GREEN BERET JEREMY BROWN Calls On Those US Patriots Who Were Asked to Spy on Oath Keepers by the FBI and Deep State to Step Forward and Speak Out

>>65222 CDC to Postpone Emergency Meeting on Serious COVID-19 Vaccine Side Effects for Juneteenth Holiday

>>65223 ICYMI: Potus45 statement from yesterday

>>65224 Cestui Que Vie Act 1666 bun

Posting early bread notables

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65226

Originally posted at >>>/qresearch/13936759 (191156ZJUN21) Notable: A Baker checked in

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Notables Are Not Endorsements

#17641

>>65218 Dong Jingwei - top level MSS counterintel agent defected in mid-February

>>65219 Vatican priest-turned-whistleblower pens world’s only Latin news column

>>65221 GREEN BERET JEREMY BROWN Calls On Those US Patriots Who Were Asked to Spy on Oath Keepers by the FBI and Deep State to Step Forward and Speak Out

>>65222 CDC to Postpone Emergency Meeting on Serious COVID-19 Vaccine Side Effects for Juneteenth Holiday

>>65223 ICYMI: Potus45 statement from yesterday

>>65224 Cestui Que Vie Act 1666 bun

Sorry have to go, this bake is GHOSTED

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65227

File: 3d4ae09e6114aad⋯.png (83.91 KB,660x2608,165:652,Clipboard.png)

Originally posted at >>>/qresearch/13936760 (191157ZJUN21) Notable: Muh DC Panic! Closures

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://t.me/s/Fall_of_the_Cabal

Reports are coming in claiming that many public buildings in Washington, DC are, today, CLOSED TO THE PUBLIC.

I was informed a few minutes ago that all buildings closed to the public and all tours suspended until further notice in DC.

National Zoo closed

Holocaust Museum closed

National Archives closed

JFK Center of Performing Arts closed

National Cherry Blossom Festival canceled

Arlington National Cemetery Closed to the public

Museum of the Bible closed

National Capital and House and Senate Buildings closed to public and all tours suspended

Library of Congress closed to public

FBI Building closed to public

Pentagon closed to public

There are more but these reports are not yet verified. Attempting to determine the reason.

Check back

UPDATE 1:43 PM EDT –

Closures now CONFIRMED by a sitting member of the US Congress:

United States Capitol and House and Senate Office Buildings: All Buildings CLOSED to public and tours SUSPENDED until further notice

Library of Congress: All buildings CLOSED to public and tours SUSPENDED until further notice

White House (Call 202-456-7041 for updates)

FBI Building: Building CLOSED to public and all tours SUSPENDED until further notice

Bureau of Engraving and Printing: Building CLOSED to public and all tours SUSPENDED until further notice

Department of State: Building CLOSED to public and all tours SUSPENDED until further notice

Pentagon: Building CLOSED to public and all tours SUSPENDED until further notice

Smithsonian Musuems (list here): All buildings CLOSED to public and all tours SUSPENDED until further notice

National Zoo: CLOSED until further notice

Holocaust Museum: Building CLOSED to public and all tours SUSPENDED until further notice

National Archives: Building CLOSED to public and all tours SUSPENDED until further notice

John F. Kennedy Center for Performing Arts (season info): Building CLOSED to public and all performances SUSPENDED until further notice

National Cherry Blossem Festival: All events CANCELLED

Arlington National Cemetary: CLOSED to public; OPEN to families for visitation; scheduled funerals will CONTINUE as planned

Museum of the Bible: CLOSED (through January 28)

International Spy Museum: OPEN

National Arboretum: Grounds only OPEN (The National Bonsai & Penjing Museum and Administration Building are still CLOSED to the public)

@NicholasVeniamin

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65228

File: b6dda1ab8a5d34e⋯.png (560.29 KB,845x707,845:707,Clipboard.png)

Originally posted at >>>/qresearch/13937016 (191248ZJUN21) Notable: Maricopa Audit Liaison Says They Need to Investigate Anomalies — Like 52 Ballots Submitted From a Two-Bedroom Homes

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/watch-maricopa-audit-liaison-says-need-investigate-anomalies-like-52-ballots-submitted-two-bedroom-home/

Maricopa Audit Liaison Says They Need to Investigate Anomalies — Like 52 Ballots Submitted From a Two-Bedroom Home

By Cassandra Fairbanks

Published June 19, 2021 at 7:45am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65229

File: a85cac52448aac2⋯.png (40.78 KB,854x234,427:117,Clipboard.png)

Originally posted at >>>/qresearch/13937027 (191250ZJUN21) Notable: PANIC IN THE PEACH STATE: Fulton County Georgia Defense Attorneys File Motion to Prevent Scheduled Testimony of Dirtbag Richard Barron on Monday

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/panic-peach-state-fulton-county-georgia-defense-attorneys-file-motion-prevent-scheduled-testimony-dirtbag-richard-barron-monday/

PANIC IN THE PEACH STATE: Fulton County Georgia Defense Attorneys File Motion to Prevent Scheduled Testimony of Dirtbag Richard Barron on Monday

By Jim Hoft

Published June 19, 2021 at 7:30am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65230

File: 3a59bd82e2a7a1e⋯.jpeg (84.06 KB,691x624,691:624,Clipboard.jpeg)

Originally posted at >>>/qresearch/13937205 (191317ZJUN21) Notable: Statement attributable to UNFPA Office in Myanmar with the Embassies of Canada, Denmark, Norway, and Sweden

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/norwayinmyanmar/status/1406094238039691265/photo/1

Statement attributable to UNFPA Office in Myanmar with the Embassies of Canada, Denmark, Norway, and Sweden

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65231

File: af5647895a7ebf6⋯.png (82.46 KB,605x336,605:336,Clipboard.png)

Originally posted at >>>/qresearch/13937209 (191318ZJUN21) Notable: Louie Gohmert Suggests Federal Agents Were Behind Capitol Attack

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/AKA_RealDirty/status/1406238274792927239

Louie Gohmert Suggests Federal Agents Were Behind Capitol Attack https://youtu.be/nCHL2GEO9hw via

@YouTube

https://www.youtube.com/watch?v=nCHL2GEO9hw

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65232

File: e06c4a9b6b4c8a9⋯.mp4 (2.49 MB,624x360,26:15,Clipboard.mp4)

Originally posted at >>>/qresearch/13937219 (191319ZJUN21) Notable: Trump Rayciss? Get Real.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937194

tank you swordy.

"Is Trump Racist?"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65233

Originally posted at >>>/qresearch/13937223 (191320ZJUN21) Notable: PB Notable… A Plan to Get Divisive & Radical Theories Out of Our Schools by Donald J. Trump

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65208 A Plan to Get Divisive & Radical Theories Out of Our Schools by Donald J. Trump

complete article, anons pass on to parents everywhere

1 of 2

As a candidate, Joe Biden’s number one promise was to “unite” America. Yet in his first months as president, his number one priority has been to divide our country by race and gender at every turn.

There is no clearer example than the Biden administration’s new effort aimed at indoctrinating America’s schoolchildren with some of the most toxic and anti-American theories ever conceived. It is vital for Americans to understand what this initiative would do, what drives it and, most importantly, how we can stop it.

For decades, the America-blaming left has been relentlessly pushing a vision of America that casts our history, culture, traditions, and founding documents in the most negative possible light. Yet in recent years, this deeply unnatural effort has progressed from telling children that their history is evil to telling Americans that they are evil.

In classrooms across the nation, students are being subjected to a new curriculum designed to brainwash them with the ridiculous left-wing dogma known as “critical race theory.” The key fact about this twisted doctrine is that it is completely antithetical to everything that normal Americans of any color would wish to teach their children.

Instead of helping young people discover that America is the greatest, most tolerant, and most generous nation in history, it teaches them that America is systemically evil and that the hearts of our people are full of hatred and malice. Far from advancing the beautiful dream of the Rev. Martin Luther King Jr. that our children should “not be judged by the color of their skin, but by the content of their character” the left’s vile new theory preaches that judging people by the color of their skin is actually a good idea.

Teaching even one child these divisive messages would verge on psychological abuse. Indoctrinating generations of children with these extreme ideas is not just immoral it is a program for national suicide==. Yet that is exactly what the Biden administration endorsed recently in a rule published in the Federal Register aimed at inflicting a critical race theory-inspired curriculum on American schoolchildren.

The rule explicitly cites the New York Times’ discredited “1619 Project” as a motivation. The Times has described the goal of its endeavor as the “re-education” of the American people, and the project even includes a lesson plan that encourages students to practice “erasing” parts of the Declaration of Independence. The Biden rule also directly cites a left-wing activist and leading proponent of critical race theory whose textbook states, “The only remedy to past discrimination is present discrimination. The only remedy to present discrimination is future discrimination.”

This is what the Biden administration wants to teach America’s children. The Department of Education rule stems from an executive order Biden signed on his first day in office. Biden’s order abolished the President’s Advisory 1776 Commission I created to honor America’s founding principles, and reversed an executive action I took to stop these depraved theories from being imposed upon federal employees in workforce training sessions.

Thankfully, most Americans oppose this insanity. The left has only gotten away with it until this point because not enough parents have been paying attention and speaking up. But that is quickly changing. From Loudoun County, Va., to Cupertino, Calif., parents are beginning to make their voices heard against the left-wing cultural revolution. What they need now is a plan to actually stop it.

Here are the reforms that every concerned parent in America should be demanding.

First, every state legislature should pass a ban on taxpayer dollars going to any school district or workplace that teaches critical race theory, which inherently violates existing anti-discrimination laws. Inspired by my executive order last year, Florida, Texas, North Carolina, Oklahoma and other states have already taken steps to pass such laws. It needs to happen everywhere — and Congress should seek to institute a federal ban through legislation as well.

Second, each state should create its own 1776 Commission to examine the public school curriculum and ensure that students are receiving a patriotic, pro-American education — not being taught that the United States is an evil nation.

Donald Trump (was)ISthe 45th president of the United States.

https://www.realclearpolitics.com/articles/2021/06/18/a_plan_to_get_divisive__radical_theories_out_of_our_schools_145946.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65234

Originally posted at >>>/qresearch/13937251 (191323ZJUN21) Notable: PB Notable… A Plan to Get Divisive & Radical Theories Out of Our Schools by Donald J. Trump

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65233

A Plan to Get Divisive & Radical Theories Out of Our Schools

2 of 2

Third, parents have a right to know exactly what is being taught to their children. Last year, many parents had the chance to routinely listen in on classes for the first time because of remote learning. As students return to the classroom, states need to pass laws requiring that all lesson plans have to be made available to parents — every handout, article, and reading should be posted on an online portal that allows parents to see what their kids are being taught. Furthermore, in many places, there are rules preventing students from recording what teachers say in class. States and school boards should establish a “Right to Record.”

Fourth, parents need to organize locally — in every school district in America — to eliminate “Action Civics” and other versions of the effort to contort traditional civics education into a vehicle for political indoctrination. The left’s new argument is that our “divisions” stem from a lack of “civics education” — a problem they intend to “fix” with lots of new taxpayer money and a redefinition of “civics” in schools, just as they are trying to redefine the meaning of “infrastructure.” Right now, Congress is working on a $1 billion bill known as the Civics Secures Democracy Act. No Republican should trust the Biden administration with a billion dollars to spend on such programs. Even worse, the legislation threatens to establish a de facto national curriculum for history and civics, effectively bribing states into adopting the left’s anti-American curriculum. It is Common Core all over again – but much more extreme. And like Common Core, parents must unite to stop this new federal power grab.

Fifth, any parent who objects to the material being taught to their child in public school should get an automatic voucher, empowering them to pick another school of their choice. The government has no right to brainwash students with controversial ideologies against their parents’ will.

Sixth, states need to take back control of their schools of education and credentialing bodies to ensure they are not churning out radicalized teachers. To be clear, the overwhelming majority of our nation’s teachers are some of the most selfless and wonderful people there are — but regrettably, many have graduated from extremely biased education schools and may not even be aware of the degree to which leftist ideology has permeated their curriculum. States should set up alternative credentialing bodies that can certify great teachers who know how to instill a sense of love for America. School districts can then make it a priority to hire teachers with these certifications, especially for English, history, and social studies roles. States could even set up their own versions of Teach for America to get passionate and patriotic young people into the classroom.

Finally, states need to break the tenure monopoly in public K-12 schools. Tenure was originally supposed to protect competent teachers from being subjected to undue political influence; it has turned into a mechanism to protect incompetent teachers who themselves wield undue political influence over our children. Educators who are alienating children from their own country should not be protected with lifelong tenure; they should be liberated to pursue a career as a political activist.

Make no mistake: The motive behind all of this left-wing lunacy is to discredit and eliminate the greatest obstacles to the fundamental transformation of America. To succeed with their extreme agenda, radicals know they must abolish our attachment to the Constitution, the Declaration of Independence, and most of all, Americans’ very identity as a free, proud, and self-governing people. The left knows that if they can dissolve our national memory and identity, they can gain the total political control they crave.

A nation is only as strong as its spirit. For our children, we must act before it is too late.

Donald Trump (was)ISthe 45th president of the United States.

https://www.realclearpolitics.com/articles/2021/06/18/a_plan_to_get_divisive__radical_theories_out_of_our_schools_145946.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65235

File: 2fbd6e4f3904ead⋯.png (192.43 KB,610x614,305:307,Clipboard.png)

Originally posted at >>>/qresearch/13937284 (191329ZJUN21) Notable: "This is amazing. Last night I did a Fox segment on how the FBI and CIA have more power over the US corporate media than ever. It used to be clandestine but now they put their operatives right in the newsrooms. It's Operation Mockingbird, but not hidden:"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/ggreenwald/status/1406240650186604549

This is amazing. Last night I did a Fox segment on how the FBI and CIA have more power over the US corporate media than ever. It used to be clandestine but now they put their operatives right in the newsrooms. It's Operation Mockingbird, but not hidden:

Quote Tweet

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65236

File: c9eb232b444a902⋯.jpeg (253.01 KB,718x620,359:310,Clipboard.jpeg)

Originally posted at >>>/qresearch/13937345 (191338ZJUN21) Notable: Candace Owens: "Weird how quickly the mainstream media was able to pull together a daily death counter for Covid-19, but they just can’t seem to compile the data as efficiently for vaccine deaths and reactions. "

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Weird how quickly the mainstream media was able to pull together a daily death counter for Covid-19, but they just can’t seem to compile the data as efficiently for vaccine deaths and reactions.

Almost like they had an agenda to terrify people into compliance.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65237

File: 6141cf07a108c45⋯.png (1.26 MB,1777x817,1777:817,Clipboard.png)

File: 0be3e73de54313e⋯.png (531.1 KB,1777x880,1777:880,Clipboard.png)

Originally posted at >>>/qresearch/13937394 (191348ZJUN21) Notable: PF Reports

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65238

File: 36911a9cd4530ec⋯.png (146.6 KB,460x566,230:283,Clipboard.png)

Originally posted at >>>/qresearch/13937409 (191350ZJUN21) Notable: Biden: "Juneteenth marks both the long, hard night of slavery and subjugation – and the promise of that brighter morning to come. It’s a day of profound weight and power. Today and every day, we must work to ensure our nation finally lives up to its promise of equality for all." + QComms?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

President Biden

@POTUS

United States government official

Juneteenth marks both the long, hard night of slavery and subjugation – and the promise of that brighter morning to come. It’s a day of profound weight and power. Today and every day, we must work to ensure our nation finally lives up to its promise of equality for all.

8:59 AM · Jun 19, 2021·The White House

https://twitter.com/POTUS/status/1406235068893437953

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65239

File: 11275b78ffb45b2⋯.png (112.49 KB,748x700,187:175,Clipboard.png)

File: 7ce405aef420d73⋯.mp4 (977.26 KB,480x270,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13937447 (191356ZJUN21) Notable: Dan The LASER Eyes Man Tweets: FF-22 Raptor

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NEW DAN

https://twitter.com/DanScavino/status/1406249036139618310

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65240

File: 3f64bd18927150b⋯.png (110.62 KB,1572x515,1572:515,Clipboard.png)

File: 15d339ea7b6df52⋯.png (102.37 KB,1180x661,1180:661,Clipboard.png)

File: b55df13cbe58cad⋯.png (305.57 KB,411x688,411:688,Clipboard.png)

File: d261df01712b9c6⋯.png (415.9 KB,411x730,411:730,Clipboard.png)

File: 7043928a6d653eb⋯.png (316.38 KB,397x675,397:675,Clipboard.png)

Originally posted at >>>/qresearch/13937503 (191406ZJUN21) Notable: Biden: "Juneteenth marks both the long, hard night of slavery and subjugation – and the promise of that brighter morning to come. It’s a day of profound weight and power. Today and every day, we must work to ensure our nation finally lives up to its promise of equality for all." + QComms?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

From Qagg Juneteenth 2020

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65241

File: 5ebef6804fe877b⋯.png (97.09 KB,1131x502,1131:502,Clipboard.png)

File: 359154e650e5536⋯.png (22.05 KB,716x181,716:181,Clipboard.png)

Originally posted at >>>/qresearch/13937518 (191408ZJUN21) Notable: FIRST ON 3: Late-night flights carrying migrant children arrive in Chattanooga

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.wrcbtv.com/story/43920052/first-on-3-latenight-flights-carrying-migrant-children-arriving-in-chattanooga

News

FIRST ON 3: Late-night flights carrying migrant children arrive in Chattanooga

Chattanooga’s Wilson Air Center is receiving planes carrying migrant children who are being bused to multiple southeastern cities during overnight hours.

Wednesday, May 19th 2021, 2:31 PM EDT

Updated: Thursday, May 20th 2021, 5:14 AM EDT

By Callie Starnes

By Mary Francis Hoots

https://www.lucianne.com/2021/06/19/border_officials_have_found_more_than_200_dead_migrants_since_october_and_rescued_thousands_62720.html

Border Officials Have Found More Than 200 Dead Migrants Since October and Rescued Thousands

The Epoch Times, by The Daily Caller News

Original Article

Posted By: Stemocrats Dink, 6/19/2021 9:20:53 AM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65242

File: 1ffde007d636228⋯.png (92.65 KB,611x391,611:391,Clipboard.png)

Originally posted at >>>/qresearch/13937577 (191415ZJUN21) Notable: Dan The LASER Eyes Man Tweets: FF-22 Raptor

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937552

FF

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65243

Originally posted at >>>/qresearch/13937594 (191416ZJUN21) Notable: #17641

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Notables Are NOT Endorsements

#17641

>>65218 Dong Jingwei (董经纬) Newsbun

>>65219 Vatican priest-turned-whistleblower pens world’s only Latin news column

>>65220 Donald Trump says more American Jews should have voted for him

>>65221 GREEN BERET JEREMY BROWN Calls On Those US Patriots Who Were Asked to Spy on Oath Keepers by the FBI

>>65222 CDC to Postpone Emergency Meeting on Serious COVID-19 Vaccine Side Effects for Juneteenth

>>65223 ICYMI: Potus45 statement from yesterday

>>65224 Cestui Que Vie Act 1666 bun

>>65225, >>65226 A Baker checked in

>>65227 Muh DC Panic! Closures

>>65228 Maricopa Audit Liaison Says They Need to Investigate Anomalies — Like 52 Ballots Submitted From a Two-Bedroom Homes

>>65229 PANIC IN THE PEACH STATE: Fulton County Georgia Defense Attorneys File Motion to Prevent Scheduled Testimony of Dirtbag Richard Barron on Monday

>>65230 Statement attributable to UNFPA Office in Myanmar with the Embassies of Canada, Denmark, Norway, and Sweden

>>65231 Louie Gohmert Suggests Federal Agents Were Behind Capitol Attack

>>65232 Trump Rayciss? Get Real.

>>65233, >>65234 PB Notable… A Plan to Get Divisive & Radical Theories Out of Our Schools by Donald J. Trump

>>65235 "This is amazing. Last night I did a Fox segment on how the FBI and CIA have more power over the US corporate media than ever. It used to be clandestine but now they put their operatives right in the newsrooms. It's Operation Mockingbird, but not hidden:"

>>65236 Candace Owens: "Weird how quickly the mainstream media was able to pull together a daily death counter for Covid-19, but they just can’t seem to compile the data as efficiently for vaccine deaths and reactions. "

>>65237 PF Reports

>>65238, >>65240 Biden: "Juneteenth marks both the long, hard night of slavery and subjugation – and the promise of that brighter morning to come. It’s a day of profound weight and power. Today and every day, we must work to ensure our nation finally lives up to its promise of equality for all." + QComms?

>>65239, >>65242 Dan The LASER Eyes Man Tweets: FF-22 Raptor

>>65241 FIRST ON 3: Late-night flights carrying migrant children arrive in Chattanooga

#17641

>>>>/qresearch/13937477

>If you want them you're going to have to do it yourself.

>Based Bakers are on vacay until The Limbo turns into The Precipice.

I been on vacation for

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65244

Originally posted at >>>/qresearch/13937681 (191428ZJUN21) Notable: After riding up an escalator, attendees at the Faith & Freedom Coalition’s annual Road to Majority conference met with a registration sign slapped with two additional labels: “Trump: Take America Back, 2024” and “Trump Store, Vendor Exhibits”…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.theguardian.com/us-news/2021/jun/19/trump-christian-right-conference-faith-and-freedom

After riding up an escalator, attendees at the Faith & Freedom Coalition’s annual Road to Majority conference met with a registration sign slapped with two additional labels: “Trump: Take America Back, 2024” and “Trump Store, Vendor Exhibits”.

Beside it was a T-shirt that said: “Jesus is my savior. Trump is my president.”

This, along with a plethora of “Make America great again” (Maga) hats, made clear that the Christian right’s unlikely faith in Trump has not been shaken. For many he is a martyr who may yet rise again.

The vendor display turned out to be quite modest at what, despite liberation from face masks and physical distancing, was a relatively low energy event. Interviews with a dozen attendees found a widespread conviction that the 2020 election was stolen, support for tougher voting restrictions and a reluctance to condemn Trump supporters who stormed the US Capitol on 6 January.

Trump, who turned 75 this week and resumes campaign rallies next Saturday in Ohio, has hinted that he might run for president again in 2024. Many who attended the Road to Majority conference pledged to support him if he does, although few wanted Pence to be his running mate again.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65245

File: a9ba28e941269d8⋯.png (10.85 KB,1263x179,1263:179,Clipboard.png)

Originally posted at >>>/qresearch/13937684 (191429ZJUN21) Notable: Georgia Democratic rockstars Stacey Abrams and Sen. Raphael Warnock have both made major reversals on their feelings about voter identification,

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Updated: June 19, 2021 - 8:37am

Georgia Democratic rockstars Stacey Abrams and Sen. Raphael Warnock have both made major reversals on their feelings about voter identification, flips that could signal shifting Democratic priorities about voter ID as the Senate considers a sweeping voting bill that could include identification measures.

West Virginia Sen. Joe Manchin this week proposed several additions to the controversial For the People Act, a bill that, if passed, would allow Congress to exert significant control over most U.S. elections.

Among the measures Manchin has suggested are voter ID rules, which would require identification at the polls but would allow voters to use a variety of documents to prove their identity.

Prominent Democratic activist Stacey Abrams this week came out in support of the measures, a sharp reversal from earlier hardline opposition to voting ID laws.

Abrams suggested that widespread Democratic opposition to voting ID laws has been “one of the fallacies of Republican talking points that have been deeply disturbing.”

“No one has ever objected to having to prove who you are to vote,” she said. “It's been part of our nation's history since the inception of voting.”

In April of this year, Abrams claimed she was opposed to Georgia’s recently passed election reform bill due in part to the fact that it “requires that a voter has a photo identification or some other form of identification that they are willing to surrender in order to participate in an absentee ballot process.”

Democratic Sen. Raphael Warnock, meanwhile, has also voiced support for Machin’s proposal, falsely claiming that he has “never been opposed to voter ID” and that he “[doesn’t] know anybody who is.”

In the past Warnock has claimed that voter ID laws are “not about voter verification” but about “voter suppression.”

https://justthenews.com/politics-policy/elections/top-georgia-democrats-flip-voter-id-amid-push-manchin-identification?utm_source=63red.com&utm_medium=referral&utm_campaign=63red

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65246

Originally posted at >>>/qresearch/13937700 (191433ZJUN21) Notable: Consider counseling… "First on CNN: Biden administration moves to make gender confirmation surgery available through Veteran Affairs health care system"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://us.cnn.com/2021/06/19/politics/veterans-affairs-gender-confirmation-surgery/index.html

First on CNN: Biden administration moves to make gender confirmation surgery available through Veteran Affairs health care system

(CNN)Veterans Affairs Secretary Denis McDonough is moving to make gender confirmation surgery available to transgender veterans through Veterans Affairs health care coverage, according to a VA department spokesperson.

McDonough will announce the move at a Pride event at the Orlando Vet Center in Florida later on Saturday, according to the spokesperson.

"We are taking the first necessary steps to expand VA's care to include gender confirmation surgery – thus allowing transgender vets to go through the full gender confirmation process with VA by their side," McDonough's prepared remarks state. CNN obtained a copy of the speech.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65247

Originally posted at >>>/qresearch/13937723 (191435ZJUN21) Notable: Muh Kunspiracy Kuntinues… Arizona 'audit' becomes far-right campaign stop, fuels conspiracy that election can be overturned

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>Arizona 'audit' becomes far-right campaign stop, fuels conspiracy that election can be overturned

Sauce: https://abcnews.go.com/Politics/arizona-audit-campaign-stop-fuels-conspiracy-election-overturned/story?id=78299072

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65248

File: 09a5098e1df41b4⋯.png (35.11 KB,596x226,298:113,Clipboard.png)

Originally posted at >>>/qresearch/13937727 (191437ZJUN21) Notable: Juneteenth Recognition

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://mobile.twitter.com/NSAGov/status/1406257827010822148

We are pleased to honor the newest federal holiday and the significance of this important time our nation's history. #JuneTeenth2021

3:29 AM · Jun 19, 2021

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65249

File: 8269801f4175eba⋯.png (400.31 KB,729x578,729:578,Clipboard.png)

File: f8b1db6e58ab1e2⋯.png (88.66 KB,600x593,600:593,Clipboard.png)

Originally posted at >>>/qresearch/13937749 (191439ZJUN21)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The National Security Agency has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans, according to a letter that I received from the NSA this afternoon, and that suggests a political fight between the two agencies.

The NSA replied to the exact same request Clevenger provided to the FBI where he received the response it would take the FBI decades to respond. Below is the NSA’s letter:

https://populist.press/bombshell-nsa-revealed-the-fbi-committed-massive-crimes-against-americans/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65250

File: 3a8bd991d948b68⋯.png (781.77 KB,1041x602,1041:602,Clipboard.png)

Originally posted at >>>/qresearch/13937771 (191443ZJUN21) Notable: Dan FF-22 Raptor video decode? Last Time there was a FF… after a similar tweet. Stay Safe Friends.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937709

come to think of it, vid length is 1:07 → 17

maybe Dan was pointing to the 17 sec mark via vid duration, reinforcing the diamond symbol.

>>>/qresearch/13937726 o7 Got it, thanks. updated graphic. D-Day is approaching.

>>>/qresearch/13937731

>>>/qresearch/13937751

Think the D-Day interpretation is the correct one. Stormin' the beaches of Normandy.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65251

File: db0a7394bf4ba63⋯.png (344.24 KB,656x511,656:511,Clipboard.png)

Originally posted at >>>/qresearch/13937778 (191443ZJUN21)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65249

BY ZACHARY STIEBER June 19, 2021 Updated: June 19, 2021

The National Security Agency (NSA) has agreed to release records on the FBI’s improper spying on thousands of Americans, the secretive agency disclosed in a recent letter.

The agreement may signal a rift between the NSA and the FBI, according to attorney Ty Clevenger.

Clevenger last year filed a Freedom of Information Act (FOIA) request on behalf of The Transparency Project, a Texas nonprofit, seeking information on the FBI’s improper searches of intelligence databases for information on 16,000 Americans.

The searches violated rules governing how to use the U.S. government’s foreign intelligence information trove, U.S. District Judge James Boasberg, an Obama nominee who currently presides over the Foreign Intelligence Surveillance Court, wrote in a 2019 memorandum and order that was declassified last year.

The FBI insisted that the queries for all 16,000 people “were reasonably likely to return foreign-intelligence information or evidence of a crime because [redacted],” Boasberg wrote. But the judge found that position “unsupportable,” apart from searches on just seven of the people.

Still, Boasberg allowed the data collection to continue, prompting Elizabeth Goitein, co-director of the Liberty and National Security Program at the Brennan Center for Justice, to lament that court’s decision on the data collection program, authorized by Section 702 of the Foreign Intelligence Surveillance Act (FISA), “is even more inexplicable given that the opinion was issued shortly after the government reported submitting FISA applications riddled with errors and omissions in the Carter Page investigation.”

Page was a campaign associate of then-candidate Donald Trump who was illegally surveilled by the FBI.

After the judge’s order was made public, Clevenger filed FOIA requests for information on the improper searches with both the FBI and the NSA.

The FBI rejected the request. In a February letter (pdf), an official told Clevenger that the letter he wrote “does not contain enough descriptive information to permit a search of our records.”

The NSA initially declined the request as well, but later granted an appeal of the decision, Linda Kiyosaki, an NSA official, said in a letter (pdf) this month.

“You had requested all documents, records, and other tangible evidence reflecting the improper surveillance of 16,000 individuals described in a 6 December, 2019, FISC Opinion,” Kiyosaki wrote.

Clevenger believes the NSA’s new position signals a rift between the two agencies, potentially because the FBI has repeatedly abused rules governing searches of the intelligence databases while the NSA has largely not.

https://www.theepochtimes.com/nsa-agrees-to-release-records-on-fbis-improper-spying-on-16000-americans_3865431.html?utm_source=partner&utm_campaign=gp

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65252

File: e09deb0c0147d60⋯.png (569.69 KB,1219x711,1219:711,Clipboard.png)

Originally posted at >>>/qresearch/13937785 (191444ZJUN21) Notable: 1 Year Delta Q4360 Review:Insurrection Act of 1807, [Determination that the various state and local authorities are not up to the task of responding to the growing unrest] Call the ball. Q

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

OTD 2020 DJT tweeting about [D]ACA

"They "punted" much like in a football game (where hopefully they would stand for our Great American Flag)."

1 year -2 days SC decision on ACA

punt, punt, punt

Fitting tweet content…

Monday is the 32nd anniversary of SC legalizing burning of the American Flag

13:44 includes some pretty solid drops including:

My fellow Americans…

Renegade… They always knew.

Really Special Place for GS

How do you hide a message in clear sight?

Do anons know what is about to be unleashed? Mercer Puppy Pic

Are we coming full circle on Kraft?

Scalia was nominated to the court 35 years ago next week. https://www.msnbc.com/opinion/supreme-court-saved-obamacare-it-s-only-part-battle-n1271145

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65253

File: 970bec7e690c845⋯.jpg (319.27 KB,1080x2220,18:37,Clipboard.jpg)

File: 4f32b719919cce5⋯.jpg (437.15 KB,1080x2220,18:37,Clipboard.jpg)

Originally posted at >>>/qresearch/13937786 (191444ZJUN21) Notable: Juneteenth Recognition

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

During National Preparedness Month, we pause to reflect on the importance of mitigating the effects of disasters and tragedies on our lives by devoting time and resources to being prepared. As we observe National Preparedness Month this September, I encourage all Americans to take intentional, precautionary measures to ensure the resilience of their families, homes, communities, and businesses.

Over the last year, our Nation has endured and persevered through many threats. Last week, hurricane Laura struck the Gulf Coast and affected the lives of millions in Louisiana, Texas, Arkansas, and Mississippi. My Administration is monitoring Federal response efforts and coordinating with State and local authorities to provide aid to the affected areas. In recent months, we have also responded to the coronavirus pandemic with unparalleled vigor and resolve, leveraging historic partnerships between the public and private sectors to produce and provide needed medical equipment and to develop therapeutics and a vaccine. We remain committed to safely reopening our country while protecting the most vulnerable among us. We have also faced wildfires, earthquakes, and storms, including a devastating weather system on Easter Sunday of this year that spawned more than 120 tornadoes in the southeastern United States. Despite the unprecedented nature and scope of the challenges we have faced, the American people have remained resolute in their determination to overcome any adversity. My Administration will continue to work with State, local, tribal, and territorial partners to ensure the country is prepared to meet any challenges that may arise.

National Preparedness Month is also an opportunity to reiterate our gratitude for the selfless service of the brave men and women who help prepare our Nation for disasters and take action when they strike. Our first responders, critical infrastructure and other frontline workers, and disaster response volunteers often take great personal risks to perform their duties. These patriots are essential to the security of our Nation, and we remain committed to supporting them in their mission.

Promoting a culture of resilience through preparedness helps enable communities and individuals to take the preparatory actions necessary to overcome the threats and hazards that present themselves. The Federal Emergency Management Agency’s Ready Campaign, which can be found by accessing Ready.gov, can help all Americans prepare for crisis situations. This easy-to‑use response can help individuals and families create an emergency fund for unexpected expenses, set up a designated shelter area within a home, subscribe to local emergency alerts on mobile devices, and determine a reliable out-of-town contact during times of crisis. By taking these steps, people can mitigate damage and speed up recovery efforts across the country when disaster strikes.

During National Preparedness Month, I encourage all Americans to adopt a proactive mindset and take the necessary steps to prepare their families and communities to withstand and recover from unexpected events. We cannot always know when the next crisis will occur, but we can know that we will be prepared by committing ourselves to a culture of resilience.

NOW, THEREFORE, I, DONALD J. TRUMP, President of the United States of America, by virtue of the authority vested in me by the Constitution and the laws of the United States, do hereby proclaim September 2020 as National Preparedness Month. I encourage all Americans, including Federal, State, tribal, and local officials, to take action to be prepared for a disaster or an emergency by making and practicing their emergency response plans. Each step we take to become better prepared makes a real difference in how our families and communities will respond and persevere when faced with the unexpected.

IN WITNESS WHEREOF, I have hereunto set my hand this

thirty-first day of August, in the year of our Lord two thousand twenty, and of the Independence of the United States of America the two hundred and forty-fifth.

DONALD J. TRUMP

https://trumpwhitehouse.archives.gov/presidential-actions/proclamation-national-preparedness-month-2020/

https://m.washingtontimes.com/news/2021/jun/18/north-koreas-kim-jong-un-vows-be-ready-confrontati/?utm_source=RSS_Feed&utm_medium=RSS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65254

File: bbd22504d4f2f59⋯.png (1.78 MB,1080x2340,6:13,Clipboard.png)

Originally posted at >>>/qresearch/13937790 (191445ZJUN21) Notable: Dan FF-22 Raptor video decode? Last Time there was a FF… after a similar tweet. Stay Safe Friends.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65250

http://umich.edu/~umfandsf/symbolismproject/symbolism.html/D/diamond.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65255

File: 2b08351dcbd433a⋯.png (243.89 KB,588x580,147:145,Clipboard.png)

Originally posted at >>>/qresearch/13937793 (191445ZJUN21) Notable: DTM Tweets: Another short video - I NEED TRUMP BACK

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://mobile.twitter.com/DanScavino/status/1406260280301137924

From

Melissa Tate

3:39 AM · Jun 19, 2021·

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65256

File: ff72dcf4d469fc1⋯.png (823.76 KB,1032x588,86:49,Clipboard.png)

Originally posted at >>>/qresearch/13937806 (191447ZJUN21) Notable: Dan FF-22 Raptor video decode? Last Time there was a FF… after a similar tweet. Stay Safe Friends.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65254

ty anon. making moar and moar sense as the hivemind weighs in

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65257

File: d732af2d6f11056⋯.jpg (107.29 KB,421x314,421:314,Clipboard.jpg)

Originally posted at >>>/qresearch/13937819 (191449ZJUN21) Notable: Consider counseling… "First on CNN: Biden administration moves to make gender confirmation surgery available through Veteran Affairs health care system"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Words of the weasel.

>gender confirmation surgery

Shouldn't that be conformation surgery?

Because: Definition of GC surgery: "surgery undergone by a transgender person in order to alter their physical sexual characteristics to match their gender identity."

https://www.plasticsurgery.org/reconstructive-procedures/gender-confirmation-surgeries

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65258

File: dfacb61075469aa⋯.jpg (194.92 KB,1920x1080,16:9,Clipboard.jpg)

File: b50fffdc54fbddf⋯.jpg (341.52 KB,1080x2220,18:37,Clipboard.jpg)

Originally posted at >>>/qresearch/13937856 (191456ZJUN21) Notable: 1 Year Delta Q4360 Review:Insurrection Act of 1807, [Determination that the various state and local authorities are not up to the task of responding to the growing unrest] Call the ball. Q

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

May 1 yr delta.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65259

File: 4d40e2c2b90f5d2⋯.png (7.84 KB,603x221,603:221,Clipboard.png)

Originally posted at >>>/qresearch/13937859 (191456ZJUN21) Notable: 1 Year Delta Q4360 Review:Insurrection Act of 1807, [Determination that the various state and local authorities are not up to the task of responding to the growing unrest] Call the ball. Q

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65252

Moar football and Old Glory from DJT OTD LY

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65260

File: 539dd5994944628⋯.jpg (217.48 KB,1080x1490,108:149,Clipboard.jpg)

File: 2acb20e3fd28989⋯.jpg (318.61 KB,1080x1823,1080:1823,Clipboard.jpg)

Originally posted at >>>/qresearch/13937876 (191459ZJUN21) Notable: FIN: DJT on vax comms clarification for normies and newbies

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937827

>>>/qresearch/13937827

https://www.msn.com/en-us/news/us/trump-says-coronavirus-vaccines-are-potentially-dangerous-for-kids/ar-AAL8cTI

https://www.politico.com/news/2021/06/16/trump-rails-against-covid-vaccines-for-very-young-people-494975

Try to keep up

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65261

File: 17c75f52b1212bf⋯.mp4 (6.61 MB,320x564,80:141,Clipboard.mp4)

Originally posted at >>>/qresearch/13937884 (191500ZJUN21) Notable: DTM Tweets: Another short video - I NEED TRUMP BACK

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65255

here's the vid

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65262

Originally posted at >>>/qresearch/13937902 (191503ZJUN21) Notable: Everyone wants a wall - The situation on the Belarusian border is still uncontrolled. This year, the flow of illegal migrants to Western Europe has increased fivefold through Lithuania alone. The Lithuanian authorities have even begun to consider erecting a fence on the border to strengthen the defense.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Everyone wants a wall

https://belsat.eu/en/news/19-06-2021-wall-may-appear-between-belarus-and-lithuania/

The situation on the Belarusian border is still uncontrolled. This year, the flow of illegal migrants to Western Europe has increased fivefold through Lithuania alone. The Lithuanian authorities have even begun to consider erecting a fence on the border to strengthen the defense.

Civilian authorities have not yet supported such a proposal by the Interior Ministry, but a discussion is on. The investigation will begin. According to the Lithuanian secret services, this flow of migrants is an international operation organized by the Belarusian authorities.

“People from third countries have been crossing our border illegally for several weeks now. We have information that Belarusian officials are involved in the organized transportation of people to our border. Intelligence agencies are figuring this out. The Ministry of Internal Affairs of Lithuania also appealed to the Prosecutor General’s Office to launch an investigation.”

Lithuanian Foreign Minister Gabrielius Landsbergis said Belarus delivers Syrians and Iraqis from Istanbul and Baghdad to its territory using the national tour operator Tsentrkurort. And so-called “tourists” are taken to the border from Minsk. Is it a coincidence that such trafficking began after Alyaksandr Lukashenka promised to weaken control over drug trafficking and illegal migration at the western border?

In 2019, Belarusian colleagues failed to catch 46 so-called illegals, in 2020 – 81. This year, in six months, 397 people have crossed the border to the Lithuanian side. If we go at this pace, at the end of the year, we will have 800.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65263

File: 92040365f28b8fb⋯.png (823.89 KB,993x541,993:541,Clipboard.png)

Originally posted at >>>/qresearch/13937911 (191506ZJUN21) Notable: 'Suspicious' Object Prompting Brief Closure of CIA Headquarters Turned Out to be…Dog Collar Device

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

'Suspicious' Object Prompting Brief Closure of CIA Headquarters Turned Out to be…Dog Collar Device

(Dog COMMS? - apology if already posted)

The CIA had to shut down its headquarters and the surrounding area on Friday after an unidentified device was detected near its front gates. Luckily, the "suspicious" item was absolutely harmless - perhapsthe intelligence agency should have let sleeping dogs lie this time.

The CIA identified a "suspicious" device found on Friday near the front gate of its headquarters in northern Virginia.

According to an investigation, the detected item was aremote control for a dog training collar.

"Our front gate is all clear, and the matter is resolved", CIA spokeswoman Nicole de Haay said in a statement, adding that the incident had no security implications.

De Haay added that no one was injured and the agency's operations had returned to normal.

On Friday, the CIA had to briefly close down its headquarters after an object was found on a sidewalk column near the front gates. The agency deployed a special robot designed to deal with "dangerous devices", according to WJLA.

https://sputniknews.com/us/202106191083188874-suspicious-object-prompting-brief-closure-of-cia-headquarters-turned-out-to-bedog-collar-device/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65264

Originally posted at >>>/qresearch/13937934 (191511ZJUN21) Notable: Ebrahim Raisi sat on Ayatollah Ruhollah Khomeini’s ‘death committee’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://spectatorworld.com/topic/dark-past-iran-new-president-ebrahim-raisi/

Ebrahim Raisi sat on Ayatollah Ruhollah Khomeini’s ‘death committee’

Each vote doesn’t count, of course. The regime makes sure of that. Iran ‘manages’ its elections. This year, 600 people registered as candidates. That was cut to seven. The unelected Guardian Council, which consists of 12 ‘jurists’ (clerics), is responsible for ensuring all candidates are compatible with ‘Islamic values’.

What this means is that it can disqualify pretty much anyone it doesn’t like. The real reasons the council generally disqualifies people are almost invariably to do with politics rather than religion.

By clearing the way for Raisi to win, the Supreme Leader’s coterie did two things: one, they ensured their man took control of the presidency; and two: they sent a message to the Iranian people and to the world.

This is because even by the regime’s pathological standards, Raisi is a hardliner. In July 1988, Ayatollah Ruhollah Khomeini, Iran’s first Supreme Leader issued an order (some argue it was even a fatwa — a religious ruling) ordering the execution of imprisoned opponents.

It was the beginning of what turned out to be the biggest massacre of political prisoners since World War Two. Charged with carrying out the executions was a ‘four-man commission’ later known as the ‘death committee’ — prominent among whom was Raisi.

The executions went on for five months — thousands were killed (some estimates are as high as 30,000). Most of the victims were members of the Iranian opposition group the People’s Mujahedin Organization of Iran (PMOI), or the Mujahedin-e-Khalq. To this day the regime denies the massacres took place.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65265

Originally posted at >>>/qresearch/13937962 (191515ZJUN21) Notable: ,President Donald J. Trump, 45th President of the United States of America, will hold amajor rallyin Wellington, Ohio on Saturday, June 26, 2021 at 7:00PM EDT.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://gab.com/realdonaldtrump/posts/106422964402241291

President Donald J. Trump, 45th President of the United States of America, will hold a major rally in Wellington, Ohio on Saturday, June 26, 2021 at 7:00PM EDT.

This Save America rally marks President Trump’s first of many appearances in support of candidates and causes that further the MAGA agenda and accomplishments of President Trump’s administration. The rally is to support Max Miller, who President Trump has endorsed for election in Ohio’s 16th Congressional District.

Saturday, June 26, 2021, at 7:00PM EDT

President Donald J. Trump, 45th President of the United States of America, Delivers Remarks

Venue:

Lorain County Fairgrounds

23000 Fairgrounds Rd.

Wellington, OH 44090

General Admission Tickets:

REGISTER HERE http://email.m.saveamerica45.com/c/eJw9jcuOgzAMRb8GdkSJ8yKLLNoi_sMhZpoRoYhHUf9-wmg0kmVLR9fnRi-UDdLVyQMHwY0wAEoBMMH4TQrXPfqut8JKaSrFM9vwTZhpTQMqzYZXrp9em6A4CklAQ7DKiWBakEK6YEk5NPXkn_u-bJW8VdCXOc-TxdeMU_ze1yMvl6dgetO8b_XqcY4rnaXvCwPDVGNepjR-fGXvFcBxpFjOrw3AaJJDKxutNTUqytA4N8SGQ2sUBkOjHa8wPMrePwv9f_5JGWVM00Vt9wNBMU1X

Doors open at 2:00PM EDT

Request Media Credentials:

REGISTER HERE: http://email.m.saveamerica45.com/c/eJw9TsmOgzAM_Rq4ESXORg4c2iL-w1mgQYSiAK369xNGo5GsZ9lvsX3HhLbc1LEDCowqpgCEACCM0Btnpn8M_aCZ5lxVgiay4ztgCjk6FJK4V6qf3ag1IAXnpGstR6FbjYxq9MZYypHXS_c8jm2v-K2CoVR4h_XYiX-tuPj5yGfarqjCuBx84SIucZ3KPH9mr8ZpzWedO1x9Dp_yxoSWYKwxbUscv12l7xXAeUZf2u8RACUDdy1vpJShEZ7bxhjnGwqtEmhVGPV4ieFR8Phu4d_5F0pCwrhcW93_AOPlVkc

All requests for media credentials must be submitted by Thursday, June 24, 2021 at 7:00PM EDT.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65266

Originally posted at >>>/qresearch/13937969 (191516ZJUN21) Notable: PDJT: "I have accepted the invitation of Texas Governor Greg Abbott to join him on an official visit to our Nation’s decimated Southern Border on Wednesday, June 30, 2021".

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://gab.com/realdonaldtrump/posts/106416984584519920

I have accepted the invitation of Texas Governor Greg Abbott to join him on an official visit to our Nation’s decimated Southern Border on Wednesday, June 30, 2021.

The Biden Administration inherited from me the strongest, safest, and most secure border in U.S history and in mere weeks they turned it into the single worst border crisis in U.S history. It’s an unmitigated disaster zone.

We went from detain-and-remove to catch-and-release. We went from having border security that was the envy of the world to a lawless border that is now pitied around the world. Biden and Harris have handed control of our border over to cartels, criminals, and coyotes. Drug dealers, MS-13 gang members, human smugglers, sex traffickers, and the criminal elements of the world now have free reign. Hospitals and schools are getting crushed and public health is being sacrificed all in service of a radical left anti-borders agenda. Our brave border agents and courageous ICE officers have been illegally stopped from doing their jobs. Our Nation is now one giant sanctuary city where even dangerous criminals are being cut loose and set free inside the U.S interior on a daily basis.

If this weren’t bad enough, Biden and Harris won’t even tour the scenes of the wreckage they created, or come down and visit with the Border Patrol and ICE heroes risking their lives to defend our Nation at a time when the White House is doing everything it can to make their job totally impossible.

What Biden and Harris have done, and are continuing to do on our border, is a grave and willful dereliction of duty.

My visit will hopefully shine a spotlight on these crimes against our Nation—and show the incredible people of ICE and Border Patrol that they have our unshakeable support.

Media credentialing information will be provided at a later date.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65267

Originally posted at >>>/qresearch/13937975 (191517ZJUN21) Notable: PDJT "Donald J. Trump is pleased to announce Liz Harrington, a strong Republican conservative voice for America and who has represented conservative policies so well over the years, as our new spokesperson for Save America and Donald J. Trump, 45th President of the United States of America. Liz will be taking the place of Jason Miller, who will be leaving to enter the private sector. "I greatly thank Jason for his service—he is outstanding!" said President Donald J. Trump."

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://gab.com/realdonaldtrump/posts/106415493011497127

Donald J. Trump is pleased to announce Liz Harrington, a strong Republican conservative voice for America and who has represented conservative policies so well over the years, as our new spokesperson for Save America and Donald J. Trump, 45th President of the United States of America. Liz will be taking the place of Jason Miller, who will be leaving to enter the private sector. "I greatly thank Jason for his service—he is outstanding!" said President Donald J. Trump.

“Liz Harrington is a fighter,” said President Trump. “She was an important part of our receiving more votes than any incumbent President in U.S. history, far more than we received the first time we won.”

“It is an honor of a lifetime to represent President Trump and to stand for the truth,” said Harrington. “At such a critical time for our country, President Trump’s fighting spirit is needed now more than ever. We will not stand idly by and let America fall to the Radical Left-Wing Mob.”

Harrington is the former national spokesperson for the Republican National Committee, editor-in-chief of http://WarRoom.org, and senior writer for the Washington Free Beacon. She has long been a staunch supporter of President Trump.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65268

File: d1e5a796591039b⋯.png (164.58 KB,614x676,307:338,Clipboard.png)

Originally posted at >>>/qresearch/13937991 (191519ZJUN21) Notable: 'Suspicious' Object Prompting Brief Closure of CIA Headquarters Turned Out to be…Dog Collar Device

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937926

>>>/qresearch/13937924

>>65263

>>>/qresearch/13937921

Dog

Collar

Device

CIA's Domestic Collection Division? (or Datacentre Dynamics?)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65269

File: 3b1f0e900b0c0a4⋯.jpg (133.85 KB,720x1127,720:1127,Clipboard.jpg)

Originally posted at >>>/qresearch/13938000 (191521ZJUN21) Notable: Explosion at a fireworks warehouse in Moscow. White Russian Smoke… WH COMMS?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/disclosetv/status/1406267675526012928?s=19

NOW - Explosion at a fireworks warehouse in Moscow.

https://t.co/L2MBgU4soZ

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65270

File: 540a51d877ed316⋯.png (1003.1 KB,1279x831,1279:831,Clipboard.png)

Originally posted at >>>/qresearch/13938002 (191522ZJUN21) Notable: After riding up an escalator, attendees at the Faith & Freedom Coalition’s annual Road to Majority conference met with a registration sign slapped with two additional labels: “Trump: Take America Back, 2024” and “Trump Store, Vendor Exhibits”…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Just a reminder.

Joe is not our POTUS & Kameltoe is not our VP

- Both Bidans’ Twat accounts, Personal & POTUS, list him as a United States Government Official.

- Both Kameltoes’ Twat accounts, Personal & VP, list him/her as a United States Government Official.

They only changed their name….

Like… what is your name: President Biden

😂 😂

Compare to real POTUS

Compare to the traitor real VP

Laugh.

Reconcile.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65271

Originally posted at >>>/qresearch/13938021 (191524ZJUN21) Notable: Tokyo Bugs? GPS watching of Journalists… Apparently Americans arent theonly ones untrusting of MSN… The president of the Tokyo Olympics, Seiko Hashimoto, announced on June 8 that international journalists will be tracked by GPS while they are in Japan. The International Federation of Journalists (IFJ) cries

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

KEK

https://ifex.org/japan-foreign-journalists-to-be-tracked-by-gps-at-tokyo-olympics/

The president of the Tokyo Olympics, Seiko Hashimoto, announced on June 8 that international journalists will be tracked by GPS while they are in Japan. The International Federation of Journalists (IFJ) condemns the Olympic Organising Committee’s (OOC) complete disregard for privacy.

The OOC has implemented this GPS monitoring system as a means of maintaining safety during the COVID-19 pandemic. If journalists do not comply with the tracking regime, their Olympic access passes will be revoked.

Before a board meeting to discuss the Games, Hashimoto said, “To make sure that people don’t go to places other than the places where they are registered to go, we will use GPS to strictly manage their behaviour.”

The GPS monitoring will be conducted through tracking the phones of media personnel and Olympic organisers will be instructing them to keep the positioning function on and save the data. This data will be provided to organisers if required.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65272

File: 636e8387c6202a6⋯.png (164.21 KB,891x518,891:518,Clipboard.png)

Originally posted at >>>/qresearch/13938029 (191527ZJUN21) Notable: 'Suspicious' Object Prompting Brief Closure of CIA Headquarters Turned Out to be…Dog Collar Device

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65268

>>65263

this about CIA and muh UFOs / muh aliens / muh weird creatures?

The CIA Once Investigated Odd Allegations About This Famous Cryptozoologist

Micah Hanks - April23,2021

… Shortly after the end of World War II, U.S. intelligence agencies began fostering relationships with escaped Nazis and other war criminals for purpose of exploiting their knowledge to the benefit of American interests. As if the intelligence community’s uneasy relationship with former enemies weren’t ironic enough, there were some instances where individuals that were being prosecuted for war crimes had actually been tapped for recruitment by the Counter-Intelligence Corps (prior to the establishment of the CIA) unbeknownst to the prosecutors that were building cases against them.

Among the most notorious war criminals who served the efforts of U.S. intelligence had been Nikolaus “Klaus” Barbie, who was employed by the United States and eventually helped to escape to Bolivia, where he was believed to have participated in the coup d’état undertaken by Luis García Meza in 1980. Barbie, nicknamed the “Butcher of Lyon” for his torture of Gestapo prisoners during the War, was eventually captured and extradited to France, where he stood trial for his war crimes and eventually died in prison.

The involvement of war criminals like Barbie in U.S. intelligence operations is one of the strangest and more disconcerting areas in post-war American history. However, what is less well known is that at one time, the CIA also investigated possible connections between Barbie and an American philanthropist and oil tycoon best known for conducting expeditions in search of the famous Abominable Snowman of the Himalayas.

San Antonio-based inventor Thomas Baker Slick, the founder of several scientific research organizations that included the Texas Biomedical Research Institute, also had a penchant for the mysterious and beastly. Beginning in the 1950s, he launched expeditions that went in search of proving the existence of creatures that included the famous Loch Ness Monster, as well as the Abominable Snowman of the Himalayas (as well as its American cousin, Bigfoot, shortly before his death.

Many of Slick’s exploits, as well as his possible associations with the Central Intelligence Agency, were detailed by cryptozoology chronicler Loren Coleman in his definitive biography Tom Slick and the Search for the Yeti (1989), as well as the updated 2002 edition Tom Slick: True Life Encounters in Cryptozoology, which featured a new appendix that examined possible involvement Slick had with the CIA (more on that subject can be found here).

However, an interesting footnote in Slick’s already intriguing history of possible interactions with the CIA and its operations turned up in the early 2000s, as a part of the Nazi War Crimes Disclosure Act….

The memorandum states that Slick had no ties to Klaus Barbie that were known to the CIA at any time, but then notes a number of interactions Slick had with the CIA over the years. Primarily, these interactions were with CIA Director Allen Dulles, and involved instances where Slick approached the agency about funding branches of hisInstitute of Inventive Researchin parts of Europe and Asia in April 1953.

“FromDCD filesit was noted that Slick’s contacts with CIA were attempts to obtain funding for one of his schemes or institutes,” the memorandum reads, adding that “There is no record of any official relationship between Slick and CIA.”

“However,” the memo does add, “CIA had periodic contacts with him between January 1950 and October 1959. According toDCD filesSlick served in the U. S. Navy from 1942 to 1946, theatre unknown. Since Slick was personally known to former Director Dulles, this association may have developed during World War II.” The connection betweenDullesand Slick described in the document likely would have occurred during their years attending college together atYale.

moar at:

https://mysteriousuniverse.org/2021/04/the-cia-once-investigated-odd-allegations-about-this-famous-cryptozoologist/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65273

File: f83a58cd3ea886a⋯.png (619.45 KB,1775x707,1775:707,Clipboard.png)

Originally posted at >>>/qresearch/13938048 (191528ZJUN21) Notable: REVEALED: Google & USAID Funded Wuhan Collaborator Peter Daszak’s Virus Experiments For Over A Decade.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://thenationalpulse.com/exclusive/google-funded-wuhan-linked-ecohealth-research/

REVEALED: Google & USAID Funded Wuhan Collaborator Peter Daszak’s Virus Experiments For Over A Decade.

JUNE 19, 2021NATALIE WINTERS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65274

File: 805108f52c12276⋯.png (330.5 KB,857x602,857:602,Clipboard.png)

Originally posted at >>>/qresearch/13938103 (191539ZJUN21) Notable: Multiple Individuals Pushed Stacks of Ballots through Tabulators Multiple Times in Georgia. This Is Illegal. Law Enforcement Did Nothing.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/multiple-individuals-push-multiple-ballots-multiple-tabulators-multiple-times-georgia-illegal-law-enforcement-nothing/

Multiple Individuals Pushed Stacks of Ballots through Tabulators Multiple Times in Georgia. This Is Illegal. Law Enforcement Did Nothing.

By Joe Hoft

Published June 19, 2021 at 10:20am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65275

File: 444a076b267a150⋯.png (925.54 KB,864x808,108:101,Clipboard.png)

Originally posted at >>>/qresearch/13938109 (191540ZJUN21) Notable: Rhode Island Teachers Busted Offering Students Bonus Points to Defend Critical Race Theory at School Board Meetings

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/rhode-island-teachers-busted-offering-students-bonus-points-defend-critical-race-theory-school-board-meetings/

Rhode Island Teachers Busted Offering Students Bonus Points to Defend Critical Race Theory at School Board Meetings

By Cassandra Fairbanks

Published June 19, 2021 at 10:00am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65276

File: 6e29e72aa1d4b54⋯.png (582.6 KB,893x1082,893:1082,Clipboard.png)

Originally posted at >>>/qresearch/13938112 (191540ZJUN21) Notable: June 18th Booms on the 19th? NAVY Tweets

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Boom

Boom

Boom

Boom

https://twitter.com/USNavy/status/1406274332997865475

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65277

File: 86b3daa35453c68⋯.png (10.62 KB,417x239,417:239,Clipboard.png)

File: 0b3370c41070d1a⋯.png (678.75 KB,744x776,93:97,Clipboard.png)

File: c2a0fe2c6ce2388⋯.png (840.64 KB,599x756,599:756,Clipboard.png)

File: 1c49abd146b9594⋯.png (700.44 KB,587x740,587:740,Clipboard.png)

File: e8c8ea1660088f8⋯.png (199.63 KB,548x767,548:767,Clipboard.png)

Originally posted at >>>/qresearch/13938117 (191541ZJUN21) Notable: ,U.K. LEAK?Permanent Lockdowns? Preparation for Anti Lockdown Protests?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

‼️🔥🔥——BREAKING BOMBSHELL——🔥🔥‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

‼️——UPDATE——‼️

IF AUTHENTIC, THIS IS WORSE THAN WE FIRST THOUGHT !!

HERE ARE ALL 4 PAGES OF THE ALLEGED LEAKED MEMORANDUM FROM NEIL M. FERGUSON OF IMPERIAL COLLEGE LONDON

PLEASE SHARE THIS LINK FAR AND WIDE

https://t.me/RambaldisEye/2048

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65278

File: bb6ec4a699e3b4a⋯.png (259.16 KB,600x800,3:4,Clipboard.png)

Originally posted at >>>/qresearch/13938120 (191542ZJUN21) Notable: Multiple Individuals Pushed Stacks of Ballots through Tabulators Multiple Times in Georgia. This Is Illegal. Law Enforcement Did Nothing.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65274

whoa, ty

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65279

File: fb88e207d752270⋯.png (317.79 KB,590x533,590:533,Clipboard.png)

Originally posted at >>>/qresearch/13938121 (191542ZJUN21) Notable: Our family lost our loving companion Champ today. I will miss him.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://mobile.twitter.com/POTUS/status/1406273358187044868

Our family lost our loving companion Champ today. I will miss him.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65280

File: 4793d14677fbf9c⋯.png (187.93 KB,392x517,392:517,Clipboard.png)

File: ca317e8f11cd7a9⋯.png (406.46 KB,725x463,725:463,Clipboard.png)

File: 2b8de3c4873de93⋯.png (437.91 KB,491x875,491:875,Clipboard.png)

Originally posted at >>>/qresearch/13938123 (191543ZJUN21) Notable: Freedom Forever Scavino Facebook Easter Egg

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Found something creepy cool on FB Scavino post, because I'm back as a MF.

https://www.facebook.com/DanScavino/posts/2912526765629707?comment_id=2914247208790996&notif_id=1624115944697210&notif_t=public_figure_l0_comment&ref=notif

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65281

File: e794c66a0d31e3b⋯.png (193.18 KB,465x440,93:88,Clipboard.png)

File: e272d813f02ae39⋯.png (933.87 KB,916x1024,229:256,Clipboard.png)

File: 09162cb0ec3c548⋯.png (779.36 KB,1024x683,1024:683,Clipboard.png)

Originally posted at >>>/qresearch/13938129 (191544ZJUN21) Notable: Our family lost our loving companion Champ today. I will miss him.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

I am so sorry for your loss, Joe.

President Biden

@POTUS

United States government official

Our family lost our loving companion Champ today. I will miss him.

11:31 AM · Jun 19, 2021·The White House

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65282

File: 50c8fe4e9a6a799⋯.jpeg (272.16 KB,1163x1956,1163:1956,Clipboard.jpeg)

Originally posted at >>>/qresearch/13938192 (191555ZJUN21) Notable: PB Notable… Re: Mockingbird, Feds

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65235 "This is amazing. Last night I did a Fox segment on how the FBI and CIA have more power over the US corporate media than ever. It used to be clandestine but now they put their operatives right in the newsrooms. It's Operation Mockingbird, but not hidden:"

Heres one of the documents that Glenn Greenwald was referencing, from the senate. Download it at link above

https://www.intelligence.senate.gov/sites/default/files/hearings/ciasuseofjournal00unit.pdf

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65283

File: 3ba90b38ea794c8⋯.jpg (25.69 KB,806x289,806:289,Clipboard.jpg)

Originally posted at >>>/qresearch/13938195 (191556ZJUN21)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13938190

>>65249

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65284

File: d56c4e1346d38dd⋯.jpg (1.86 MB,969x6545,57:385,Clipboard.jpg)

Originally posted at >>>/qresearch/13938198 (191556ZJUN21) Notable: PB Notable… Re: Mockingbird, Feds

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65282

Well done.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65285

File: d5bf589a7439481⋯.png (125.85 KB,422x528,211:264,Clipboard.png)

File: 454d663ecdb95f3⋯.png (553.19 KB,560x543,560:543,Clipboard.png)

File: 2ad7431dd635200⋯.png (452.21 KB,427x590,427:590,Clipboard.png)

File: 492513293dbae93⋯.gif (966.31 KB,500x281,500:281,Clipboard.gif)

File: 2ad147384b48058⋯.png (634.12 KB,764x389,764:389,Clipboard.png)

Originally posted at >>>/qresearch/13938203 (191557ZJUN21) Notable: #176421, #176422

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937630, >>>/qresearch/13937829 DoughUpdate

Notables Are NOT Endorsements

#17642

>>65244, >>65270 After riding up an escalator, attendees at the Faith & Freedom Coalition’s annual Road to Majority conference met with a registration sign slapped with two additional labels: “Trump: Take America Back, 2024” and “Trump Store, Vendor Exhibits”…

>>65245 Georgia Democratic rockstars Stacey Abrams and Sen. Raphael Warnock have both made major reversals on their feelings about voter identification,

>>65246, >>65257 Consider counseling… "First on CNN: Biden administration moves to make gender confirmation surgery available through Veteran Affairs health care system"

>>65247 Muh Kunspiracy Kuntinues… Arizona 'audit' becomes far-right campaign stop, fuels conspiracy that election can be overturned

>>65248, >>65253 Juneteenth Recognition

>>65249, >>65251, >>65283

Spying is fun huh? Except when it happens to you eh? The National Security Agency has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans, according to a letter that I received from the NSA this afternoon, and that suggests a political fight between the two agencies.

>>65250, >>65254, >>65256 Dan FF-22 Raptor video decode? Last Time there was a FF… after a similar tweet. Stay Safe Friends.

>>65252 OTD 2020 DJT tweeting about [D]ACA… "They "punted" much like in a football game (where hopefully they would stand for our Great American Flag)."

>>65255, >>65261 DTM Tweets: Another short video - I NEED TRUMP BACK

>>65258, >>65252, >>65259 1 Year Delta Q4360 Review:Insurrection Act of 1807, [Determination that the various state and local authorities are not up to the task of responding to the growing unrest] Call the ball. Q

>>65260 FIN: DJT on vax comms clarification for normies and newbies

>>65262 Everyone wants a wall - The situation on the Belarusian border is still uncontrolled. This year, the flow of illegal migrants to Western Europe has increased fivefold through Lithuania alone. The Lithuanian authorities have even begun to consider erecting a fence on the border to strengthen the defense.

>>65263, >>65268, >>65272, >>65279, >>65281 'Suspicious' Object Prompting Brief Closure of CIA Headquarters Turned Out to be…Dog Collar Device

>>65264 Ebrahim Raisi sat on Ayatollah Ruhollah Khomeini’s ‘death committee’

>>65265,President Donald J. Trump, 45th President of the United States of America, will hold amajor rallyin Wellington, Ohio on Saturday, June 26, 2021 at 7:00PM EDT.

>>65266 PDJT: "I have accepted the invitation of Texas Governor Greg Abbott to join him on an official visit to our Nation’s decimated Southern Border on Wednesday, June 30, 2021".

>>65267 PDJT "Donald J. Trump is pleased to announce Liz Harrington, a strong Republican conservative voice for America and who has represented conservative policies so well over the years, as our new spokesperson for Save America and Donald J. Trump, 45th President of the United States of America. Liz will be taking the place of Jason Miller, who will be leaving to enter the private sector. "I greatly thank Jason for his service—he is outstanding!" said President Donald J. Trump."

>>65269 Explosion at a fireworks warehouse in Moscow. White Russian Smoke… WH COMMS?

>>65271 Tokyo Bugs? GPS watching of Journalists… Apparently Americans arent theonly ones untrusting of MSN… The president of the Tokyo Olympics, Seiko Hashimoto, announced on June 8 that international journalists will be tracked by GPS while they are in Japan. The International Federation of Journalists (IFJ) cries

>>65273 REVEALED: Google & USAID Funded Wuhan Collaborator Peter Daszak’s Virus Experiments For Over A Decade.

>>65274, >>65278 Multiple Individuals Pushed Stacks of Ballots through Tabulators Multiple Times in Georgia. This Is Illegal. Law Enforcement Did Nothing.

>>65275 Rhode Island Teachers Busted Offering Students Bonus Points to Defend Critical Race Theory at School Board Meetings

>>65276 June 18th Booms on the 19th? NAVY Tweets

>>65277,U.K. LEAK?Permanent Lockdowns? Preparation for Anti Lockdown Protests?

>>65279, >>65281 Our family lost our loving companion Champ today. I will miss him.

>>65280 Freedom Forever Scavino Facebook Easter Egg

>>65282, >>65284 PB Notable… Re: Mockingbird, Feds

#17642

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65286

File: efcd49e2673ab1b⋯.png (63.43 KB,871x498,871:498,Clipboard.png)

Originally posted at >>>/qresearch/13938216 (191600ZJUN21) Notable: NSA FBI Games Begin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13938194

>>65283

That populist press poster is a clickbait nigger.

Every link he uses is just a clickfarm placeholder for the legit source.

In this particular case, here is the OP/OG of that article:

https://lawflog.com/?p=2492&page=2

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65287

Originally posted at >>>/qresearch/13938219 (191602ZJUN21) Notable: Spy Games

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Top Chinese spy catcher Dong Jingwei warns agents to look out for those who collude with foreign forces

•The security chief tells agents they must hunt down ‘insiders’ who collude with anti-China forces and ‘those who bankroll them’

•Dong warns that infiltration and spying activity have been on the increase

https://www.scmp.com/news/china/politics/article/3137958/top-chinese-spy-catcher-dong-jingwei-warns-agents-look-out

https://archive.ph/za20X

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65288

File: 332e192dfa58012⋯.jpg (23.62 KB,400x400,1:1,Clipboard.jpg)

File: 54574d7ec2809c4⋯.jpg (44.4 KB,1280x720,16:9,Clipboard.jpg)

File: 6274254396c7c30⋯.jpg (370.2 KB,1080x2220,18:37,Clipboard.jpg)

Originally posted at >>>/qresearch/13938224 (191603ZJUN21) Notable: Sound Familiar? The government announced his victory on Saturday, a day after a vote that many Iranians skipped, viewing it as rigged.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13938166

Kamala

Amala

The government announced his victory on Saturday, a day after a vote that many Iranians skipped, viewing it as rigged.

https://www.nytimes.com/2021/06/19/world/middleeast/iran-election-president-raisi.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65289

File: c0323cefa4d42b3⋯.png (447.87 KB,780x578,390:289,Clipboard.png)

Originally posted at >>>/qresearch/13938226 (191603ZJUN21) Notable: Col. Scott Green, the director of the Army’s Command and General Staff School at Fort Leavenworth, Kansas, was found unresponsive in his office on Tuesday, and pronounced dead.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Wierd, Col. Green

https://www.military.com/daily-news/2021/06/19/army-investigating-death-of-colonel-found-unresponsive-fort-leavenworth.html

Col. Scott Green, the director of the Army’s Command and General Staff School at Fort Leavenworth, Kansas, was found unresponsive in his office on Tuesday, and pronounced dead.

Army Criminal Investigation Command special agents are investigating his death, according to a statement on the CGSS Facebook page.

Green, 49, had been in his current position since July of 2019.

The CGSS Facebook post included the following biographical details on Green's Army career.

A native of South Dakota, Green began his Army career in 1994 after completing an ROTC program at the South Dakota School of Mines and Technology in Rapid City, South Dakota.

As a career infantry officer, Green served in numerous leadership positions, including company command in the 75th Ranger Regiment, and command of a Brigade Combat Team (Airborne). He served for 27 years. He was a highly decorated combat veteran with multiple tours that included a combat parachute jump. His awards include the prestigious Army’s Legion of Merit and multiple Bronze Star Medals including one for valor.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65290

File: b56d72b9cd19e84⋯.png (839.52 KB,1565x807,1565:807,Clipboard.png)

File: a0dea943da1d649⋯.jpg (71.59 KB,1059x790,1059:790,Clipboard.jpg)

Originally posted at >>>/qresearch/13938227 (191603ZJUN21) Notable: New Docuseries Suggests Jeffrey Epstein Was a Government Informant

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thedailybeast.com/new-docuseries-suggests-jeffrey-epstein-was-a-government-informant?ref=home

T.V.

New Docuseries Suggests Jeffrey Epstein Was a Government Informant

THE PLOT THICKENS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65291

File: 7506f9dfd9ab488⋯.png (6.4 MB,3600x3900,12:13,Clipboard.png)

Originally posted at >>>/qresearch/13938236 (191604ZJUN21) Notable: A Qlock Suddenly Appears

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937760

1:07

On here.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65292

File: b850cc87d054d44⋯.png (266.44 KB,857x661,857:661,Clipboard.png)

Originally posted at >>>/qresearch/13938287 (191612ZJUN21) Notable: Amazing New Website Confirms YouTube Is Suppressing Dislikes on Joe Biden Videos by as Much as 600%

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/amazing-new-website-confirms-youtube-suppressing-dislikes-joe-biden-videos-much-600/

Amazing New Website Confirms YouTube Is Suppressing Dislikes on Joe Biden Videos by as Much as 600%

By Jim Hoft

Published June 19, 2021 at 11:05am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65293

File: a65205cb5c38fd6⋯.png (49.25 KB,465x311,465:311,Clipboard.png)

Originally posted at >>>/qresearch/13938292 (191613ZJUN21) Notable: On #Juneteenth we commemorate the moment the order, “All Slaves are Free”, ushered in Emancipation. We remember the millions of African Americans who suffered the evils of slavery & we cherish their countless contributions that have enriched every facet of American life.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Mike Pence

@Mike_Pence

On #Juneteenth we commemorate the moment the order, “All Slaves are Free”, ushered in Emancipation. We remember the millions of African Americans who suffered the evils of slavery & we cherish their countless contributions that have enriched every facet of American life.

11:04 AM · Jun 19, 2021·Twitter for iPhone

https://twitter.com/Mike_Pence/status/1406266684235784201

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65294

File: b4d174899859236⋯.png (782.87 KB,871x723,871:723,Clipboard.png)

Originally posted at >>>/qresearch/13938298 (191614ZJUN21) Notable: Illinois Town Holds Juneteenth and Pride Parades… Cancels Fourth of July Parade and Fireworks

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/illinois-town-holding-juneteeth-pride-parades-cancelled-fourth-july-parade-fireworks/

Illinois Town Holds Juneteenth and Pride Parades… Cancels Fourth of July Parade and Fireworks

By Cassandra Fairbanks

Published June 19, 2021 at 11:00am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65295

File: 5131d42999cf0b9⋯.png (149.67 KB,572x306,286:153,Clipboard.png)

Originally posted at >>>/qresearch/13938306 (191615ZJUN21) Notable: On #Juneteenth we commemorate the moment the order, “All Slaves are Free”, ushered in Emancipation. We remember the millions of African Americans who suffered the evils of slavery & we cherish their countless contributions that have enriched every facet of American life.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65293

How about the 40.3 million slaves in the world today?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65296

File: 223c4a8f446bc11⋯.png (296.45 KB,1029x700,147:100,Clipboard.png)

Originally posted at >>>/qresearch/13938318 (191617ZJUN21) Notable: REVEALED: Google & USAID Funded Wuhan Collaborator Peter Daszak’s Virus Experiments For Over A Decade.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

REVEALED: Google & USAID Funded Wuhan Collaborator Peter Daszak’s Virus Experiments For Over A Decade.

Google funded research conducted by Peter Daszak’s EcoHealth Alliance – a controversial group which has openly collaborated with the Wuhan Institute of Virology on “killer” bat coronavirus research – for over a decade, The National Pulse can today reveal.

The unearthed financial ties between EcoHealth Alliance and Google follow months of big tech censorship of stories and individuals in support of the COVID-19 “lab leak” theory.

The Google-backed EcoHealth Alliance played a critical role in the cover-up of COVID-19’s origins through its president, Peter Daszak.

Daszak served on the wildly compromised World Health Organization’s (WHO) COVID-19 investigation team. He championed the efforts to “debunk” the lab origin theory of the virus, despite mounting support for the claim first made by experts on Steve Bannon’s War Room: Pandemic podcast in early January 2020.

Left-wing websites masquerading as “fact checkers” still call the lab theory “false,” despite the shift in tone from the Biden regime, leading world scientists, and intelligence officials.

EcoHealth Alliance also funneled hundreds of thousands of U.S. taxpayer dollars from Dr. Anthony Fauci’s National Institute of Allergy and Infectious Diseases (NIAID) to its research partner, the Wuhan Institute of Virology, to conduct studies on “killer” bat coronaviruses.

And Google.org, the charity arm of the tech behemoth, has also been funding studies carried out by EcoHealth alliance researchers including Peter Daszak since at least 2010.

‘The Generous Support of the American People’.

The decade-plus relationship is evident in a 2010 study on bat flaviviruses, which lists Daszak and EcoHealth Alliance Vice President Jonathan Epstein as authors, that thanks Google.org for funding. A 2014 study on henipavirus spillover, which was authored by Daszak, similarly declares it was partly “supported by Google.org.”

And a 2015 paper focusing on herpes, which lists EcoHealth’s Daszak and Epstein as authors, reveals it was “supported by funding from the US Agency for International Development’s Emerging Pandemic Threats: PREDICT program, the Skoll Foundation, and Google.org.”

The 14-page paper’s abstract summarizes:

We report on a study conducted in Guangdong Province, China, to characterize behaviors and perceptions associated with transmission of pathogens with pandemic potential in highly exposed human populations at the animal-human interface. A risk factor/exposure survey was administered to individuals with high levels of exposure to wildlife.

The paper appears to lay the groundwork for the theory that SARS-like coronaviruses could originate in a wet market in a province close to the city of Wuhan – the likely epicenter of COVID-19.

MORE AT

https://thenationalpulse.com/exclusive/google-funded-wuhan-linked-ecohealth-research/

https://archive.is/WtdEH

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65297

Originally posted at >>>/qresearch/13938323 (191618ZJUN21) Notable: On #Juneteenth we commemorate the moment the order, “All Slaves are Free”, ushered in Emancipation. We remember the millions of African Americans who suffered the evils of slavery & we cherish their countless contributions that have enriched every facet of American life.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65295

Muslims and Chinese make the money off modern slavery. They own the media.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65298

File: 76facebf4ff94ed⋯.jpg (125.47 KB,720x886,360:443,Clipboard.jpg)

File: 73e1671de6e5fd9⋯.jpg (153.54 KB,1200x800,3:2,Clipboard.jpg)

Originally posted at >>>/qresearch/13938328 (191618ZJUN21) Notable: Nothing to see here… Manhattan City Council candidate caught with dominatrix in leaked video

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/nypost/status/1406283743334223874?s=19

Manhattan City Council candidate caught with dominatrix in leaked video

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65299

File: 5a426d403a68c89⋯.png (354.84 KB,359x446,359:446,Clipboard.png)

File: 794235974cc81ff⋯.jpeg (492.07 KB,1241x1770,1241:1770,Clipboard.jpeg)

Originally posted at >>>/qresearch/13938330 (191619ZJUN21) Notable: Patriots or Pinheads? PINHEAD

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/sailinjackvip/status/1405579823729168384?s=20

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65300

File: d6916f8838e9ed5⋯.png (291.98 KB,647x434,647:434,Clipboard.png)

Originally posted at >>>/qresearch/13938332 (191619ZJUN21) Notable: Nothing to see here… Manhattan City Council candidate caught with dominatrix in leaked video

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://nypost.com/2021/06/19/nyc-council-candidate-caught-with-dominatrix-in-leaked-bdsm-video/?utm_campaign=SocialFlow&utm_medium=SocialFlow&utm_source=NYPTwitter

Manhattan City Council candidate caught with dominatrix in leaked video

By Jon LevineJune 19, 2021 | 12:09p

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65301

Originally posted at >>>/qresearch/13938353 (191621ZJUN21) Notable: #176421, #176422

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13937630, >>>/qresearch/13937829 DoughUpdate

Notables Are NOT Endorsements

#17642

>>65285 #17642

Notables Are NOT Endorsements

#17642

>>65286 NSA FBI Games Begin

>>65287 Spy Games

>>65288 Sound Familiar? The government announced his victory on Saturday, a day after a vote that many Iranians skipped, viewing it as rigged.

>>65289 Col. Scott Green, the director of the Army’s Command and General Staff School at Fort Leavenworth, Kansas, was found unresponsive in his office on Tuesday, and pronounced dead.

>>65290 New Docuseries Suggests Jeffrey Epstein Was a Government Informant

>>65291 A Qlock Suddenly Appears

>>65292 Amazing New Website Confirms YouTube Is Suppressing Dislikes on Joe Biden Videos by as Much as 600%

>>65293, >>65295, >>65297 On #Juneteenth we commemorate the moment the order, “All Slaves are Free”, ushered in Emancipation. We remember the millions of African Americans who suffered the evils of slavery & we cherish their countless contributions that have enriched every facet of American life.

>>65294 Illinois Town Holds Juneteenth and Pride Parades… Cancels Fourth of July Parade and Fireworks

>>65296 REVEALED: Google & USAID Funded Wuhan Collaborator Peter Daszak’s Virus Experiments For Over A Decade.

>>65299 Patriots or Pinheads? PINHEAD

>>65298, >>65300 Nothing to see here… Manhattan City Council candidate caught with dominatrix in leaked video

#176422

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65302

File: c332a28e6a378c4⋯.png (80.36 KB,604x668,151:167,Clipboard.png)

Originally posted at >>>/qresearch/13938437 (191633ZJUN21) Notable: Hopefully there is miner commission?: A huge diamond weighing more than 1,000 carats, which could be the third-largest mined in history, has been discovered in the southern African country of Botswana.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Glowing discovery: A huge diamond weighing more than 1,000 carats, which could be the third-largest mined in history, has been discovered in the southern African country of Botswana.

https://twitter.com/AP_Oddities/status/1406288433149009921

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65303

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13938477 (191642ZJUN21) Notable: Child stealing networks operate worldwide. They frequently prey on indigenous populations living in remote areas of third world countries. This witness describes what he saw in the Guatemalan Highlands.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Child stealing networks operate worldwide. They frequently prey on indigenous populations living in remote areas of third world countries.

This witness describes what he saw in the Guatemalan Highlands.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65304

Originally posted at >>>/qresearch/13938485 (191643ZJUN21) Notable: Every Single Year? California's Willow Fire spreads to 2,000 acres as record drought, heat continue to grip state

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Every. Single. Year.

California's Willow Fire spreads to 2,000 acres as record drought, heat continue to grip state

California's Willow Fire exploded overnight, jumping from 750 acres on Friday afternoon to 2,000 acres early Saturday morning.

The blaze, located in Los Padres National Forest near Monterey County's Big Sur, began Thursday night shortly at 8:10 p.m. PT.

More than 300 firefighters from multiple agencies responded to fight the fire, fueled by chaparral, tall grass and brush and rugged and steep terrain.

In a tweet, the Los Padres National Forest's U.S. Forest Service account said the Willow Fire was 0% contained as hot and dry weather and an increase in winds pushed the fire in the Ventana Wilderness towards the Arroyo Seco Recreation Area close to the Tassajara Zen Center and Hot Springs.

In a description of the incident, the Los Padres National Forest's U.S. Forest Service said that spotting and runs were expected to increase the growth of the fire and detailed state and local response,

"There are approximately 337 firefighters on the ground including 5 Type I Interagency Hotshot crews assigned to the fire. Air support including fixed-wing air tankers and water-dropping helicopters are assisting crews on the ground," the agency wrote, noting that temperatures around the fire had hovered around 100 degrees Fahrenheit with low humidity levels and winds of 5 to 10 mph with gusts of up to 20 mph.

According to SFGate, the fire also emitted a large pyrocumulus cloud that rose up to 14,000 feet above ground level.

Video of the smoke plume was posted on the National Weather Service's Bay Area Twitter account.

Residents in the surrounding area were reportedly evacuated to China Camp and evacuation warnings were issued for areas north of Arroyo Seco Campground to Anastasia Canyon, west of Carmel Valley Rd. and east of Tassajara Rd.

Road closures were also announced nearby.

The cause of the fire remains unknown.

California and much of the western U.S. are in the midst of both a sweltering heatwave and are threatened by a historic drought.

The Golden State's Democratic Gov. Gavin Newsom issued emergency orders to address both issues as images showed critical reservoirs were almost barren.

Nearby, Arizona's San Carlos Reservoir – located in between the state capital of Phoenix and Tucson – was reportedly also in trouble as firefighters in the Grand Canyon State also worked to fend off fires amidst record-breaking heat.

more

https://www.yahoo.com/news/california-apos-willow-fire-spreads-145725011.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65305

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13938486 (191643ZJUN21) Notable: REPOST - CNN VIDEO ON SNOWDEN BEING HUNTED BY THE Q GROUP FROM 11TH JUNE 2013 ARCHIVED, DROPPED BY AN ANON !!!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13938386

TYB

REPOST, NOTABRUH

CNN VIDEO ON SNOWDEN BEING HUNTED BY THE Q GROUP FROM 11TH JUNE 2013 ARCHIVED, DROPPED BY AN ANON !!!

=========

Manhunt underway for NSA leaker

28,097 views•11 Jun 2013

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65306

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13938503 (191646ZJUN21) Notable: Revolver News: Unindicted Co-Conspirators raises questions for FBI 1/6 events The Duran: Episode 1008

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Revolver News: Unindicted Co-Conspirators raises questions for FBI 1/6 events

Jun 19, 2021

The Duran

147K subscribers

Revolver News: Unindicted Co-Conspirators raises questions for FBI 1/6 events

The Duran: Episode 1008

https://youtu.be/26qqKktUYNs

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65307

File: 5f5e97acdbb0776⋯.png (1.24 MB,1913x999,1913:999,Clipboard.png)

Originally posted at >>>/qresearch/13938506 (191646ZJUN21) Notable: PF Report?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13938235 lb

Our family lost our loving companion Champ today. I will miss him. "Catch our grandchildren as they ran around the backyard in Delaware"

>>>/qresearch/13936545 pb

>>>/qresearch/13936550

Callsign 0

Out of McGuire air force base looping over the Delaware in an anti clockwise oblong circles…?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65308

Originally posted at >>>/qresearch/13938524 (191649ZJUN21) Notable: Secretary of State Brad Raffensperger on Friday made public the names of nearly 102,000 people who are at risk of having their Georgia voter registrations canceled, a warning before they lose their ability to vote next month. (Election Law Blog.org)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://electionlawblog.org/?p=122724

Secretary of State Brad Raffensperger on Friday made public the names of nearly 102,000 people who are at risk of having their Georgia voter registrations canceled, a warning before they lose their ability to vote next month.

The mass cancellations, called voter “purges” by their critics, target registered voters who moved or didn’t participate in elections for several years.

Fewer voter registrations are being canceled this year than in 2017, when 534,000 were eliminated from Georgia’s voter rolls during the largest removal of registrations in U.S. history. Most of the state’s outdated registrations were already canceled in prior years.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65309

File: 4832fdb2823caba⋯.jpg (36.93 KB,640x446,320:223,Clipboard.jpg)

File: d7ebe11e4f3a109⋯.png (612.77 KB,800x400,2:1,Clipboard.png)

Originally posted at >>>/qresearch/13938528 (191650ZJUN21) Notable: Faggots and satanism ID:4e7deb

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dalai Lama and Magic in Politics

Since time immemorial ritual magic and politics have been one in Tibet. A large proportion of these magic practices are devoted to the annihilation of enemies, and especially to the neutralizing of political opponents. The help of demons was necessary for such ends. And they could be found everywhere — the Land of Snows all but overflowed with terror gods, fateful spirits, vampires, ghouls, vengeful goddesses, devils, messengers of death and similar entities, who, in the words of Matthias Hermanns, “completely overgrow the mild and goodly elements [of Buddhism] and hardly let them reveal their advantages” (Hermanns, 1965, p. 401).

For this reason, invocations of demons were not at all rare occurrences nor were they restricted to the spheres of personal and family life. They were in general among the most preferred functions of the lamas. Hence, “demonology” was a high science taught at the monastic universities, and ritual dealings with malevolent spirits were — as we shall see in a moment — an important function of the lamaist state.

Awaken to this evil, 3, 2, 1

For the demons to appear they have to be offered the appropriate objects of their lust as a sacrifice, each class of devil having its own particular taste. René von Nebesky-Wojkowitz describes a number of culinary specialties from the Lamaist “demon recipe books”: cakes made of dark flour and blood; five different sorts of meat, including human flesh; the skull of the child of an incestuous relationship filled with blood and mustard seeds; the skin of a boy; bowls of blood and brain; a lamp filled with human fat with a wick made of human hair; and a dough like mixture of gall, brain, blood and human entrails (Nebesky-Wojkowitz, 1955, p. 261).

Once the gods had accepted the sacrifice they stood at the ritual master’s disposal. The four-armed protective deity, Mahakala, was considered a particularly active assistant when it came to the destruction of enemies. In national matters his bloodthirsty emanation, the six-handed Kschetrapala, was called upon. The magician in charge wrote the war god’s mantra on a piece of paper in gold ink or blood from the blade of a sword together with the wishes he hoped to have granted, and began the invocation.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65310

File: 1565afe93be9799⋯.png (199.96 KB,442x831,442:831,Clipboard.png)

Originally posted at >>>/qresearch/13938545 (191654ZJUN21) Notable: Anyone in Technology knows this is all bullshit the way it's dragging… Ken tells John Fredericks that they are still waiting on the passwords and the router logs from the slimy Maricopa County Supervisors. The audit team is unable to get past a partition on the 385 tabulator machines without a second password. The Supervisors’ excuse that sensitive health and social security data contained on the router logs prevents them from granting access is ludicrous, Ken points out.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Arizona Conservatives Take Action, [19.06.21 10:34]

Ken Bennett Update on the Arizona Audit June 17

Ken tells John Fredericks that they are still waiting on the passwords and the router logs from the slimy Maricopa County Supervisors. The audit team is unable to get past a partition on the 385 tabulator machines without a second password. The Supervisors’ excuse that sensitive health and social security data contained on the router logs prevents them from granting access is ludicrous, Ken points out.

Although the Coliseum portion of the audit will wrap up at the end of this month, the team will still have several more weeks of work to confirm that envelopes had signatures, review voter registration anomalies (canvassing), complete the analysis of the machines, and possibly do another vote tabulation using the ballot images. Ken expects the results report to be released a few weeks after all of that work is complete, likely in August. No mention of an interim hand count update.

Watch 👉🔗 Arizona Conservatives (https://m.youtube.com/watch?v=32CwLdlSKoY)

Read 👉🔗 TGP Summary (https://www.thegatewaypundit.com/2021/06/watch-maricopa-audit-liaison-says-need-investigate-anomalies-like-52-ballots-submitted-two-bedroom-home/)

https://t.me/ArizonaConservatives/2116

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65311

Originally posted at >>>/qresearch/13938557 (191657ZJUN21) Notable: Canadian authority warns operators over 5G risk to radio altimeters…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Canadian authority warns operators over 5G risk to radio altimeters

Canadian authorities are warning operators of the potential risk of interference to radio altimeters arising from 5G communications networks, following auction of part of the frequency spectrum.

The country’s spectrum regulator, ISED, is auctioning the 3.45-3.65GHz band during June and will allow mobile wireless systems to operate in the adjacent 3.65-4GHz band in 2023.

https://www.flightglobal.com/safety/canadian-authority-warns-operators-over-5g-risk-to-radio-altimeters/144229.article

https://archive.ph/NJtkb

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65312

File: ca87815607d61ae⋯.png (92.96 KB,457x585,457:585,Clipboard.png)

Originally posted at >>>/qresearch/13938564 (191658ZJUN21) Notable: LW Telegrams: Simple truths are simple truth. Simple truth: If the shoe fits, wear it. What is the punishment for treason?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [19.06.21 08:34]

Simple truths are simple truth.

Simple truth: If the shoe fits, wear it.

What is the punishment for treason?

https://populist.press/pence-gets-exactly-what-he-deserves-on-stage-watch/

Pence Gets What He Deserves On Stage | Populist Press 2021 ©

Pence gets drowned out by heck­lers at the Faith & Free­dom Coali­tion sum­mit, some of whom appear to be chant­i­ng “trai­tor!” pic.twitter.com/pAQxavsK3O — Andrew Solen­der (@AndrewS

https://t.me/linwoodspeakstruth/3294

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65313

File: 5ed71074d4cd404⋯.png (53.7 KB,466x403,466:403,Clipboard.png)

Originally posted at >>>/qresearch/13938570 (191659ZJUN21) Notable: LW Telegrams: Simple truths are simple truth. Simple truth: If the shoe fits, wear it. What is the punishment for treason?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [19.06.21 12:26]

Telegram has been suppressing the numbers of my followers and replies on my Reply Channel for several months.

Feels just like Twitter before Hit The Road Jack kicked me off. On Twitter, it was referred to as shadow banning.

How do you feel about Telegram suppressing speech? I thought Telegram assured us it would not do so.

Maybe Telegram needs to hear from We The People.

https://t.me/Reply_To_Lin_Wood

Lin Wood claims telegram is supressing his number of followers and replies like twitter

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65314

File: 9fe321f48c96816⋯.mp4 (1.83 MB,960x540,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13938578 (191702ZJUN21) Notable: LW Telegrams: Simple truths are simple truth. Simple truth: If the shoe fits, wear it. What is the punishment for treason?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

June 18, 2021

Pence gets drowned out by heck­lers at the Faith & Free­dom Coali­tion sum­mit, some of whom appear to be chant­i­ng “trai­tor!”pic.twitter.com/pAQxavsK3O

— Andrew Solen­der (@AndrewSolender) June 18, 2021

https://twitter.com/AndrewSolender/status/1405928997880533003

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65315

File: c13e03e97e10b75⋯.png (206.12 KB,601x664,601:664,Clipboard.png)

Originally posted at >>>/qresearch/13938596 (191707ZJUN21) Notable: The Space Shuttle Challenger crew likely survived the explosion on board until their capsule plunged into the Atlantic Ocean, according to a new book about the 1983 disaster…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The Space Shuttle Challenger crew likely survived the explosion on board until their capsule plunged into the Atlantic Ocean, according to a new book about the 1983 disaster.

https://twitter.com/newsmax/status/1406297072123273219

I thought everyone knew this

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65316

File: 8a34a9539c63e8b⋯.png (1017.31 KB,900x614,450:307,Clipboard.png)

File: f804833fe63dac6⋯.png (215.91 KB,500x289,500:289,Clipboard.png)

Originally posted at >>>/qresearch/13938604 (191709ZJUN21) Notable: The Space Shuttle Challenger crew likely survived the explosion on board until their capsule plunged into the Atlantic Ocean, according to a new book about the 1983 disaster…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65315

>Space Shuttle Challenger crew

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65317

File: 3920b3d0464ce52⋯.png (228.48 KB,426x450,71:75,Clipboard.png)

File: e05f1217b78acd8⋯.jpg (101.71 KB,890x467,890:467,Clipboard.jpg)

File: e62e91981608dd8⋯.png (6.51 MB,2439x1208,2439:1208,Clipboard.png)

Originally posted at >>>/qresearch/13938613 (191711ZJUN21) Notable: The Space Shuttle Challenger crew likely survived the explosion on board until their capsule plunged into the Atlantic Ocean, according to a new book about the 1983 disaster…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65315

The Space Shuttle Challenger crew survived, surprise!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65318

File: 9c5a1f3ee35f7fe⋯.png (426.88 KB,604x725,604:725,Clipboard.png)

Originally posted at >>>/qresearch/13938626 (191714ZJUN21) Notable: What's the REAL, hidden story behind your patch? What does your patch mean? Who designed it? What do the colors represent? +

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

What's the REAL, hidden story behind your patch? What does your patch mean? Who designed it? What do the colors represent?

Well, you can stop asking.

Next week, 18th Airborne Corps Patch WeekTrade mark sign, we answer the big questions and tell you the story behind your patch.

https://twitter.com/18airbornecorps/status/1406295719804293120

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65319

File: 23f8384d9b998b7⋯.png (217.29 KB,599x371,599:371,Clipboard.png)

File: 551e9de0d766511⋯.png (503.17 KB,1264x788,316:197,Clipboard.png)

File: 6a99cfb627efd91⋯.png (493.75 KB,1243x790,1243:790,Clipboard.png)

Originally posted at >>>/qresearch/13938661 (191719ZJUN21) Notable: LB Repost - Amazing New Website Confirms YouTube Is Suppressing Dislikes on Joe Biden Videos by as Much as 600%

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Amazing New Website Confirms YouTube Is Suppressing Dislikes on Joe Biden Videos by as Much as 600%

There is a relatively new website that tracks the popularity of Joe Biden’s video channel — the same man that smashed all US records and received 81 million votes in the 2020 election while campaigning from his basement.

The website tracks the YouTube page of Joe Biden’s White House. And after several weeks of results can confirm that far-left YouTube is suppressing the dislikes on Joe Biden’s videos.

In fact the dislikes on the White House YouTube page are being manipulated on every single Joe Biden White House video!

EVERY SINGLE ONE!

Here is how this is proven, via the 81m.org website:

It is true that Biden won the most votes cast for a U.S. presidential candidate, amassing about 81 million votes.

– USA Today

Such a popular president should have some truly epic YouTube numbers. Let’s keep track. I’m sure we won’t see anything weird happening, such as dislikes being thrown out in the wee hours of the morning.

Verifying the accuracy of the data

I encourage visitors to this site, especially reporters, to verify the deletion phenomenon for themselves. To do so, go to the official White House YouTube channel and find a new video that is a few hours old. Click on the video and go to its page. Take a screenshot of the likes and dislikes, being sure that your computer’s/phone’s clock is visible in the screenshot (example). Once per hour, come back to the page, reload it so that the newest totals appear, and take another screenshot. Do that over the course of the day, and you will almost certainly see that YouTube deletes dislikes repeatedly. Check back the next day, and you will see the deletions continuing throughout that day as well. Finally, check your screenshots against the video’s chart at 81m.org (based on the timestamp in each of your screenshots), and you will see that the two data sources, your screenshots and my charts, line up for the official likes and dislikes. (There might be small discrepancies due to our respective samples being taken a few minutes apart.)

If you want to go further:

My real likes and real dislikes stats are simply computed from all the increases to likes/dislikes (but ignoring decreases). You can check the arithmetic in the “Last … stats” table on each video page at 81m.org. You can download the full data on each page as CSV, TSV, or JSON files if you want to do your own charting. Also note that my real likes and real dislikes statistics almost always line up very closely for the videos in the comparison data, like those by PewDiePie.

And here are several examples on how YouTube is lying to their consumer and assisting Joe Biden.

YouTube is suppressing dislikes of Biden by as much as 600% on some videos.

Do you think they ever gave this same benefit to President Trump?

YouTube is deleteing up to 650% of all downvotes on Joe Bidens videos.

The website shows Biden gets only a paltry few thousands viewers per video.

This confirms what we all know is fact — The tech elites are lying to the American public and Joe Biden is extremely unpopular.

https://www.thegatewaypundit.com/2021/06/amazing-new-website-confirms-youtube-suppressing-dislikes-joe-biden-videos-much-600/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65320

Originally posted at >>>/qresearch/13938680 (191722ZJUN21) Notable: Happy Father's Day! Father of 8 was set to get 2nd vaccine dose, but contracted COVID-19 and died (Of Course!)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BULLSHIT.

He died of the SHOT.

Father of 8 was set to get 2nd vaccine dose, but contracted COVID-19 and died

This Father's Day will be an especially difficult one for many of the more than 600,000 American families mourning the death of a loved one to COVID-19.

Among those is the Ballard family in North Carolina, grappling with the loss of their patriarch.

Gordon Ballard, a devoted husband and father of eight who pushed through a lifelong illness to provide for his family, died of COVID-19 on May 17, 2021, his daughter said.

The 65-year-old tested positive two weeks earlier, on May 3 – the same day he was set to get his second vaccine dose.

more

https://www.yahoo.com/gma/father-8-set-2nd-vaccine-140641747.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65321

File: e2852c61afccc7e⋯.png (473.56 KB,751x668,751:668,Clipboard.png)

Originally posted at >>>/qresearch/13938690 (191724ZJUN21) Notable: How to ease the idea in… Tori Spelling has admitted that she is currently co-sleeping with four of her children. They make up words to normalize perversion…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Tori Spelling has admitted that she is currently co-sleeping with four of her children.

they make up words to normalize perversion

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65322

Originally posted at >>>/qresearch/13938712 (191726ZJUN21) Notable: Boris Epshteyn: Subpoenas Are Being Prepared in Pennsylvania for Another Audit

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Boris Epshteyn: Subpoenas Are Being Prepared in Pennsylvania for Another Audit

Former Special Assistant to President Trump Boris Epshteyn joined Steve Bannon and The War Room on Friday.

During their discussion on America’s Audit in Arizona, Epshtyn dropped this bomb!

Boris Epshteyn: Subpoenas are needed and necessary and it’s time for these elected Republicans to step fully up. And that’s exactly what I’m hearing is happening in Pennsylvania as soon as the the next 48 business hours. I believe that the subpoenas are being prepared as we speak and maybe dropping as soon as next week – again for a full Arizona level audit in several counties in Pennsylvania. Keep in mind, and we need to be very clear on this. We called it Arizona audit because it sounds good, right? But this is actually the Maricopa County audit.

https://www.thegatewaypundit.com/2021/06/boris-epshteyn-subpoenas-prepared-pennsylvania-another-audit-video/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65323

Originally posted at >>>/qresearch/13938730 (191729ZJUN21) Notable: How Many dead VOTERS Voted In Georgia?! Raffensperger Cleans Voter Rolls AFTER Fraudulent Election

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

How Many dead VOTERS Voted In Georgia?! Raffensperger Cleans Voter Rolls AFTER Fraudulent Election

John Solomon and Just the News reported that more than 100,000 Georgians are set to be removed from the state’s voter registration rolls unless they act in a timely manner.

Breaking: Georgia Secretary of State to remove 100K names from state voter rolls | Just The News https://t.co/qRN7u2sGg1

— John Solomon (@jsolomonReports) June 19, 2021

Critics are calling this a voter purge.

Most of these invalid voters submitted change of address forms to the post office. For some, mail that was sent to their listed residences was returned. More than 18,000 were removed because they are dead.

Different groups including Atlanta’s NAACP are watching this move closely for disenfranchisement.

Brad Raffensperger has been taking heat for his role in the fraudulent Georgia election and still refuses to hold an audit.

How many of these 18,000+ dead registered voters cast a ballot while dead in 2020?

How many of these 100,000 + voters were phantom voters in 2020?

Raffensperger said, “You need to have accurate voter rolls and proper list maintenance. It also helps your county election directors.” But the corrupt Secretary of State refuses to hold a full forensic audit to ensure the rolls were accurate, maintained and that no fraud occurred.

Trump “lost” Georgia by 11,779 votes.

How many dead voters voted for Joe Biden in 2020?

https://www.thegatewaypundit.com/2021/06/many-dead-voters-voted-georgia-raffensperger-cleans-voter-rolls-fraudulent-election/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65324

File: 9510cbae27f8fa8⋯.png (136.57 KB,449x300,449:300,Clipboard.png)

File: 318263b45f808ba⋯.png (360.3 KB,524x631,524:631,Clipboard.png)

File: 3668031151110f0⋯.png (145.92 KB,515x622,515:622,Clipboard.png)

Originally posted at >>>/qresearch/13938752 (191732ZJUN21) Notable: Obama/Biden Chief Diversity Officer Who Compared President Trump to Hitler Is Reinstated After Investigation Finds No Issue with His Tweets

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Obama/Biden Chief Diversity Officer Who Compared President Trump to Hitler Is Reinstated After Investigation Finds No Issue with His Tweets

Biden’s sick and disgusting ‘Chief Diversity Officer’ in the military, Richard Torres-Estrada, is reinstated to his position. The Biden gang, which is trying to make our military worthless, weak and woke, is happy again.

Here is one of Torres-Estrada’s tweets:

Then a few days later we reported that Torres-Estrada was reassigned pending investigation:

The Daily Caller reported yesterday:

The US Special Operations Command reinstated its head of diversity on Thursday after an investigation concluded he did not violate any Defense Department policies in a series of controversial Facebook posts.

Richard Torres-Estrada was named Chief of Diversity & Inclusion for the Defense Department’s US Special Operations Command (USSOCOM) in March, but was reassigned pending an investigation into his social media activity, which included a post comparing then-president Donald Trump to Adolf Hitler.

The investigation found that Torres-Estrada’s posts violated no Defense Department (DoD) policies and he could return to his job, Military Times reported Thursday.

“Mr. Torres-Estrada has resumed the duties of the Chief of Diversity & Inclusion for United States Special Operations Command after a USSOCOM commander-directed investigation into the circumstances surrounding his hiring concluded and found no violations of law or DoD regulation,” USSOCOM spokesman Ken McGraw told the Daily Caller News Foundation in a statement Friday.

This is another sick, outrageous move coming from the sick outrageous Obama/Biden gang.

https://www.thegatewaypundit.com/2021/06/obama-biden-chief-diversity-officer-compared-president-trump-hitler-reinstated-investigation-shows-no-problem-tweets/

https://www.thegatewaypundit.com/2021/06/obama-biden-chief-diversity-officer-compared-president-trump-hitler-reinstated-investigation-shows-no-problem-tweets/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65325

File: 06c25bb7c024900⋯.png (46.13 KB,558x350,279:175,Clipboard.png)

Originally posted at >>>/qresearch/13938761 (191734ZJUN21) Notable: …1 killed & 11 injured after helicopter carrying ballot boxes crashes in Iran – media

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

1 killed & 11 injured after helicopter carrying ballot boxes crashes in Iran – media

A helicopter transporting ballots cast during Iran’s presidential election has crashed, resulting in one fatality and nearly a dozen injuries, according to media reports.

The accident occurred in the country's southwestern Khuzestan Province. The person killed in the crash was a police officer tasked with guarding the ballot boxes, the province's governor, Qasem Soleimani Dashtaki, told IRNA news agency.

A photo posted on Iranian news site Khabar Online shows emergency workers at the scene of the crash. The helicopter was missing its propeller and appeared to be badly damaged.

Those who were injured were transported to the hospital, with several in critical condition, Dashtaki was quoted as saying.

Iranians went to the polls on Friday to vote for a new president. Hardline cleric Ebrahim Raisi was declared the winner on Saturday after around 90% of ballots were counted, in what has been described as a landslide victory.

https://www.rt.com/news/527037-helicopter-crash-iran-ballot-boxes/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65326

File: 535f6e3c142df41⋯.jpeg (50.86 KB,484x304,121:76,Clipboard.jpeg)

Originally posted at >>>/qresearch/13938770 (191735ZJUN21) Notable: What's the REAL, hidden story behind your patch? What does your patch mean? Who designed it? What do the colors represent? +

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65318

Spearhead

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65327

File: 310298c8057ac6c⋯.png (278.55 KB,855x505,171:101,Clipboard.png)

File: 3aaabf0f48ccd3b⋯.png (280.49 KB,888x882,148:147,Clipboard.png)

Originally posted at >>>/qresearch/13938773 (191736ZJUN21) Notable: …1 killed & 11 injured after helicopter carrying ballot boxes crashes in Iran – media

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65325

Hardline Cleric Ebrahim Raisi Wins Iran Presidential Election By A Landslide

update(9:32am): Iran’s hardline candidate Ebrahim Raisi, who is the conservative head of the judiciary and considered a close ally of the Ayatollah, has been announced the winner of the Islamic Republic's presidential election.

Iran state media is calling it a landslide also as international reports spotlight the very low voter turnout. Iran's PressTV writes of the results: "According to preliminary results, with around 90% of the votes counted, Raeisi garnered over 17.8 million votes, followed by Mohsen Rezaei who secured 3.3 million."

https://www.zerohedge.com/geopolitical/low-turnout-iran-election-3-out-4-presidential-candidates-are-islamic-hardliners

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65328

Originally posted at >>>/qresearch/13938777 (191737ZJUN21) Notable: Shenzhen Airport Cancels Hundreds Of Flights Amid New COVID Cases

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Shenzhen Airport Cancels Hundreds Of Flights Amid New COVID Cases

The southern coastal province of Guangdong appears to be the epicenter of new coronavirus cases as Shenzhen airport has canceled hundreds of flights and tightened entry controls.

Shenzhen health officials said a restaurant employee at Shenzhen Baoan International Airport had been infected with the "Delta strain, a variant described as fast-spreading, with a high viral load and a short incubation period," according to South China Morning Post.

The woman tested positive during a test for airport staff conducted Thursday, according to health officials.

China on Friday reported 30 new infections, including six local transmissions in the southern province of Guangdong, where Shenzhen is located.

As we've noted, infections at neighboring Yantian International Container Terminal, a deepwater port in Shenzhen, about an hour east of the airport, has been operating at 40% capacity after a recent surge in infections. This has resulted in significant port congestion. The world's largest container line, Maersk, warned last week congestion at Yantian is worse than the shutdown of the Suez Canal in March.

Data from flight tracker VariFlight shows 400 inbound and outbound flights were canceled Friday. More are expected Saturday.

Chen Bin, deputy director of Guangzhou's health commission, said there was still an elevated threat of a community outbreak. He warned against an easing of lockdown measures and said residents in locked-down areas would be tested regularly to prevent a spread.

So if you were hoping the logistical nightmare in China would be over in the intermediate timeframe, think again.

More than 60,000 factories are situated in Guangdong, and about a third of China's exports and one-third of the world's production of shoes, textiles, and toys move through airports and seaports in the region.

https://www.zerohedge.com/covid-19/shenzhen-airport-cancels-hundreds-flights-amid-new-covid-case-s

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65329

Originally posted at >>>/qresearch/13938783 (191738ZJUN21) Notable: Vatican launches approval that might lead to EU ‘founder’ Schuman becoming a saint

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Vatican launches approval that might lead to EU ‘founder’ Schuman becoming a saint

Pope Francis has approved a decree recognizing the “heroic virtues” of French politician Robert Schuman, known as an ‘architect’ of the EU. The official decision is one of the first steps to Schuman potentially becoming a saint.

Having served as France’s finance, foreign and prime minister after World War II, the statesman became best known for proposing economic unity among European nations in the so-called “Schuman Plan” of 1950, which eventually evolved into what is known today as the European Union. In the late 1950s, he served as the first president of what is now the European Parliament.

The Pope’s decree on Saturday declares the “heroic virtues” of the politician, who can now be considered and called “venerable” by the faithful of the Roman Catholic Church.

“Behind the action of the public man, there was the interiority of the man who lived the sacraments, who, when he could, would take to an abbey, who would reflect on the sacred word before finding the shape of his political words,” the Vatican said, as quoted by AP.

The decree “advances the causes for canonization,” the Vatican’s statement said.

For Schuman to be recognized as a saint, more steps are needed, including miracles to be attributed to him and validated by the Vatican. Prior to the Pope’s latest decree, Schuman’s followers and devotees had examined his writings and heard from witnesses before sending relevant documents to the Church’s headquarters.

Last year, Pope Francis publicly praised Schuman, having said that “a long period of stability and peace” had resulted from his initiative.

Uh huh cuz he was told directly from God this is the way🤣 #religionisourdownfall

— BelieverinDemocracy2020 (@Klibra1018) June 19, 2021

Some social media users have questioned the news, apparently puzzled by the "mix" of politics and religion. Shuman’s actions were a “political success or political heroism but nothing to do with sainthood at all,” one Twitter user commented, while another expressed disappointment that religion could be “politicized like this.”

https://www.rt.com/news/527054-eu-schuman-decree-vatican/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65330

File: 31962a83f928a75⋯.png (1.25 MB,947x1731,947:1731,Clipboard.png)

Originally posted at >>>/qresearch/13938815 (191742ZJUN21) Notable: What's the REAL, hidden story behind your patch? What does your patch mean? Who designed it? What do the colors represent? +

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65326

Tip of the spear

Expanded

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65331

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13938832 (191744ZJUN21) Notable: RETRACTION #344: New York Times Issues SECOND CORRECTION About Babylon Bee

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

RETRACTION #344: New York Times Issues SECOND CORRECTION About Babylon Bee

Jun 19, 2021

https://youtu.be/BklMet5t6yI

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65332

File: ae283bdbf5492a5⋯.png (294.07 KB,560x773,560:773,Clipboard.png)

File: 66afd545928d50d⋯.png (125.75 KB,909x719,909:719,Clipboard.png)

File: ae283bdbf5492a5⋯.png (294.07 KB,560x773,560:773,Clipboard.png)

File: 3f36064c8a0c869⋯.png (66.97 KB,814x342,407:171,Clipboard.png)

Originally posted at >>>/qresearch/13938836 (191745ZJUN21) Notable: Is this why we can't keep our 3g, 2g phones? COVID-Tracker App Installs Itself Without User Consent, Including on Parental-Locked Devices.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

COVID-Tracker App Installs Itself Without User Consent, Including on Parental-Locked Devices.

Massachusetts state officials recently announced the launch of the “voluntary” MassNotify app, which monitors the spread of COVID-19 in the state. The only problem is the app appears to be installing itself on residents’ and their kids’ smartphones, unbeknownst to users, and without their consent.

The news creates a disturbing new dimension to privacy laws and even private property concerns as hundreds of users have reported their Android phones have had the app surreptitiously installed, without their prior knowledge.

“Thank you MA/Google for silently installing #MassNotify on my phone without consent. But I have a request: Can you also silently install an app that makes my phone explode and k*ll me?” wrote Twitter user Justin Jacobs. Others have taken to the Android app store to register their complaints.

The MassNotify app was developed in cooperation with both Apple and Google, and claims to work anonymously and “not track” users’ private information. This claim was made by Republican Governor Charlie Baker, who said this week: “As we embrace our new normal, MassNotify is a voluntary, free tool to provide additional peace of mind to residents as they return to doing the things they love.”

The app notifies users who have been near a person that tested COVID positive, and the tracking is conducted using the Bluetooth. The app claims that the tracking will be “completely anonymous, with no location tracking or exchange of personal information”. Furthermore, it promises to not share any location data or personal information with Google, Apple, the Commonwealth of Massachusetts or other users.

https://thenationalpulse.com/breaking/massachusetts-massnotify-app-consent/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65333

File: 71550e957d925c6⋯.png (554.3 KB,843x475,843:475,Clipboard.png)

File: 6315cb4613cb8b7⋯.png (72.07 KB,649x821,649:821,Clipboard.png)

File: 7e5a528bfdffe7c⋯.png (10.44 KB,640x264,80:33,Clipboard.png)

Originally posted at >>>/qresearch/13938853 (191747ZJUN21) Notable: Buffalo Bills player Cole Beasley reacts to COVID vaccine backlash, says he's prepared to quit football: 'My values are more important to me than a dollar'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Buffalo Bills player Cole Beasley reacts to COVID vaccine backlash, says he's prepared to quit football: 'My values are more important to me than a dollar'

Buffalo Bills wide receiver Cole Beasley railed against the NFL's new and very rigid COVID-19 protocols for training camp and the preseason. Beasley proclaimed that he is prepared to walk away from the NFL, "My values are more important to me than a dollar."

The NFL and NFL Players Association agreed upon new COVID-19 protocols, which are far more critical of unvaccinated players than those who are fully vaccinated. Unvaccinated players will face daily COVID-19 tests, must wear a mask in the team facility and during travel, and are barred from leaving the hotel to eat at a restaurant. First violations of the NFL's COVID-19 protocols can result in a $50,000 fine.

Some NFL players voiced their displeasure with the new restrictions as well as the NFLPA. One of the more outspoken players against the strict rules is Beasley, who on Thursday called the restrictions "crazy" and said the NFLPA is a "joke."

There was swift backlash to Beasley's opinions on the NFL's COVID-19 rules, to which he responded to his critics with an even more powerful stance against the new restrictions.

Beasley began his response captioned by declaring, "Hi, I'm Cole Beasley, and I'm not vaccinated!"

"I will be outside doing what I do. I'll be out in the public. If (you're) scared of me, then steer clear, or get vaccinated. Point. Blank. Period," he tweeted on Friday. "I may die of COVID, but I'd rather die actually living."

"I have family members whose days are numbered," Beasley said in response to the NFL's rules that prohibit players from having more than 15 people at their home," Beasley added. "If they want to come and see me and stay at my house then they are coming regardless of protocol."

Beasley, who has two years and roughly $11.9 million remaining on his contract with the Bills, seemed to hint that he is willing to quit or be fired from the NFL over his COVID-19 vaccine stance.

"I don't play for the money anymore. Fine me if you want," Beasley stated. "My way of living and my values are more important to me than a dollar."

"I'll play for free this year to live life the way I've lived it from Day 1," Beasley said. "If I'm forced into retirement, so be it. I've enjoyed the times I've had … So either way, it's a win-win."

"I'm not going to take meds for a leg that isn't broken," he wrote on Twitter. "I'd rather take my chances with COVID and build up my immunity that way … That is my choice based on my experiences and what I think is best."

https://www.theblaze.com/news/buffalo-bills-cole-beasley-nfl-covid-vaccine

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65334

Originally posted at >>>/qresearch/13938864 (191749ZJUN21) Notable: Prepare for Lockdowns Biden: US Likely Won’t Go Back Into Lockdown Over Delta Variant

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Biden: US Likely Won’t Go Back Into Lockdown Over Delta Variant

The prevalence of a new variant of the virus that causes COVID-19 will probably not prompt the United States to re-enter lockdown, President Joe Biden said Friday.

“I don’t think so because so many people have already been vaccinated,” he said at the White House when asked about the possibility.

“But the Delta variant can cause more people to die in areas where people have not been vaccinated,” he added. “So, no, it’s not a lockdown, but some areas will be very hurt.”

The United States entered near-nationwide lockdown in the spring of 2020 due to the COVID-19 pandemic. Every state, as well as the federal government, has since rolled back restrictions, though some have kept rules in place despite the plunge in COVID-19 metrics such as average daily cases and patients in hospitals.

COVID-19 is the disease caused by the CCP (Chinese Communist Party) virus.

Health officials say the lockdowns helped keep people safe by spreading out infections over time, avoid hospital overloading except in New York City. But some experts assert the strategy had unintended consequences, while many have noted the harsh measures led to skyrocketing unemployment, widespread business closures, and a rise in mental health issues.

https://www.ntd.com/biden-us-likely-wont-go-back-into-lockdown-over-delta-variant_630297.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65335

File: d44bb5f48204776⋯.png (298.85 KB,652x677,652:677,Clipboard.png)

Originally posted at >>>/qresearch/13938902 (191755ZJUN21) Notable: Earth tipped over 84 million years ago then corrected itself, new study claims

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Earth tipped over 84 million years ago then corrected itself, new study claims

https://twitter.com/SputnikInt/status/1406219963468185601

>>>/qresearch/13938888

"As the World Turns.

Marker.

Everything has meaning.

Everything."

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65336

File: 0643687a39656b3⋯.png (41.95 KB,639x844,639:844,Clipboard.png)

Originally posted at >>>/qresearch/13938910 (191756ZJUN21) Notable: FNC’s Carlson: FBI’s Focus on ‘Joe Biden’s Political Opponents’ a Nightmare for Civil Liberties, Threat to Democracy

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

FNC’s Carlson: FBI’s Focus on ‘Joe Biden’s Political Opponents’ a Nightmare for Civil Liberties, Threat to Democracy

Friday on FNC’s “Tucker Carlson Tonight,” host Tucker Carlson reiterated his skepticism of the FBI and its handling of the January 6 riot on Capitol Hill.

Carlson pointed to examples of where the FBI had not been truthful in the past and asked why media outlets like CNN were so trusting of it regarding the January 6 investigation.

The FNC host said the FBI’s approach to what it is referring to as domestic terrorism endangers civil liberties and democracy in America.

Transcript as follows:

CARLSON: Way back in the fall of 2017, CNN — believe it or not — ran a pretty interesting piece on its website. We read it. It was the story of a pizza delivery driver from Dearborn Heights, Michigan called Khalil Abu Rayyan.

At the age of 21, Rayyan found himself deeply depressed and contemplating suicide. He poured out his feelings to strangers on the internet as so many young people do. He posted pictures of himself at one point with a rifle and then he suggested he might want to wage jihad.

When he did that, out of the blue, he got a response from a woman he had never heard of called Ghaada. The two never actually met in person, but over time, a very intense relationship developed.

Ghaada professed her love for Rayyan. They courted online for weeks and then one day, Ghaada stopped writing. She simply disappeared. And then a new woman took her place, this one began texting Rayyan, too.

Her name was Jannah. Jannah was not interested in romance, Jannah wanted to wage violent jihad. She told Rayyan that if he planned to kill himself, he might as well kill some infidels along with him. Quote: “When it’s jihad or when it’s based on our creed or cause, that’s the only time Allah allows it.” That’s what she wrote.

Eventually, Rayyan admitted to Jannah that he had fantasized about killing people in a church near his pizza shop, though he stressed that he would never actually do it. In fact he encouraged Jannah not to hurt anyone.

Days after he wrote that, the FBI swooped in and arrested Rayyan, and that’s when he learned that the women he’d been texting with didn’t exist. Ghaada and Jannah were fake. They were pure creations of the FBI.

The bureau had spent an entire year working to entrap a depressed pizza delivery boy and then created a honey trap to do it, but it still didn’t work. After all of that, the Fed still did not have enough evidence to file terrorism charges against him. Nothing Rayyan had said was criminal.

He could have gone free, but they couldn’t let him go free. That would be too embarrassing to the Federal government. So, they charged him with an absurd non-crime, unlawful possession of a firearm while under the influence of a controlled substance.

https://www.breitbart.com/clips/2021/06/19/fncs-carlson-fbis-focus-on-joe-bidens-political-opponents-a-nightmare-for-civil-liberties-threat-to-democracy/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65337

File: 9930f5a6c30ada8⋯.png (241.78 KB,956x624,239:156,Clipboard.png)

Originally posted at >>>/qresearch/13938911 (191756ZJUN21) Notable: Ho Lee Sheeeit. Needs Sauce. Smart Thermostat Allegedly turn themselves up to 78!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

So what are y'all going to do about it?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65338

File: af2ff904b4ca2cf⋯.png (51.95 KB,463x694,463:694,Clipboard.png)

Originally posted at >>>/qresearch/13938919 (191757ZJUN21) Notable: Lin Wood Telegrams: "And one must never forget King & Spalding’s influence over Cox, Mercer University, the State Bar of Georgia, and the Lawyers Club of Atlanta. Ol’ Rod Rosenstein and Sally Yates are partners at King & Spalding! Talk about a rich and powerful international law firm!!! Wonder how many CCP clients pay the firm large sums of money???"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [19.06.21 13:14]

Mercer Law School Dean Cathy Cox invited me to speak on Legal Professionalism on January 16, 2020. It was a 2-hour discussion for which I received many laudatory comments, including from Dean Cathy “Diebold/Dominion” Cox.

In late May of 2020, Cox asked me to deliver remarks to the Mercer Law School Class of 2020.

Cox placed my remarks last after those of former Georgia Governor Nathan Deal. Ol’ Cathy told me, “I saved the best for last.”

What happened after May of 2020 to justify Mercer Law School’s false Zoom attack on me???

Oh yeah. I supported Donald J. Trump and fought for an investigation into the November 2020 Georgia election which used Dominion voting machines! How is that election looking now, Cathy?

That explains everything!

And one must never forget King & Spalding’s influence over Cox, Mercer University, the State Bar of Georgia, and the Lawyers Club of Atlanta. Ol’ Rod Rosenstein and Sally Yates are partners at King & Spalding! Talk about a rich and powerful international law firm!!! Wonder how many CCP clients pay the firm large sums of money???

https://www.kslaw.com/

https://t.me/linwoodspeakstruth/3303

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65339

Originally posted at >>>/qresearch/13938937 (191800ZJUN21) Notable: French Anti-Terror Police Arrest Suspected Far-Left Extremist School Principal

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

French Anti-Terror Police Arrest Suspected Far-Left Extremist School Principal

French anti-terror police arrested six people, including a school principal, alleged to be far-left extremists, in connection with the sabotage of a communications tower.

Anti-terror police arrested the school principal, said to be a woman in her 60s, on Tuesday in the department (county) of Creuse. Officers also arrested two other women and three men in the department of Haute-Vienne.

The six alleged far-left extremists are accused of taking part in an arson attack on a relay antenna in the district of Cars in January, which led to 1.4 million people being without access to radio, television, and mobile phones, French newspaper Le Figaro reports.

According to the local prosecutor’s office, the six “ultra-left” extremists are suspected of “destruction and degradation by dangerous means [undertaken by] an organised gang, criminal association, and destruction of property likely to harm the interests of the nation”.

A group of 70 people gathered in the city of Limoges to protest the arrests of the alleged far-left extremists, including the partner of the principal who stated that the charges of terrorism against the woman made “everyone howl with laughter!”

Far-left extremists have committed attacks on infrastructure, particularly communications, in France for several years.

In February, communications company Constructel suffered infrastructure attacks in the communes of Brézins and Sassenage, both in the department of Isère, with fibre optic cables being destroyed, vehicles damaged, and a 980-foot high fibre optic tower set on fire.

Anarchists took credit for both attacks on the far-left Indymedia web platform, stating: “…it is not to protest against 5G in particular but in a broader context, fighting against the techno-world.”

In May 2020, Antifa militants were suspected of being behind the cutting of telephone and communications cables in the Île-de-France region that knocked out internet connectivity for at least 50,000 customers and is suspected of having cost €1 million (£860,000/$1.19m) in damages.

https://www.breitbart.com/europe/2021/06/19/far-left-extremist-school-principal-arrested-french-anti-terror-police/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65340

Originally posted at >>>/qresearch/13938946 (191801ZJUN21) Notable: Previously Deported Sex Offenders Arrested After Crossing into Multiple Border Sectors

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Previously Deported Sex Offenders Arrested After Crossing into Multiple Border Sectors

Border Patrol agents in multiple southern border sectors arrested several previously deported sex offenders after they illegally crossed the border from Mexico into the United States.

Yuma Sector Border Patrol agents detected a group of three migrants on Tuesday evening after they illegally crossed the border from Mexico into Arizona, according to information provided by Border Patrol officials in Arizona. The agents arrived at the location and arrested the three migrants.

The agents transported the migrants to a processing center where a records check identified one of the men, 37-year-old Juan Nunez-Tavarez, as a four-time previously deported sex offender.

A Texas court convicted the Mexican national for indecency with a child: sexual contact, officials stated. The court sentenced him to two years in state prison.

The agents arrested Nunez-Tavarez for illegal re-entry after removal as a sex offender. If convicted, he could face up to 20 years in federal prison.

In Southeast Texas, McAllen Station Border Patrol agents apprehended a group of 53 migrants who illegally crossed the border near Hidalgo, Texas, on June 16. The agents transported the group to the station for processing.

A biometric background investigation identified one of the men embedded in the group, a Salvadoran national, as an MS-13 gang member.

A short time later, McAllen Station agents apprehended another group of 17 migrants in a nearby section of the border. During processing, agents identified one of the men as a Salvadoran citizen. Criminal history records revealed the man received a conviction in New York for Rape-3rd Degree, officials reported. ICE Enforcement and Removal Operations agents deported the man following his six-year prison sentence.

El Centro Sector Border Patrol agents also identified a previously deported sex offender attempting to illegally re-enter the United States on the same day.

At approximately 9 a.m., Calexico Border Patrol Station agents encountered a man who illegally crossed the border one mile west of the Calexico Port of Entry. The agents transported him to the station where they identified him as a previously deported sex offender.

Agents frequently find an arrest previously deported sex offenders and other criminal aliens.

https://www.breitbart.com/border/2021/06/19/deported-sex-offenders-arrested-after-crossing-into-multiple-border-sectors/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65341

File: 4c17fad9e4d6389⋯.mp4 (3.24 MB,320x180,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13938957 (191804ZJUN21) Notable: REPOST - CNN VIDEO ON SNOWDEN BEING HUNTED BY THE Q GROUP FROM 11TH JUNE 2013 ARCHIVED, DROPPED BY AN ANON !!!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65305

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65342

File: 8591196c22aa6aa⋯.png (32.71 KB,733x883,733:883,Clipboard.png)

File: 1c7f47203d1c1ec⋯.png (5.84 KB,712x174,356:87,Clipboard.png)

Originally posted at >>>/qresearch/13938973 (191806ZJUN21) Notable: Pfizer & Moderna Fail To Respond To British Medical Journal About COVID Vaccine Safety Concerns

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Pfizer & Moderna Fail To Respond To British Medical Journal About COVID Vaccine Safety Concerns

An article published in the British Medical Journal by Dr. Peter Doshi titled “Covid-19 Vaccines: In The Rush for Regulatory Approval, Do We Need More Data?” raises concerns regarding COVID-19 vaccine rollout, and one of them is the bio-distribution of the vaccine. This refers to the examination and study of where the vaccine and its ingredients go once injected into the body. Having sped up the approval process of these vaccines, it has been claimed that no compromises in the process of examining their safety were made. But the fact that no study for tracking the distribution of the vaccine within the human body was conducted for any of the authorized vaccines, we cannot say this is true.

Dr. Doshi points out that such bio-distribution studies are a standard practice of drug safety testing but “are usually not required for vaccines.” This in itself is concerning. Research regarding the bio-distribution of aluminum containing vaccines, for example, have raised concerns about injected aluminum crossing the blood brain barrier and being distributed throughout the body where it can be detected years after injection. This is important, because vaccines are a different method of delivery than say, ingested aluminum, which the body does a great job of getting rid of through digestion.

Bio-distribution studies weren’t performed for COVID vaccines because data from past studies performed with related, and “mostly unapproved compounds that use the same platform technology” were used to bypass them.

Dr. Doshi points out that,

“Pfizer and Moderna did not respond to The BMJ’s questions regarding why no biodistribution studies were conducted on their novel mRNA products, and none of the companies, nor the FDA, would say whether new biodistribution studies will be required prior to licensure.”

In his article, Dr. Doshi also references a report that Pfizer provided to the Japanese government. In the report there is a table containing lipid nanoparticle bio-distribution data.

This table shows where their surrogate “vaccine” (i.e. represented in the laboratory test by little bubbles of surrogate fat containing an analytical detection marker) ended up in the body of immunized rats, used in the laboratory as surrogates for humans…I would like to highlight some observations. First…a lot of the surrogate vaccine dose remained at the injection site, as one would expect. Remarkably, however, most of the vaccine dose had gone elsewhere….50-75% of the vaccine dose failed to remain at the site of injection. The big question is, where did it go? Looking at the other tissues shows some of the paces it went and accumulated…The surrogate vaccine was circulating in the blood. There is also evidence that a substantial amount of the vaccine went to places like the spleen, liver, ovaries, adrenal glands, and bone marrow. The vaccine went to other places as well, such as testes, lungs, intestines, kidneys, thyroid glands, pituitary gland, uterus, etc. The surrogate vaccine tested in a laboratory setting was widely distributed throughout the laboratory animal’s bodies. – Dr. Byram W. Bridle, Viral Immunologist, University of Guelph.

https://www.lewrockwell.com/2021/06/no_author/pfizer-moderna-fail-to-respond-to-british-medical-journal-about-covid-vaccine-safety-concerns/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65343

File: de2ea81891daf56⋯.png (360.89 KB,661x874,661:874,Clipboard.png)

Originally posted at >>>/qresearch/13938975 (191807ZJUN21) Notable: Prepare for Lockdowns Biden: US Likely Won’t Go Back Into Lockdown Over Delta Variant

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://gab.com/Behizy/posts/106438706959635787

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65344

File: a175cc0980206a7⋯.png (103.29 KB,683x676,683:676,Clipboard.png)

Originally posted at >>>/qresearch/13938981 (191807ZJUN21) Notable: Biden's new domestic terror strategy could be used to SILENCE any criticism of the administration, claims political science professor

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Biden's new domestic terror strategy could be used to SILENCE any criticism of the administration, claims political science professor

Nicholas Giordano made the claim about new Biden's domestic terror strategy

Questioned whether document issued this week is too broad in its definitions

Lockdown protests, for example, could be called 'anti-government extremism'

Biden insists that the new strategy is 'narrowly targeted' against violence

Administration says it will protect free speech while targeting extremism

A professor of political science has claimed that President Joe Biden's new plan to counter domestic terrorism could be used to silence administration critics.

Nicholas Giordano, a professor at Suffolk Community College on Long Island, raised his concerns about the new National Strategy for Countering Domestic Terrorism in an interview with Fox News on Friday.

Earlier this week, Attorney General Merrick Garland unveiled the new 32-page strategy document, which came in response to an order issued by Biden on his first full day in office, calling domestic terrorism 'the most urgent terrorism threat the United States faces today.'

In a statement attached to the document, Biden insisted that that the new strategy is 'narrowly tailored to focus specifically on addressing violence' while preserving free speech.

But nevertheless Giordano raised his concerns about the wording of the strategy, calling it 'overly broad and dangerous' and 'ripe for abuse and targeting any political opposition.'

https://www.dailymail.co.uk/news/article-9703155/Bidens-new-domestic-terror-strategy-used-SILENCE-criticism-claims-professor.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65345

File: 0532009943d7a0e⋯.png (280.88 KB,905x830,181:166,Clipboard.png)

Originally posted at >>>/qresearch/13938990 (191809ZJUN21) Notable: Muh Q is fake guys just belieb the news…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Moar conspiracy theory stuff.

https://twitter.com/disclosetv/status/1406312326953947141

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65346

File: c1ccd574a74cf80⋯.png (483.2 KB,1070x964,535:482,Clipboard.png)

Originally posted at >>>/qresearch/13938992 (191810ZJUN21) Notable: golden globes has a 'culture of verbal abuse' according to two members who have resigned

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.breitbart.com/entertainment/2021/06/19/golden-globes-in-tatters-as-two-hfpa-members-resign-over-corruption-and-verbal-abuse/

golden globes has a 'culture of verbal abuse' according to two members who have rsigned, so says Breitbart linked story.

who knew?

wait . . .

maybe Ricky but . . . he was doing humor.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65347

File: 6f34ebae229eee9⋯.png (85.04 KB,861x439,861:439,Clipboard.png)

Originally posted at >>>/qresearch/13939048 (191820ZJUN21) Notable: I'd like to negotiate a 2.5B annual…Georgia’s Dominion Voting System Implementation Manager Gabe Sterling Negotiated a $144,000 Salary Increase for Himself Last Year

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Georgia’s Dominion Voting System Implementation Manager Gabe Sterling Negotiated a $144,000 Salary Increase for Himself Last Year

Gabriel Sterling, Georgia’s Dominion Voting System Implementation Manager, appeared on several liberal news channels this past year following Georgia’s controversial presidential election.

Sterling was the state’s “Voting System Implementation Manager.”

Georgia officials negotiated a $107 million deal with Dominion earlier in the year for their voting machines.

Democrat operatives removed media and GOP observers from the counting room in Atlanta, Georgia on election night and then proceeded to count thousands of unsecured ballots late in the night on election day including stacks of ballots that were counted two or three times by multiple operatives.

Gabriel Sterling defended this practice on national TV.

Many interested patriots were wondering where this loudmouth leftist came from?

Apparently, Gabriel Sterling negotiated a $200,000 per year contract for himself last year.

Sterling then quit his state government job and worked as an independent contractor ever since.

AJC reported on December 29, 2020.

The man who oversees Georgia’s voting system, Gabriel Sterling, negotiated a $200,000 per year contract for himself last year, quit his state government job and has worked as an independent contractor ever since.

Under the arrangement, Sterling’s pay increased from his $114,000 government salary since November 2019, when he took on the role of project manager for the purchase and rollout of the state’s new voting equipment. State election officials say as a contractor, the government didn’t have to pay benefits, such as health insurance.

Though he’s a contractor, Sterling has become the face of Georgia elections, leading press conferences debunking election conspiracy theories, criticizing mistakes by county election officials and calling out President Donald Trump for inciting threats against election workers, proclaiming “this has to stop.”

https://www.thegatewaypundit.com/2021/06/georgias-dominion-voting-system-implementation-manager-gabe-sterling-negotiated-144000-salary-increase-last-year/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65348

File: d46f602936aa5dd⋯.jpg (391.73 KB,1080x1608,45:67,Clipboard.jpg)

Originally posted at >>>/qresearch/13939060 (191823ZJUN21) Notable: Inside the toxic Murdaugh family dynasty of incest money, murder and mayhem

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Inside the toxic Murdaugh family dynasty of money, murder and mayhem

https://nypost.com/2021/06/19/inside-the-toxic-murdaugh-family-of-south-carolina/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65349

File: 9c59305fd1191f2⋯.png (46.36 KB,657x333,73:37,Clipboard.png)

File: 1917cd8096934c8⋯.png (178.23 KB,1027x486,1027:486,Clipboard.png)

Originally posted at >>>/qresearch/13939062 (191823ZJUN21) Notable: Twitter and Cali

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Q proof.

Pelosi cut deal with @jack

https://www.breitbart.com/tech/2021/06/19/lawsuit-california-government-colluded-with-twitter-on-censorship/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65350

Originally posted at >>>/qresearch/13939068 (191825ZJUN21) Notable: Walmart CEO may face deposition in opioid epidemic lawsuit

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Walmart CEO may face deposition in opioid epidemic lawsuit

Chief executive may have "personal knowledge of and involvement in" the matters of the case.

Walmart CEO Doug McMillon may face deposition as part of the discovery phase of a multi-state lawsuit targeting the manufacturers and distributors of pharmaceutical opioids.

The suit, brought by several thousand U.S. tribal plaintiffs, is meant to target the alleged facilitation of the ongoing opioid addiction crisis that has gripped much of American for years.

Walmart—which operates thousands of pharmacies nationwide—is named in the suit. The company had argued that the request for McMillon’s deposition was "harassing on its face" and should be dismissed.

But Special Master David Cohen, appointed by the U.S. District Court for the Northern District of Ohio, Eastern District, said McMillon may have "personal knowledge of and involvement in" the matters related to the suit, and that the plaintiffs could depose him as part of their discovery process.

Walmart can still file an objection to the decision.

https://justthenews.com/government/courts-law/walmart-ceo-may-face-deposition-opioid-epidemic-lawsuit

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65351

Originally posted at >>>/qresearch/13939097 (191830ZJUN21) Notable: Five batches in a row of absentee ballots from Georgia's most-populous Fulton County suspiciously showed the same tally of 392 votes for Biden, 96 Trump, and 3 for Libertarian candidate Jo Jorgensen — which state officials have admitted is a statistical impossibility.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://sputniknews.com/us/202106191083189689-georgia-secretary-of-state-finally-admits-2020-election-foul-play-in-atlanta/

Five batches in a row of absentee ballots from Georgia's most-populous Fulton County suspiciously showed the same tally of 392 votes for Biden, 96 Trump, and 3 for Libertarian candidate Jo Jorgensen — which state officials have admitted is a statistical impossibility.

The US state of Georgia's top electoral official has acknowledged voting irregularities in the state capital — seven months after the presidential election.

Revelations this week have prompted Georgia Secretary of State Brad Raffensperger to order a new audit of tens of thousands of ballots collected from drop-boxes in Fulton County — which covers 90 percent of the state capital Atlanta and whose one million inhabitants represent a tenth of the state's population.

In one of the newly-discovered incidents, more than 100 batches of absentee ballot papers — each at least 100 votes — were sent to be scanned through vote-counting machines in Fulton County, but their tracking numbers were never recorded in hand-written logs of counted batches, raising the prospect that they were not tallied.

Some 25 more batches were scanned twice, while many batch control sheets do not bear a tick in the box declaring they came from a secure container — potentially meaning they could have been tampered with.

Crucially, five batches counted in a row suspiciously showed the same tally of 392 votes for Biden, 96 Trump and 3 for Libertarian candidate Jo Jorgensen. State officials have admitted that tally of almost 2,500 votes is a statistical impossibility.

​While Raffensperger still denies that ballot fraud swung the election for Biden, he called for Fulton County Elections Director Richard Barron to be fired.

Barron was previously fired by the county's Board of Registration and Elections in February, but was reinstated the next month by county commissioners

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65352

File: 102a58a4e30a3d0⋯.jpg (446.18 KB,1471x852,1471:852,Clipboard.jpg)

Originally posted at >>>/qresearch/13939113 (191832ZJUN21) Notable: Earth tipped over 84 million years ago then corrected itself, new study claims

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13939088

>>Earth tipped over 84 million years ago then corrected itself, new study claims

Allegedly, on June 11th, 2019 there was a civil court hearing where Flat vs. Spherical Earth sides collided in a legal battle. Apparently the Judge ruled that there was not enough proof presented by one of the sides to consider the Earth to be spherical. I guess, the gist goes like this:

Mr. Garcia stated that he will give some money to whoever presents enough scientific evidence that the Earth was Spherical

Mr. Thompson mailed Mr. Garcia the evidence

Mr. Garcia replied, that the evidence was not enough to consider the Earth not flat

Mr. Thompson sued Mr. Garcia in some Civil Court of Barrow County, Georgia

The judge ruled, that the evidence presented was not indeed enough to consider our Earth to be spherical

Mr. Garcia stated on his Facebook Page:

I’m pleased to announce that on this Shavuot/Pentecost, the 9th of Sivan, that the judge presiding over a civil court case in which I was being sued for the amount of $15,000, ruled in my favor and sided with the evidence I presented. Those of you familiar with my work know that following the publication of my ninth book, Flat Earth As Key To Decrypt The Book Of Enoch, that I openly held a challenge to any individual in the world that should they be able to verify with two independent scientifically verifiable experiments that either the Earth had curvature or that it was moving in excess of 50 mph, that they could earn the reward money.

Thus interestingly enough, this case was actually based upon and dependent upon whether one believes the earth to be a globe or flat plane. The judge was ruling over whether the plaintiff W. T. had provided ample evidence to warrant being rewarded the prize money I had put up in challenge. My contention was that he had not, and could not scientifically prove that curvature was nonsexist. Her ruling upheld the fact that his conclusions per stipulation of the rules, were not based on real-world experimentation that curvature actually exists. That whether one believes the earth to be flat or a globe, one must consider the evidence which I brought forth to the court contending against the supposed existence of the Earth’s curvature.

Imagine the shock of those law students witness to the proceedings, watching as the case was argued out, when they discovered that those in the courtroom would be contesting arguments for and against viewpoint that the earth could hold shape contrary to what we have been as public largely indoctrinated into belief.

I was so relieved to discover that the judge was actually open to hearing and considering the facts of this case; and in doing so state in conclusion that no matter one’s belief on whether the earth was a globe or flat, certainly there was much to consider when examining the evidence.

With that I will submit below the statement that I read into the Barrow County Magistrate Court public record, here in Winder Georgia this morning at 9 AM Eastern. Know that I have amended some of this material to clarify the stances of this case. However, the facts as presented here are truthful and reflect the proceedings brought against me by W.T. I am hoping to get an account of the case as reported by the law clerk but do not yet know how to do so.

I’m not sure whether this case is the first one to be argued publicly in a court of law with focus and regard to the question of whether the earth is a plane or a globe. But would be interested to know whether any other case like this had been considered before a judge. W. did boast to the court that should he lose this case it would reflect very badly on the indoctrinated belief that the earth is a globe. I do believe that the judge’s decision to support the evidence that I’ve presented on such consideration, was without a doubt a large win for our community and a precedent we can in the least be proud of when sharing in discussion this topic and case.

All praise, honor, and glory to the Most High God. I believe this case was a win for Yahaveh and biblical cosmologists. Praise God that I did not have to shell out $15,000 dollars to someone undeserving of such reward. Likewise God bless Judge Jamie Crowe for standing with truth in the face of world conditioning.

https://www.stolenhistory.org/articles/2019-court-case-globe-vs-flat-earth.296/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65353

File: 6dd7553d09be7b9⋯.png (52.41 KB,640x295,128:59,Clipboard.png)

Originally posted at >>>/qresearch/13939116 (191833ZJUN21) Notable: Ho Lee Sheeeit. Needs Sauce. Smart Thermostat Allegedly turn themselves up to 78!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65337

>https://www.khou.com/article/news/local/texas/remote-thermostat-adjustment-texas-energy-shortage/285-5acf2bc5-54b7-4160-bffe-1f9a5ef4362a

Sauce

Get a dumb thermostat

https://www.howtogeek.com/355852/you-don%E2%80%99t-need-a-smart-thermostat/

Wire a thermostat

https://www.homedepot.com/c/ah/wiring-a-thermostat/9ba683603be9fa5395fab908af393aa

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65354

Originally posted at >>>/qresearch/13939144 (191838ZJUN21) Notable: Muh Baseless Kunspiracy Theory is Good Ratings! President Biden announced on Saturday the passing of the family dog Champ, a 13-year-old German Shepherd who died peacefully at the Biden's family home in Delaware. Meanwhile, QAnon supporters took the announcement as a secret code.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.newsweek.com/qanon-believers-suggest-secret-message-behind-announcement-biden-dogs-death-1602280?piano_t=1

President Biden announced on Saturday the passing of the family dog Champ, a 13-year-old German Shepherd who died peacefully at the Biden's family home in Delaware. Meanwhile, QAnon supporters took the announcement as a secret code.

"Comms" are formally known as secret messages that can be decoded by QAnon supporters.

Writer and popular debunker Mike Rothschild followed up to inform that dog comms have been around for quite some time.

"When James Comey's dog died, QAnon believers claimed the announcement was code that George HW Bush had secretly been executed," Rothschild tweeted. "Get ready for them to relentlessly bake Champ's death."

Rothschild tweeted: "#QAnon is already claiming that George HW Bush was taken out by the deep state as a distraction. The proof being a tweet about James Comey's dog."

And now, it seems, the death of Champ may be code for something else. Some commenters on Telegram, a software messaging platform, had posted the announcement of Champ and wrote, "interdasting," with a few quizzical emoticons.

Another commented afterward and said: "State Funeral Coming?"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65355

Originally posted at >>>/qresearch/13939156 (191840ZJUN21) Notable: HUMA ABEDIN, LONGTIME CLINTON AIDE, UNEXPECTED FIGURE IN 2016 PRESIDENTIAL RACE, TO PUBLISH MEMOIR

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

HUMA ABEDIN, LONGTIME CLINTON AIDE, UNEXPECTED FIGURE IN 2016 PRESIDENTIAL RACE, TO PUBLISH MEMOIR

First published at 17:40 UTC on June 19th, 2021.

https://www.bitchute.com/video/Sg1Lo7YbqCer/

Just The News

Huma Abedin, Hillary Clinton's chief of staff and the ex-wife of former Rep. Anthony Weiner, is writing a memoir titled "Both/And: A Life in Many Worlds," a coming-of-age story about her largely behind-the-scene's life that later became very public.

Story by: Ava Castelli

Hillary Clinton's chief of staff and the ex-wife of former Rep. Anthony Weiner, is writing a memoir titled "Both/And: A Life in Many Worlds," a coming-of-age story about her largely behind-the-scene's life that later became very public.

The 45-year-old Abedin has been a Clinton staffer since President Bill Clinton and wife Hillary Clinton were in the White House.

To most political observers, she was known as Clinton's polished but quiet aide. The picture change after she married Weiner, a New York Democrat, in 2010 and a year later endured the public scrutiny of Weiner having to resign from Congress over texting lewd photos to women.

Abedin was thrust back into the public stoplight in 2013 when Weiner, a front-runner in the New York City mayoral race, was again caught sexting. Three years later, in the homestretch of Clinton's failed 2016 presidential bid, emails on Weiner's laptop became part of the FBI investigation into Clinton's use of a private email server while secretary of state, again putting her in the spotlight.

The couple, who have a young son, have since divorced. Weiner pleaded guilty in 2017 to charges of sending sexual materials to a minor and was sentenced to 21 months in prison, according to the Associated Press.

Abedin’s book will be published by the Simon & Schuster imprint Scribner and is due for a Nov. 2 release.

The book will be about Abedin's "inspiring story, coming of age as an American Muslim, the daughter of Indian and Pakistani scholars who split their time between Saudi Arabia, the United States, and the UK,” said the publisher in a June 10 announcement, adding the story “grapples with family, legacy, identity, faith, marriage, and motherhood.”

Abedin says in the release: "For most of my life, I was viewed through the lens of others, a refraction of someone else’s pronoun. 'They' as in the parents who raised me; 'she’ as in the woman I worked for; and 'he' as in the man I married."

Abedin has known Clinton since she was a student at George Washington University, when she worked as an intern in 1996 for the then-first lady. She was an aide to Clinton during Clinton’s successful run for the U.S. Senate in 2000; deputy chief of staff during Clinton’s years as secretary of state in the first term of the Obama administration, 2009-2013; and a top adviser during the 2016 election, the Associated Press also reports.

RELATED ARTICLES

https://justthenews.com/accountability/media/huma-abedin-chief-staff-hillary-clinton-releases-memoir-fall

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65356

Originally posted at >>>/qresearch/13939167 (191841ZJUN21) Notable: #176431, #176432

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13938386 Dough

Notables Are NOT Endorsements

#17643

>>65302 Hopefully there is miner commission?: A huge diamond weighing more than 1,000 carats, which could be the third-largest mined in history, has been discovered in the southern African country of Botswana.

>>65303 Child stealing networks operate worldwide. They frequently prey on indigenous populations living in remote areas of third world countries. This witness describes what he saw in the Guatemalan Highlands.

>>65304 Every Single Year? California's Willow Fire spreads to 2,000 acres as record drought, heat continue to grip state

>>65305, >>65341 REPOST - CNN VIDEO ON SNOWDEN BEING HUNTED BY THE Q GROUP FROM 11TH JUNE 2013 ARCHIVED, DROPPED BY AN ANON !!!

>>65306 Revolver News: Unindicted Co-Conspirators raises questions for FBI 1/6 events The Duran: Episode 1008

>>65307 PF Report?

>>65308 Secretary of State Brad Raffensperger on Friday made public the names of nearly 102,000 people who are at risk of having their Georgia voter registrations canceled, a warning before they lose their ability to vote next month. (Election Law Blog.org)

>>65309 Faggots and satanism ID:4e7deb

>>65310 Anyone in Technology knows this is all bullshit the way it's dragging… Ken tells John Fredericks that they are still waiting on the passwords and the router logs from the slimy Maricopa County Supervisors. The audit team is unable to get past a partition on the 385 tabulator machines without a second password. The Supervisors’ excuse that sensitive health and social security data contained on the router logs prevents them from granting access is ludicrous, Ken points out.

>>65311 Canadian authority warns operators over 5G risk to radio altimeters…

>>65312, >>65313, >>65314 LW Telegrams: Simple truths are simple truth. Simple truth: If the shoe fits, wear it. What is the punishment for treason?

>>65315, >>65316, >>65317 The Space Shuttle Challenger crew likely survived the explosion on board until their capsule plunged into the Atlantic Ocean, according to a new book about the 1983 disaster…

>>65318, >>65326, >>65330 What's the REAL, hidden story behind your patch? What does your patch mean? Who designed it? What do the colors represent? +

>>65319 LB Repost - Amazing New Website Confirms YouTube Is Suppressing Dislikes on Joe Biden Videos by as Much as 600%

>>65320 Happy Father's Day! Father of 8 was set to get 2nd vaccine dose, but contracted COVID-19 and died (Of Course!)

>>65321 How to ease the idea in… Tori Spelling has admitted that she is currently co-sleeping with four of her children. They make up words to normalize perversion…

>>65322 Boris Epshteyn: Subpoenas Are Being Prepared in Pennsylvania for Another Audit

>>65323 How Many dead VOTERS Voted In Georgia?! Raffensperger Cleans Voter Rolls AFTER Fraudulent Election

>>65324 Obama/Biden Chief Diversity Officer Who Compared President Trump to Hitler Is Reinstated After Investigation Finds No Issue with His Tweets

>>65325, >>65327 …1 killed & 11 injured after helicopter carrying ballot boxes crashes in Iran – media

>>65328 Shenzhen Airport Cancels Hundreds Of Flights Amid New COVID Cases

>>65329 Vatican launches approval that might lead to EU ‘founder’ Schuman becoming a saint

>>65331 RETRACTION #344: New York Times Issues SECOND CORRECTION About Babylon Bee

>>65332 Is this why we can't keep our 3g, 2g phones? COVID-Tracker App Installs Itself Without User Consent, Including on Parental-Locked Devices.

>>65333 Buffalo Bills player Cole Beasley reacts to COVID vaccine backlash, says he's prepared to quit football: 'My values are more important to me than a dollar'

#176431

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65357

File: d874baf12b8d084⋯.png (149.52 KB,792x736,99:92,Clipboard.png)

File: 37f92661ad027e9⋯.png (181.65 KB,787x814,787:814,Clipboard.png)

File: 088b5b836a8e2c6⋯.png (153.37 KB,779x783,779:783,Clipboard.png)

File: dfad7616da58c0e⋯.png (167.04 KB,792x827,792:827,Clipboard.png)

File: 71d3a0f6af9be88⋯.png (87.94 KB,788x486,394:243,Clipboard.png)

Originally posted at >>>/qresearch/13939285 (191901ZJUN21) Notable: 'Misleading Title for an article supportive of hydroxychloroquine… "Dr. McCullough: COVID Vaccines Have Already Killed Up to 50,000 Americans, According to Whistleblowers" + Related (Hydroxychloroquine, Vaccine, COVID, Various)''

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dr. McCullough: COVID Vaccines Have Already Killed Up to 50,000 Americans, According to Whistleblowers

In an extraordinary interview last week, Dr. Peter McCullough, an American professor of Medicine and Vice Chief of Internal Medicine at Baylor University, declared that the world has been subjected to a form of bioterrorism, and that the suppression of early treatments for COVID-19—such as hydroxychloroquine— “was tightly linked to the development of a vaccine.”

Dr. McCullough made the explosive comments during a webinar on June 11, with Dr. Reiner Fuellmich, a German trial lawyer, who believes the pandemic was planned, and is “a crime against humanity.”

McCullough said he believes the bioterrorism has come in two stages—the first wave being the rollout of the coronavirus, and the second, the rollout of the dangerous vaccines, which he said may already be responsible for the deaths of up to 50,000 Americans.

Dr. McCullough practices internal medicine and cardiology, is the editor of Reviews in Cardiovascular Medicine, senior editor of the American Journal of Cardiology, editor of the textbook Cardiorenal Medicine, and president of the Cardiorenal Society.

“The first wave of the bioterrorism is a respiratory virus that spread across the world, and affected relatively few people—about one percent of many populations—but generated great fear,” McCullough explained during the Oval Media webinar with other doctors. He noted that the virus targeted “mostly the frail and the elderly, but for otherwise well people, it was much like having the common cold.”

Dr. McCullough later elaborated that he has treated many patients with the disease, written papers on it, had the disease himself, and has also seen a death in his own family due to COVID.

The doctor said he believes that fear of the virus was used very quickly to generate policies that would hugely impact human life, such as the draconian lockdowns.

“Every single thing that was done in public health in response to the pandemic made it worse,” he pointed out.

McCullough explained that early on, as a doctor treating COVID patients, he came up with an early treatment regimen for those struck with the virus, which reduced hospital stays by about 85 percent, and said he began publishing papers on what he had learned. The doctor noted that he was “met with resistance at all levels” in terms of actually treating patients and publishing his papers.

“Fortunately I had enough publication strength to publish the only two papers in the entire medical literature that teaches doctors how to treat COVID-19 patients at home to prevent hospitalization,” he said.

https://amgreatness.com/2021/06/15/dr-mccullough-covid-vaccines-have-already-killed-up-to-50000-americans-according-to-whistleblowers/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65358

Originally posted at >>>/qresearch/13939293 (191901ZJUN21) Notable: WITZKE: ‘I WILL Be Pursuing Legal Action’ Against Wells Fargo, ‘We’re Fighting Back’ (National File)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

WITZKE: ‘I WILL Be Pursuing Legal Action’ Against Wells Fargo, ‘We’re Fighting Back’

Lauren Witzke is pledging to take legal action against Wells Fargo after being debanked

Lauren Witzke, the former Republican candidate for U.S. Senate and political pundit who Wells Fargo admits to debanking, is now pledging to take legal action against the American multinational financial services company for what she calls the politically motivated decision to terminate her bank account, leaving her stranded out of state with no access to her funds.

“Just an update on the Wells Fargo issue. I WILL be pursuing legal action and filing complaints against WF for violating federal and state banking laws, discriminating against me for my religious/ political beliefs, and violating my consumer rights,” Witzke wrote in her Telegram channel, before noting that she was stranded out of state with no access to her finances when Wells Fargo closed her account. “We’re fighting back. Hold the Line now, or lose everything and be thrown in the gulags later.”

In another post, Witzke referenced National File’s article about Wells Fargo also banning Pete D’Abrosca. Like Witzke, D’Abrosca had his accounts terminated with no explanation, and believes Wells Fargo’s decision to terminate his accounts may be due to his politics. Witzke wrote, “Wells Fargo also shut down my political consultant’s account who helped run my campaign in 2020,” referring to D’Abrosca, who is of Arab descent. “Undeniably targeted, politically motivated, and not to mention, racist!”

Wells Fargo took hours to reply to National File’s inquiry about the decision to ban Witzke from banking with them. Eventually, Wells Fargo claimed in an email to National File that the decision to cancel Witzke’s account was not due to “political views or affiliations” but could have been due to “a number of reasons” and claimed they “reviewed this situation” and “it was handled appropriately.”

Witzke is one of many conservative individuals, organizations, or companies who have been cut off from financial services apparently due to their political views. Gab founder and CEO Andrew Torba earlier this year revealed that he and his social media platform had been banned from four banks within the space of four weeks, due to media smears claiming the site is a “haven for extremists” and other spurious reports. In February, pro-Trump coffee brand “Covfefe Coffee” were banned from using Chase Bank’s WePay processor, and after National File and others reported on the incident, sales for Covfefe Coffee shot up over 7,500%.

https://nationalfile.com/witzke-i-will-be-pursuing-legal-action-against-wells-fargo-were-fighting-back/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65359

File: e15d57a9f60031b⋯.png (731.77 KB,792x905,792:905,Clipboard.png)

File: 35aa51ed4403ce0⋯.png (162.38 KB,773x667,773:667,Clipboard.png)

File: 99a962f5e493ea8⋯.png (557.8 KB,803x909,803:909,Clipboard.png)

File: e0cce53ab64db74⋯.png (467.65 KB,808x909,8:9,Clipboard.png)

File: b8d0285d62bceac⋯.png (199.8 KB,791x879,791:879,Clipboard.png)

Originally posted at >>>/qresearch/13939305 (191904ZJUN21) Notable: Questions About the FBI's Role in 1/6 Are Mocked Because the FBI Shapes Liberal Corporate Media (greenwald.substack.com)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Questions About the FBI's Role in 1/6 Are Mocked Because the FBI Shapes Liberal Corporate Media

The FBI has been manufacturing and directing terror plots and criminal rings for decades. But now, reverence for security state agencies reigns.

The axis of liberal media outlets and their allied activist groups — CNN, NBC News, The Washington Post, Media Matters — are in an angry uproar over a recent report questioning the foreknowledge and involvement of the FBI in the January 6 Capitol riot. As soon as that new report was published on Monday, a consensus instantly emerged in these liberal media precincts that this is an unhinged, ignorant and insane conspiracy theory that deserves no consideration.

The original report, published by Revolver News and then amplified by Fox News’ Tucker Carlson, documented ample evidence of FBI infiltration of the three key groups at the center of the 1/6 investigation — the Oath Keepers, the Proud Boys, and the Three Percenters — and noted how many alleged riot leaders from these groups have not yet been indicted. While low-level protesters have been aggressively charged with major felonies and held without bail, many of the alleged plot leaders have thus far been shielded from charges.

The implications of these facts are obvious. It seems extremely likely that the FBI had numerous ways to know of any organized plots regarding the January 6 riot (just as the U.S. intelligence community, by its own admission, had ample advanced clues of the 9/11 attack but, according to their excuse, tragically failed to “connect the dots”). There is no doubt that the FBI has infiltrated at least some if not all of these groups — which it has been warning for years pose a grave national security threat — with informants and/or undercover spies. It is known that Proud Boys leader Enrique Tarrio has served as an FBI informant in the past, and the disrupted 2020 plot by Three Percenters members to kidnap Gov. Gretchen Whitmer (D-MI) was shaped and driven by what The Wall Street Journal reported were the FBI’s “undercover agents and confidential informants.”

More

https://greenwald.substack.com/p/questions-about-the-fbis-role-in

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65360

Originally posted at >>>/qresearch/13939307 (191904ZJUN21) Notable: 'Misleading Title for an article supportive of hydroxychloroquine… "Dr. McCullough: COVID Vaccines Have Already Killed Up to 50,000 Americans, According to Whistleblowers" + Related (Hydroxychloroquine, Vaccine, COVID, Various)''

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Human endogenous retroviruses (HERVs) are traces of ancient viruses present in the human genome, having first integrated themselves into our makeup millions of years ago, after infecting a common ancestor. They comprise a significant part of the our genome, making up about 8% of our DNA.

There aren't many HERVs that can still be read & expressed by the body, but there's one that can: HERV-W.

HERV-W has been functionally adopted by its human host, meaning the body has learned to make use of this viral code. There's not a single tissue in the body where it's not found; it's expressed in the brain, testis, ovaries, spleen, thymus, placenta (ESPECIALLY in the placenta), and more.

In the placenta, humans have come to rely on the envelope protein (outer skin) code of the HERV-W virus, which is used to form the 'syncytiotrophoblast'; a layer in the wall of the uterus which feeds the embryo with nutrients from the mother.

HERV-W ENV is highly expressed in the white blood cells of COVID-19 patients but not in those of healthy donors:

https://www.thelancet.com/journals/ebiom/article/PIIS2352-3964(21)00134-1/fulltext https://www.bloomberg.com/press-releases/2021-04-15/geneuro-researchers-detect-herv-w-env-in-covid-19-patients-and-link-expression-to-disease-severity

Why is this?

Because despite factually incorrect "debunkings", sequence motifs of SARS-CoV-2 clearly show high similarity to HERV-W. The alignments show that the S-CoV-2 spike protein & the envelope protein of HERV-W (also called syncytin-1) are directly related to one another.

The "debunkings" either try to debunk made-up claims of HERV-W itself being present in the vaccine, or feature Pfizer spokespeople purposefully employing straightforward sequence comparisons, which is NOT where the similarity lies; the parity is between sections of the β-pleated sheet:

https://virological.org/t/response-to-ncov2019-against-backdrop-of-endogenous-retroviruses/396

What are the effects of this?

The majority of the vaccines confer immunity based on an ability to recognise the covid spike glycoprotein, the spike protein's beta sheet comforms to that of HERV-W; thus, every tissue where HERV-W is expressed in the body will now be targeted by the white blood cells expressing HERV-W, as mentioned above in The Lancet. Think hard about where the side-effects of the vaccine are located in the body; blindness, bizarre menstruation, bloodclots, headaches, heart attack, vascular inflammation: in each of these places you will find HERV-W being utilised by the body.

Now with that knowledge read this carefully:

“The placentas look completely burnt out, just incredibly necrotic and damaged"

“There’s a very abnormal appearance to the surface of the placenta when it is cut for examination, with white streaks and nodules occupying large portions of the placental disk. It is a very uncommon finding that we would rarely see in routine practice."

https://www.the-scientist.com/news-opinion/doctors-investigate-several-stillbirths-among-moms-with-covid-19-68703

Doctors are also concerned about this:

https://bjgplife.com/2020/05/21/of-hervs-and-covid-19-questions-for-the-future/

"is that why COVID-19 has adverse effects on pregnancy and child birth?"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65361

File: efa322b23743f0e⋯.png (5.31 MB,2700x3200,27:32,Clipboard.png)

File: 146deeb022ec9db⋯.png (722.85 KB,1064x1850,532:925,Clipboard.png)

File: a37bcac958aaf98⋯.png (3.97 MB,1977x3400,1977:3400,Clipboard.png)

Originally posted at >>>/qresearch/13939373 (191915ZJUN21) Notable: Newsweek strikes again

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Updated this graphic that the Baker had deemed notable.

This is from a social media (formerly twitter now gab) account that claims to be a screenwriter who had a role in writing the movie we are currently watching.

He seems to be driving a narrative regarding Julian Assange and his quest for freedom. JA was an Elvis fan (See SURFRAW and ELVI). Plenty of coincidences and deltas.

Some other storyboards as well for those interested.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65362

File: 32eeca56d16ea2b⋯.png (668.96 KB,867x780,289:260,Clipboard.png)

Originally posted at >>>/qresearch/13939388 (191918ZJUN21) Notable: Preparation for Nationwide Summer Riot Control nearly complete ARIZONA AUDIT UPDATE – Dr. Kelli Ward: June 26th – More Leftist Lies DEBUNKED on “Montana Counting” and National Guard at the Scene (The Gateway Pundit, pjmedia.com)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/arizona-audit-update-dr-kelli-ward-june-26th-leftist-lies-debunked-montana-counting-national-guard-scene-video/

ARIZONA AUDIT UPDATE – Dr. Kelli Ward: June 26th – More Leftist Lies DEBUNKED on “Montana Counting” and National Guard at the Scene (VIDEO)

By Jordan Conradson

Published June 19, 2021 at 1:45pm

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65363

File: 4907b385264c963⋯.png (551.55 KB,771x771,1:1,Clipboard.png)

Originally posted at >>>/qresearch/13939398 (191919ZJUN21) Notable: Preparation for Nationwide Summer Riot Control nearly complete ARIZONA AUDIT UPDATE – Dr. Kelli Ward: June 26th – More Leftist Lies DEBUNKED on “Montana Counting” and National Guard at the Scene (The Gateway Pundit, pjmedia.com)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://pjmedia.com/news-and-politics/rick-moran/2021/06/19/portland-mayor-scrambles-as-fallout-from-mass-resignations-of-portland-riot-squad-begins-n1455730

Portland Mayor Scrambles as Fallout From Mass Resignations of Portland Riot Squad Begins

By Rick Moran Jun 19, 2021 10:03 AM ET

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65364

File: fa58ed122e0f737⋯.png (408.19 KB,652x648,163:162,Clipboard.png)

Originally posted at >>>/qresearch/13939404 (191920ZJUN21) Notable: Eyes on the prize… Boom boom boom boom… Reports

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Keep your eyes on the prize!

https://twitter.com/TheRealCVN71/status/1405555838291382274

>>>/qresearch/13939383

Notable

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65365

File: a55c833cd18e695⋯.png (262.16 KB,1003x468,1003:468,Clipboard.png)

Originally posted at >>>/qresearch/13939420 (191923ZJUN21) Notable: Confederate Gen. Nathan Bedford Forrest's polarizing presence has hung over Memphis since he moved here in 1852 — his legacy cemented by a giant statue that loomed over all who passed his gravesite in a popular park.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.npr.org/2021/06/19/1008371491/confederate-general-remains-memphis-moved

MEMPHIS, Tenn. (AP) — Confederate Gen. Nathan Bedford Forrest's polarizing presence has hung over Memphis since he moved here in 1852 — his legacy cemented by a giant statue that loomed over all who passed his gravesite in a popular park.

Now the former slave trader's remains are set to be moved to a new Confederate museum in Columbia, Tennessee — another milestone in the effort to remove statues, monuments, and now the remains, of Confederate leaders from public spaces.

As workers prepared to dig up his grave earlier this month, a white man waved a rebel flag, sang "Dixie" and launched an expletive-laced tirade at Shelby County Commissioner Tami Sawyer. Sawyer, who is Black, plucked Confederate flags off a chain-link fence surrounding the site as George Johnson paced behind her on a concrete platform.

When he cursed at her again, Sawyer replied: "It's not your property," and turned toward reporters gathered for the June 1 news conference.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65366

File: 2eb30efa5cf7748⋯.jpg (78.96 KB,827x765,827:765,Clipboard.jpg)

Originally posted at >>>/qresearch/13939426 (191923ZJUN21) Notable: Social Media Pedo Alert Hopefully the feds pulling for a sit down moment…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13939395

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65367

File: d0b1e10c8df249b⋯.png (52.28 KB,1039x399,1039:399,Clipboard.png)

Originally posted at >>>/qresearch/13939435 (191927ZJUN21) Notable: Newsweek strikes again

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

QAnon Believers Suggest Secret Message Behind Announcement of Biden Dog's Death

https://archive.ph/YUPqs

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65368

File: effb5ae6b5849d7⋯.png (685.48 KB,1382x1179,1382:1179,Clipboard.png)

Originally posted at >>>/qresearch/13939450 (191929ZJUN21) Notable: Muh Dekodes Expert Level

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

That's a whole lotta comms, Dan.

1:07 marker

FF

177

954

STURTUP = missing [A]

Enjoy the show.

Blackout necessary.

It's Happening!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65369

File: 0b976fc43e9f0e9⋯.png (786.41 KB,1508x1400,377:350,Clipboard.png)

Originally posted at >>>/qresearch/13939455 (191931ZJUN21) Notable: Muh Dekodes Expert Level

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65367

Every Dog has his day.

Hit 'em with the memes Anons.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65370

File: 1c23f19a88658d4⋯.png (6.4 MB,3600x3900,12:13,Clipboard.png)

Originally posted at >>>/qresearch/13939482 (191934ZJUN21) Notable: Muh Dekodes Expert Level

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65368

I know this Qclock was just notabled but a version that might have better resolution (is the original).

Was a big marker. Upcoming in a week.

Today is :30.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65371

File: 3602c340549b6ea⋯.png (187.25 KB,953x426,953:426,Clipboard.png)

Originally posted at >>>/qresearch/13939521 (191941ZJUN21) Notable: Pedobait for kids “We’re going to toe that line, you know what I mean? It’s not going to be super-raw,” Actor Jerry Trainor, who returns as older brother Spencer Shay in the Paramount+ iCarly reboot, promises that at least one of the characters is going to have sex.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

“We’re going to toe that line, you know what I mean? It’s not going to be super-raw,”

Actor Jerry Trainor, who returns as older brother Spencer Shay in the Paramount+ iCarly reboot, promises that at least one of the characters is going to have sex.

https://www.avclub.com/jerry-trainor-confirms-that-there-will-be-sexual-situa-1847109587

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65372

File: 319d6d55c98fcb1⋯.png (4.89 MB,3000x3000,1:1,Clipboard.png)

File: 718d734cab0f2ce⋯.png (5.3 MB,3000x3000,1:1,Clipboard.png)

File: e2f58a3c378c0af⋯.png (4.03 MB,3000x3000,1:1,Clipboard.png)

Originally posted at >>>/qresearch/13939564 (191947ZJUN21) Notable: Muh Dekodes Expert Level

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13939539

HISTORY

JUSTICE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65373

File: ffa255611108237⋯.png (152.32 KB,535x704,535:704,Clipboard.png)

File: 77f5890950a2f6f⋯.jpg (67.81 KB,800x350,16:7,Clipboard.jpg)

Originally posted at >>>/qresearch/13939607 (191954ZJUN21) Notable: Defense Minister #BennyGantz will submit a resolution proposing the establishment of a state commission of inquiry into the purchase of the submarines and vessels, his office announced on Saturday night. #Case3000

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Defense Minister #BennyGantz will submit a resolution proposing the establishment of a state commission of inquiry into the purchase of the submarines and vessels, his office announced on Saturday night. #Case3000

https://twitter.com/Jerusalem_Post/status/1406325591717056514

>>>/qresearch/13939520

>Think tesseract.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65374

File: 8426f178c87e43f⋯.mp4 (3.02 MB,480x852,40:71,Clipboard.mp4)

Originally posted at >>>/qresearch/13939619 (191956ZJUN21) Notable: Pay Attention People.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Q conspiracy factuals go mainstream

https://twitter.com/adridakoda/status/1406337734659223552

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65375

File: ff15f08197c667f⋯.png (28.95 KB,936x201,312:67,Clipboard.png)

Originally posted at >>>/qresearch/13939630 (191958ZJUN21) Notable: Georgia secretary of state removes 100,000 'outdated' voter files

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.washingtonexaminer.com/news/georgia-brad-raffensperger-removes-outdated-voter-files

Georgia secretary of state removes 100,000 'outdated' voter files

by Kaelan Deese, Breaking News Reporter |

| June 19, 2021 02:51 PM

Georgia's secretary of state is poised to remove more than 100,000 "outdated" names from the state's voter registration rolls unless those on the list take immediate action.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65376

File: aece8ae9403b1e8⋯.png (1.8 MB,1242x2688,207:448,Clipboard.png)

File: b8acb6fc6a796b3⋯.png (2.06 MB,1242x2688,207:448,Clipboard.png)

File: f5b1e7b45bb81ad⋯.jpeg (352.12 KB,1242x2269,1242:2269,Clipboard.jpeg)

Originally posted at >>>/qresearch/13939646 (192001ZJUN21) Notable: PF Reporting

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Planefag

When do you need a TRUCK?

After a score ? Someone moving?

2 E6 up TRUCK91 & SCORE73 reminds me of that Q74 fire truck one drop has TRUCK in it

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65377

File: 2cea19d80b33864⋯.png (13.08 KB,669x278,669:278,Clipboard.png)

Originally posted at >>>/qresearch/13939650 (192002ZJUN21) Notable: NSA Agrees To Release Records On FBI's Improper Spying On 16,000 Americans

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

NSA Agrees To Release Records On FBI's Improper Spying On 16,000 Americans

The National Security Agency (NSA) has agreed to release records on the FBI’s improper spying on thousands of Americans, the secretive agency disclosed in a recent letter.

The agreement may signal a rift between the NSA and the FBI, according to attorney Ty Clevenger.

Clevenger last year filed a Freedom of Information Act (FOIA) request on behalf of The Transparency Project, a Texas nonprofit, seeking information on the FBI’s improper searches of intelligence databases for information on 16,000 Americans.

The searches violated rules governing how to use the U.S. government’s foreign intelligence information trove, U.S. District Judge James Boasberg, an Obama nominee who currently presides over the Foreign Intelligence Surveillance Court, wrote in a 2019 memorandum and order that was declassified last year.

The FBI insisted that the queries for all 16,000 people “were reasonably likely to return foreign-intelligence information or evidence of a crime because [redacted],” Boasberg wrote. But the judge found that position “unsupportable,” apart from searches on just seven of the people.

Still, Boasberg allowed the data collection to continue, prompting Elizabeth Goitein, co-director of the Liberty and National Security Program at the Brennan Center for Justice, to lament that court’s decision on the data collection program, authorized by Section 702 of the Foreign Intelligence Surveillance Act (FISA), “is even more inexplicable given that the opinion was issued shortly after the government reported submitting FISA applications riddled with errors and omissions in the Carter Page investigation.”

Page was a campaign associate of then-candidate Donald Trump who was illegally surveilled by the FBI.

After the judge’s order was made public, Clevenger filed FOIA requests for information on the improper searches with both the FBI and the NSA.

The FBI rejected the request. In a February letter (pdf), an official told Clevenger that the letter he wrote “does not contain enough descriptive information to permit a search of our records.”

The NSA initially declined the request as well, but later granted an appeal of the decision, Linda Kiyosaki, an NSA official, said in a letter (pdf) this month.

“You had requested all documents, records, and other tangible evidence reflecting the improper surveillance of 16,000 individuals described in a 6 December, 2019, FISC Opinion,” Kiyosaki wrote.

Clevenger believes the NSA’s new position signals a rift between the two agencies, potentially because the FBI has repeatedly abused rules governing searches of the intelligence databases while the NSA has largely not.

https://www.zerohedge.com/political/nsa-agrees-release-records-fbis-improper-spying-16000-americans

https://www.theepochtimes.com/nsa-agrees-to-release-records-on-fbis-improper-spying-on-16000-americans_3865431.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65378

File: 73611a73d82b093⋯.png (450.63 KB,652x683,652:683,Clipboard.png)

Originally posted at >>>/qresearch/13939655 (192003ZJUN21) Notable: It's Storm Season!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Tropical Storm Claudette crashes into Gulf Coast

https://twitter.com/nypost/status/1406328458507173892

When´s the Big one?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65379

File: f97772a6d142050⋯.png (234 KB,865x533,865:533,Clipboard.png)

Originally posted at >>>/qresearch/13939656 (192003ZJUN21) Notable: NSA Agrees To Release Records On FBI's Improper Spying On 16,000 Americans

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.zerohedge.com/political/nsa-agrees-release-records-fbis-improper-spying-16000-americans

NSA Agrees To Release Records On FBI's Improper Spying On 16,000 Americans

Tyler Durden's Photo

by Tyler Durden

Saturday, Jun 19, 2021 - 03:30 PM

Authored by Zachary Stieber via The Epoch Times,

The National Security Agency (NSA) has agreed to release records on the FBI’s improper spying on thousands of Americans, the secretive agency disclosed in a recent letter.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65380

Originally posted at >>>/qresearch/13939705 (192010ZJUN21) Notable: KUWAIT CITY: The Pentagon said Friday (Saturday in Manila) it was cutting the number of troops and air defense units deployed to the Middle East, confirming a Wall Street Journal report that eight Patriot batteries were being moved out from the region.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.manilatimes.net/2021/06/20/news/world/us-cuts-military-aid-to-iraq-kuwait-saudi/1803914

KUWAIT CITY: The Pentagon said Friday (Saturday in Manila) it was cutting the number of troops and air defense units deployed to the Middle East, confirming a Wall Street Journal report that eight Patriot batteries were being moved out from the region.

The move comes as President Joe Biden's administration seeks to ease tensions with Iran after they heated up in 2019 and saw a strong escalation in the US military presence across the region.

The Wall Street Journal said the Patriot anti-missile batteries were being removed from Iraq, Kuwait, Jordan and Saudi Arabia, and that a separate anti-missile system, called Thaad, was being transferred from Saudi Arabia as well.

Pentagon spokesperson Commander Jessica McNulty said that some of the units were being redeployed to other countries and some were returning to the United States for maintenance.

She would not say where the redeployed units were being moved to. "This decision was made in close coordination with host nations and with a clear eye on preserving our ability to meet our security commitments," she said in an email.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65381

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13939708 (192010ZJUN21) Notable: Crypto Digital Fiat and Global Financial Futures Versus Physical Fiat Currency and Global Financial Present Credit Transition

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Posted a few days ago - didn't get a lot of eyes on it.

So Anthony Scaramucci comes onto a crypto show Anon watches regularly today. We know Mooch is a douche. He is however shilling bitcoin which Anon is OK with. They begin talking about the whole fed system and how it’s broken how are you gonna fix it? Start at 30 min mark or so. In a nutshell here’s his model:

Big corps now have forced diversity in the boardroom.

When Georgia changed the voting laws, these new boards with brown/black nignogs/muhwahmans - these corps all said no, we’re not gonna screw my [insert group]. Basically this will cause a rude awakening at the ‘tippy top’ (yes he said that) 31.23 minute mark. Scaramucci model.

Then I see the LDR post also. Conclusion: diversity in the CEO's & diversity in the board rooms. Evil. Shit's gonna lead to no good. We need to resist this shit NOW! Diverse representation is an overdiverse evil representation versus the population!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65382

File: c3fe0244e337926⋯.png (221.38 KB,357x774,119:258,Clipboard.png)

Originally posted at >>>/qresearch/13939712 (192011ZJUN21) Notable: Crypto Digital Fiat and Global Financial Futures Versus Physical Fiat Currency and Global Financial Present Credit Transition

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65381

LDR post

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65383

File: 4d08511ec48a69b⋯.png (4.67 MB,889x6735,889:6735,Clipboard.png)

Originally posted at >>>/qresearch/13939713 (192011ZJUN21) Notable: Feds accused of seizing $85 million from safe deposit boxes without 'any legal basis'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Feds accused of seizing $85 million from safe deposit boxes without 'any legal basis'

It says, "U.S. Private Vaults was raided after an indictment for conspiracy to sell drugs"

I'd bet money the conspirator selling drugs was the very FBI raiding U.S. Private Vaults.

The FBI/DOJ/CIA make up the crime, commit the crime then raid/interrogate/arrest/jail/prosecute whoever they like for that made up crime.

Just like the FDA/CDC/NIH/NIAID find a virus/bacteria; manipulate said virus/bacteria; patent said virus/bacteria; come up with a vaccine for said virus/bacteria; patent the vaccine to said virus/bacteria and then release the virus/bacteria

Then they all sit back and watch the money roll in or in the case of this story, take other people's cash/precious metals/heirlooms-still watching the money roll in…

https://justthenews.com/accountability/watchdogs/feds-accused-seizing-85-million-safe-deposit-boxes-without-any-legal-basis

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65384

File: bda54c09c65d57e⋯.png (412.34 KB,652x709,652:709,Clipboard.png)

Originally posted at >>>/qresearch/13939715 (192011ZJUN21) Notable: CIA veterans explain how they used spy tactics to raise their kids

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CIA veterans explain how they used spy tactics to raise their kids

https://twitter.com/nypost/status/1406241103997669379

>>>/qresearch/13939433

>>>/qresearch/13939672

>>>/qresearch/13939710

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65385

Originally posted at >>>/qresearch/13939728 (192013ZJUN21) Notable: Feds accused of seizing $85 million from safe deposit boxes without 'any legal basis'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65383

"U.S. Private Vaults was raided after an indictment for conspiracy to sell drugs"

I'd bet money the conspirator selling drugs was the very FBI raiding U.S. Private Vaults.

The FBI/DOJ/CIA make up the crime, commit the crime then raid/interrogate/arrest/jail/prosecute whoever they like for that made up crime.

Just like the FDA/CDC/NIH/NIAID find a virus/bacteria; manipulate said virus/bacteria; patent said virus/bacteria; come up with a vaccine for said virus/bacteria; patent the vaccine to said virus/bacteria and then release the virus/bacteria

Then they all sit back and watch the money roll in or in the case of this story, take other people's cash/precious metals/heirlooms-still watching the money roll in…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65386

Originally posted at >>>/qresearch/13939777 (192024ZJUN21) Notable: Rep. Thomas Massie slams Fauci and CDC for COVID-19 'coverup': 'One of the biggest scandals during this whole pandemic'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Rep. Thomas Massie slams Fauci and CDC for COVID-19 'coverup': 'One of the biggest scandals during this whole pandemic'

Rep. Thomas Massie (R-Ky.) shut down a reporter who demanded to know the congressman's vaccination status during a press conference. Massie also blasting Dr. Anthony Fauci and the Centers for Disease Control and Prevention for an alleged "coverup" of natural immunity.

While advocating that Americans get the coronavirus vaccine, Massie also touted the effectiveness of natural immunity, adding that the critical voices in U.S. health have downplayed "natural protection" to those who had already been infected with COVID-19.

"One of the biggest scandals during this whole pandemic is the coverup that's been committed by Dr. Fauci and the [Centers for Disease Control and Prevention] — especially the CDC — about the effectiveness of immunity that's conferred after a natural infection, after you've recovered from [COVID], they've completely ignored that," Massie said during a news conference earlier this week. "They want everybody to get vaccinated, even those who don't need [to be] vaccinated."

Massie said to "follow the science," and cited the Moderna trials that he said showed "no benefit of the vaccine to those who recovered from infection." He then noted that the trials of the Pfizer COVID-19 vaccine "showed there was no benefit to those who had recovered from infection."

"I'm not saying go out and get the virus instead of getting the vaccine. The vaccine can save lives, it's certain," Massie stated. "But there's no need…to get the vaccine if you've already recovered from COVID. There's no need to expose yourself to that danger."

Massie referred to a five-month study from the Cleveland Clinic on 52,238 employees, which found that "none of the previously infected employees who remained unvaccinated were re-infected over the duration of the study."

The CDC website states: "Getting COVID-19 may offer some natural protection, known as immunity. Current evidence suggests that reinfection with the virus that causes COVID-19 is uncommon in the 90 days after initial infection. However, experts don't know for sure how long this protection lasts, and the risk of severe illness and death from COVID-19 far outweighs any benefits of natural immunity."

A reporter asked Massie if he had been vaccinated, to which he barked back, "Well, first of all, it's none of your business, but I'm gonna tell you."

"I'm not vaccinated, and until there's some science—by the way I have a master's of science degree from MIT, I'm not a virologist but I can read data," the congressman, who earned a master's degree in mechanical engineering from the Massachusetts Institute of Technology, said. "Everybody just needs to read. Don't put your head in the sand. Look at the data."

"I'm not gonna get the vaccine until there's data that shows that it will improve upon the immunity that's been conferred to me as a result of a natural infection that I had," Massie explained.

#nunya, the full clip. https://t.co/tjTBdjZCfn

— Thomas Massie (@Thomas Massie)1623970522.0

In August 2020, Massie announced that he had recovered from COVID-19 and tested positive for antibodies, which prompted him to donate plasma.

Massie made his comments during a press conference about the House Republican-sponsored Fire Fauci Act, which reduces the salary of Fauci, the director of the National Institute of Allergy and Infectious Diseases, and calls for an examination of his correspondences and expenditures during the COVID-19 pandemic. Fauci is the highest-paid federal government employee, reportedly raking in $417,608 in 2019.

https://www.theblaze.com/news/thomas-massie-covid-immunity-cdc-fauci

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65387

Originally posted at >>>/qresearch/13939800 (192029ZJUN21) Notable: WH Freezing Security Assistance?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Did they just accuse Politico of working for the Russians

https://www.mil.gov.ua/news/2021/06/19/rosiya-vede-vijnu-proti-nas-na-vsih-frontah-u-tomu-chisli-informaczijnomu-andrij-taran-pro-fejki-shhodo-nibito-zamorozhennya-amerikanskoi-dopomogi-ukraini/

Information about the alleged freezing of security assistance by the United States of America has become widespread in the media. It was promptly refuted by officials of the American side. White House spokeswoman Jennifer Psaki, on Friday, June 18, without picking up words, called these rumors "nonsense."

"The idea that we have curbed security assistance to Ukraine is nonsense. Just last week, on the eve of the Summit between Russia and the United States, we provided a $150 million aid package, including lethal means. We have provided all the amount approved by Congress as part of the security assistance initiative in Ukraine. Two days before the Summit, President Biden took to the stage in front of the world in NATO and said that we would continue to support Ukraine "in the ability to withstand Russian aggression."

Minister of Defense of Ukraine Andriy Taran also commented on the situation. "It is not surprising when the so-called "media" of the aggressor state work out tasks for information operations. They are an unsuitable weapon of the Russian military machine. It is surprising and regretful when some domestic media, including those that consider themselves to be high-quality resources, are provocative, do not check the content and sources of this kind of information, and become a blind tool of information warfare in the hands of the enemy," he said.

https://112.international/politics/provocation-of-russia-defense-ministry-reacts-to-information-about-delay-in-us-military-aid-62443.html

Earlier, Politico reported that the White House temporarily froze a $ 100,000 package of military aid to Ukraine. The package included lethal weapons. It was allegedly frozen ahead of a meeting between President Joe Biden and Russian leader Vladimir Putin.

Later, the White House said that information about the suspension of security assistance to Ukraine is absurd.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65388

File: a79c5b4f47e23bc⋯.mp4 (4.45 MB,1280x720,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13939889 (192051ZJUN21) Notable: Lookit Mister Tough Guy Over Here!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13939879

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65389

File: c5a4b6cd2374821⋯.png (428.38 KB,614x590,307:295,Clipboard.png)

Originally posted at >>>/qresearch/13939906 (192054ZJUN21) Notable: …Russell Brand 'devastated' after his German Shepherd mauls wallaby to death….

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Russell Brand 'devastated' after his German Shepherd mauls wallaby to death

https://twitter.com/PageSix/status/1406353793369968643

SO MANY DOG COMMS TODAY

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65390

File: 7db5b32ae10fffc⋯.jpg (56.24 KB,731x554,731:554,Clipboard.jpg)

Originally posted at >>>/qresearch/13939954 (192104ZJUN21) Notable: Bill Clinton Military Tribunal: Day 1

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Bill Clinton Military Tribunal: Day 1

https://realrawnews com/2021/06/bill-clinton-military-tribunal-day-1/

This board is comped, "Q" will not be posting here until the kitchen is cleaned out from the scum…you have been warned!!!

Replace/Ban the BAKER UNION(SHILLS) or let it E-Bake and PATRIOTS will fill in the NOTABLES…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65391

File: f2ba1e37836238f⋯.gif (5.84 MB,320x313,320:313,Clipboard.gif)

Originally posted at >>>/qresearch/13939972 (192108ZJUN21) Notable: #17644, #17645, #17646

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13939196 Dough

Notables Are NOT Endorsements

#17644

>>65357, >>65360 '''Misleading Title for an article supportive of hydroxychloroquine… "Dr. McCullough: COVID Vaccines Have Already Killed Up to 50,000 Americans, According to Whistleblowers" + Related (Hydroxychloroquine, Vaccine, COVID, Various)

>>65358 WITZKE: ‘I WILL Be Pursuing Legal Action’ Against Wells Fargo, ‘We’re Fighting Back’ (National File)

>>65359 Questions About the FBI's Role in 1/6 Are Mocked Because the FBI Shapes Liberal Corporate Media (greenwald.substack.com)

>>65361, >>65367 Newsweek strikes again

>>65362, >>65363 Preparation for Nationwide Summer Riot Control nearly complete ARIZONA AUDIT UPDATE – Dr. Kelli Ward: June 26th – More Leftist Lies DEBUNKED on “Montana Counting” and National Guard at the Scene (The Gateway Pundit, pjmedia.com)

>>65364 Eyes on the prize… Boom boom boom boom… Reports

>>65365 Confederate Gen. Nathan Bedford Forrest's polarizing presence has hung over Memphis since he moved here in 1852 — his legacy cemented by a giant statue that loomed over all who passed his gravesite in a popular park.

>>65366 Social Media Pedo Alert Hopefully the feds pulling for a sit down moment…

>>65368, >>65369, >>65370, >>65372 Muh Dekodes Expert Level

>>65371 Pedobait for kids “We’re going to toe that line, you know what I mean? It’s not going to be super-raw,” Actor Jerry Trainor, who returns as older brother Spencer Shay in the Paramount+ iCarly reboot, promises that at least one of the characters is going to have sex.

>>65373 Defense Minister #BennyGantz will submit a resolution proposing the establishment of a state commission of inquiry into the purchase of the submarines and vessels, his office announced on Saturday night. #Case3000

>>65374 Pay Attention People.

>>65375 Georgia secretary of state removes 100,000 'outdated' voter files

>>65376 PF Reporting

>>65377, >>65379 NSA Agrees To Release Records On FBI's Improper Spying On 16,000 Americans

>>65378 It's Storm Season!

>>65380 KUWAIT CITY: The Pentagon said Friday (Saturday in Manila) it was cutting the number of troops and air defense units deployed to the Middle East, confirming a Wall Street Journal report that eight Patriot batteries were being moved out from the region.

>>65381, >>65382 Crypto Digital Fiat and Global Financial Futures Versus Physical Fiat Currency and Global Financial Present Credit Transition

>>65383, >>65385 Feds accused of seizing $85 million from safe deposit boxes without 'any legal basis'

>>65384 CIA veterans explain how they used spy tactics to raise their kids

>>65386 Rep. Thomas Massie slams Fauci and CDC for COVID-19 'coverup': 'One of the biggest scandals during this whole pandemic'

>>65387 WH Freezing Security Assistance?

>>65388 Lookit Mister Tough Guy Over Here!

>>65389 …Russell Brand 'devastated' after his German Shepherd mauls wallaby to death….

>>65390 Bill Clinton Military Tribunal: Day 1

#17644

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65392

Originally posted at >>>/qresearch/13940099 (192132ZJUN21) Notable: Military Promotions, Nominations, Appointments, and Recognitions

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Vice Adm. William R. Merz, U.S. Navy, has been nominated for reappointment to the rank of vice admiral and assignment as deputy chief of Naval Operations for Operations, Plans and Strategy, N3/N5, Office of the Chief of Naval Operations, Washington, D.C. Merz is currently serving as commander, SEVENTH Fleet, Yokosuka, Japan.

Rear Adm. Francis D. Morley, U.S. Navy, has been nominated for appointment to the rank of vice admiral and assignment as principal military deputy assistant secretary of the Navy (Research, Development, and Acquisition), Washington, D.C. Morley is currently serving as director, Navy International Programs Office, Office of the Secretary of the Navy, Washington, D.C.

Rear Adm. Darse E. Crandall, Judge Advocate General Corps, U.S. Navy, for appointment to the rank of vice admiral and assignment as Judge Advocate General of the Navy, Washington, D.C. Crandall is currently serving as deputy Judge Advocate General of the Navy/commander, Naval Legal Service Command, Washington, D.C.

Capt. Max G. McCoy, Jr., has been nominated for appointment to the rank of rear admiral (lower half). McCoy is currently serving as commander, Naval Aviation Warfighting Development Center, Fallon, Nevada.

https://www.defense.gov/Newsroom/Releases/Release/Article/2663305/flag-officer-announcements/

Colonel Lanny J. Acosta, Jr., U.S. Army, has been designated as Chief Trial Judge for the Military Commissions Trial Judiciary with an effective date of July 1, 2021.

Col. Acosta replaces Col. Douglas K. Watkins, the current Chief Trial Judge, who will retire from the Army July 31.

The Chief Trial Judge assigns military judges to preside over each military commissions case referred to trial.

For more information about the Office of Military Commissions, visit https://www.mc.mil.

https://www.defense.gov/Newsroom/Releases/Release/Article/2662266/chief-trial-judge-named-for-military-commissions/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65393

Originally posted at >>>/qresearch/13940103 (192132ZJUN21) Notable: Military Promotions, Nominations, Appointments, and Recognitions

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65392

10th United States – Mexico Defense Bilateral Working Group Discuss Bilateral Defense Cooperation

JUNE 18, 2021

On June 17, 2021, Under Secretary for Policy, Dr. Colin Kahl, and Under Secretary of Defense for Intelligence and Security, Mr. Ronald Moultrie, co-hosted the tenth meeting of the United States – Mexico Bilateral Defense Working Group with Major General Ricardo Trevilla Trejo, Chief of Staff of the Mexican Secretariat of National Defense (SEDENA) and Vice Admiral Luis Javier Robinson Portillo Villanueva Chief of Staff of the Mexican Secretariat of the Navy (SEMAR). The Defense Bilateral Working Group is the bilateral defense component of United States – Mexico high level cooperation efforts.

The co-chairs established mutual objectives, lines of effort and priorities to address the shared bilateral and transnational challenges facing our region. The co-chairs recognized that North America has regional responsibilities and complex challenges are best addressed by collaborative and cooperative responses. Together with the supporting Defense Bilateral Strategic Framework, the Defense Bilateral Working Group provides a process for bilateral cooperation between the United States and Mexico's defense institutions. The purpose is to build a common understanding of challenges and to identify and implement initiatives to promote bilateral defense cooperation.

The co-chairs agreed to expand U.S. and Mexican defense cooperation; advance bilateral capability to address mutually identified regional defense challenges; expand bilateral support and cooperation for regional defense cooperation activities; and, exchange lessons-learned and best practices.

https://www.defense.gov/Newsroom/Releases/Release/Article/2663447/10th-united-states-mexico-defense-bilateral-working-group-discuss-bilateral-def/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65394

File: 57ef5111381eedf⋯.png (601.66 KB,828x1792,207:448,Clipboard.png)

Originally posted at >>>/qresearch/13940130 (192138ZJUN21) Notable: Military Promotions, Nominations, Appointments, and Recognitions

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65392

>designated as Chief Trial Judge for the Military Commissions Trial Judiciary with an effective date of July 1, 2021.

No quarters for enemy combatants, open season on fake news media 😂

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65395

Originally posted at >>>/qresearch/13940198 (192156ZJUN21) Notable: FNC’s Carlson: FBI’s Focus on ‘Joe Biden’s Political Opponents’ a Nightmare for Civil Liberties, Threat to Democracy

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

FNC’s Carlson: FBI’s Focus on ‘Joe Biden’s Political Opponents’ a Nightmare for Civil Liberties, Threat to Democracy

https://www.breitbart.com/politics/2021/06/19/fncs-carlson-fbis-focus-on-joe-bidens-political-opponents-a-nightmare-for-civil-liberties-threat-to-democracy/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65396

File: 976702b95c25980⋯.png (212.54 KB,789x558,263:186,Clipboard.png)

Originally posted at >>>/qresearch/13940239 (192209ZJUN21) Notable: Here's the Reason for the Monumental Collapse of Nickelodeon

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.newsbusters.org/blogs/nb/matt-norcross/2021/06/19/heres-reason-monumental-collapse-nickelodeon

Here's the Reason for the Monumental Collapse of Nickelodeon

Matt Norcross

June 19th, 2021 2:45 PM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65397

File: ab1653fe803eb14⋯.png (254.87 KB,857x596,857:596,Clipboard.png)

Originally posted at >>>/qresearch/13940273 (192219ZJUN21) Notable: Commie Party in Commiefornia Ahead of Summer Riots after the Scheduled Annual Wildfires Conceived Near Roadsides.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/george-soros-interested-funding-reparations-program-los-angeles-according-report/

George Soros Interested in Funding Reparations Program in Los Angeles, According to Report

By Cassandra Fairbanks

Published June 19, 2021 at 5:00pm

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65398

Originally posted at >>>/qresearch/13940283 (192222ZJUN21) Notable: Speaking of roadside… Trump sign Location Quake epicenter or fake news?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13940263

Link has a video of the sign, but doesn't specify the exact location.

A large “Trump” sign that appeared overnight in the Sepulveda Pass hills near the 405 Freeway was promptly taken down by authorities Tuesday morning.

The sign was made of large white capital letters similar to those of the iconic Hollywood sign and was reportedly spotted just before 7 a.m.

There’s little information about who placed the sign, but Lauren Wonder, chief public information officer for the California Department of Transportation, said it was on private property.

https://www.latimes.com/california/story/2020-10-06/trump-sign-appears-and-swiftly-disappears-in-sepulveda-pass

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65399

File: 3515312b7cde0aa⋯.png (275.91 KB,614x586,307:293,Clipboard.png)

Originally posted at >>>/qresearch/13940287 (192223ZJUN21) Notable: Dan TapDancin' Man: Bust the Moves

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/DanScavino/status/1406376175895724032

From

Steve Inman

11:19 AM · Jun 19, 2021·

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65400

Originally posted at >>>/qresearch/13940333 (192236ZJUN21) Notable: AZ AUDIT – Randy Pullen: “THE REPORT IS GOING TO COME OUT AND THERE IS NO DOUBT THAT IT WILL BE CHALLENGED”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

AZ AUDIT – Randy Pullen: “THE REPORT IS GOING TO COME OUT AND THERE IS NO DOUBT THAT IT WILL BE CHALLENGED”

The Arizona Audit continues today with paper evaluation, counting Braille ballots, signature verification, and quality control checks to ensure the final report will stand in court when the findings are released. The paper examination will be completed by June 26.

The Gateway Pundit’s Jordan Conradson spoke to audit spokesperson, Randy Pullen to ask about the next steps after the Coliseum lease ends in June. Randy told him that once they’re finished examining ballots, they will produce the final report.

Randy said, “The report is going to come out and there is no doubt that it will be challenged.”

Obviously, the Arizona Senate and Trump supporters will be satisfied when this exceedingly secure and transparent, in-depth full forensic audit is finalized. Trump’s team will not have a challenge no matter what is found. We will finally know the truth about 2020 after this audit is completed.

Recently on John Fredricks Outside the Beltway, Ken Bennett cited “fifty-two people voting from a two-bedroom home somewhere, or people voting twice, or dead people voting” while speaking about the irregularities they are finding.

The only group expected to challenge the outcome of the Senate’s audit is the left. They are expected to object to the audit unless it’s favorable to them.

They have already thrown everything they’ve got legally at this audit to prevent us from finding the results.

This is very telling of what we can expect to find in the coming months.

https://www.thegatewaypundit.com/2021/06/az-audit-randy-pullen-report-going-come-no-doubt-will-challenged/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65401

Originally posted at >>>/qresearch/13940336 (192237ZJUN21) Notable: BLDM The BLM SCAM! Dignity and Power Now, a group started by former BLM boss Khan-Cullors in 2013, raked in hundreds of thousands in donations but claimed otherwise to the IRS, public documents show.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Nonprofit tied to Patrisse Cullors failed to disclose significant donations

Another nonprofit started by Blacks Lives Matter co-founder Patrisse Khan-Cullors has some fishy finances.

Dignity and Power Now, a group started by former BLM boss Khan-Cullors in 2013, raked in hundreds of thousands in donations but claimed otherwise to the IRS, public documents show.

https://nypost.com/2021/06/19/nonprofit-tied-to-patrisse-cullors-failed-to-disclose-donations/

https://archive.ph/ZYdgG

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65402

File: 1c75bb3b3a678cb⋯.png (552.21 KB,862x604,431:302,Clipboard.png)

Originally posted at >>>/qresearch/13940347 (192239ZJUN21) Notable: Governor Vetoes Funding For Texas Legislature After Showdown Over Voting Reform

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://dailycaller.com/2021/06/19/texas-governor-voting-reform-legislature-funding/

Governor Vetoes Funding For Texas Legislature After Showdown Over Voting Reform

Alex Asgari

Contributor

June 19, 2021 2:48 PM ET

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65403

File: 6b7ff6e71202294⋯.png (255.82 KB,475x798,25:42,Clipboard.png)

Originally posted at >>>/qresearch/13940362 (192242ZJUN21) Notable: Australia Takes China To WTO Over Wine Tariffs As Biggest Export Market Gutted

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Australia Takes China To WTO Over Wine Tariffs As Biggest Export Market Gutted

Australia continues reeling from its ongoing trade war with China, lately seeing retaliatory tariffs cause the price of wine to double or triple in China, essentially wiping out Australia's biggest export market.

And now the Aussie government is lodging a formal complaint with the World Trade Organization - specifically over its imposition of anti-dumping duties on Australian wines.

Saturday's announcement marks yet another major escalation, with minister for trade, tourism and investment Dan Tehan stating alongside Agriculture Minister David Littleproud: "The government will continue to vigorously defend the interests of Australian wine makers using the established system in the WTO to resolve our differences."

Canberra further said the decision comes after "extensive consultation with Australia’s winemakers" and added that "Australia remains open to engaging directly with China to resolve this issue."

Tehan further told a public broadcaster: "We’ve always said that we would take a very principled approach when dealing with these trade disputes, and if we think our industry has been harmed or injured we will take all necessary steps and measures to try to address that."

The ongoing tensions were triggered last year after Canberra started seeking a probe into the ongoing COVID-19 pandemic, now no doubt exacerbated by calls for investigating Wuhan's labs lately going mainstream among Western allies. The demand led the Chinese diplomats in Australia hinting at "economic coercion" of Australian goods by Chinese companies.

Saturday's complaint to the WTO follows last year's formal appeal to the global trade dispute body over China's imposition of steep tariffs on imports of Australian barley.

Australia has since the whole spat started endured severe collateral damage on everything from seafood to coal to barley to wine to beef, and tourism sectors - along with hitting some other commodities, even timber.

Canberra has frequently voiced its "readiness" to resume dialogue with Beijing yet there's been no substantial breakthrough, particularly as the US has pushed its allies - most recently at the G7 summit in the UK - to take a tougher line on rolling back China's influence.

https://www.zerohedge.com/commodities/australia-takes-china-wto-over-wine-tariffs-biggest-export-market-gutted

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65404

File: 048b83379c14761⋯.png (1.11 MB,886x4663,886:4663,Clipboard.png)

Originally posted at >>>/qresearch/13940365 (192243ZJUN21) Notable: AZ AUDIT – Randy Pullen: “THE REPORT IS GOING TO COME OUT AND THERE IS NO DOUBT THAT IT WILL BE CHALLENGED”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

AZ Senate wants to dismiss bid to access audit documents

PHOENIX — Senate President Karen Fann is taking the position that Arizona courts cannot force her or any other member of the Arizona Legislature to comply with the state’s Public Records Act.

In a new court filing, attorney Kory Langhofer who represents the Prescott Republican and the entire Senate, is asking Maricopa County Superior Court Judge Michael Kemp to throw out a claim by a self-described nonpartisan watchdog group to get access to all documents and materials related to the Senate’s audit of the 2020 election results.

https://www.havasunews.com/news/senate-wants-to-dismiss-bid-to-access-audit-documents/article_4e2c7bc0-d0c2-11eb-8f78-4ff70e70e848.html

https://archive.ph/7zzpT

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65405

File: 54509cf12967544⋯.png (215.81 KB,652x660,163:165,Clipboard.png)

File: 084a1ed02995f73⋯.png (48.03 KB,687x205,687:205,Clipboard.png)

Originally posted at >>>/qresearch/13940371 (192243ZJUN21) Notable: "Is this the pen Ben-Gurion used to sign the Declaration of Independence?"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Is this the pen Ben-Gurion used to sign the Declaration of Independence?

https://twitter.com/TimesofIsrael/status/1406380034491772930

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65406

File: fd3f242dadc2915⋯.png (140.35 KB,838x793,838:793,Clipboard.png)

Originally posted at >>>/qresearch/13940421 (192250ZJUN21) Notable: Pennsylvania Man Charged With Using Identities Of Then-President’s Family Members To Perpetrate Online Fraud Scheme

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Pennsylvania Man Charged With Using Identities Of Then-President’s Family Members To Perpetrate Online Fraud Scheme

Audrey Strauss, the United States Attorney for the Southern District of New York, and William F. Sweeney, Jr., Assistant Director-in-Charge of the New York Office of the Federal Bureau of Investigation (“FBI”), announced the unsealing of a Complaint charging JOSHUA HALL with fraud and identity theft offenses for impersonating family members of the then-President of the United States on social media to fraudulently raise funds for a fictitious political organization.

HALL was arrested this morning and will be presented later today in Harrisburg federal court before United States Magistrate Judge Susan E. Schwab.

Manhattan U.S. Attorney Audrey Strauss said: “Joshua Hall allegedly impersonated family members of the then-President of the United States on social media to fraudulently induce hundreds of victims to donate to a political organization that did not exist, and then pocketed those funds for his own use. We thank the FBI for their partnership in the investigation of this case, and we remain dedicated to rooting out and prosecuting fraud wherever we find it.”

FBI Assistant Director-in-Charge William F. Sweeney, Jr., said: “Hall led hundreds of people to believe they were donating to an organization that didn’t exist by pretending to be someone he wasn’t, as alleged. As we continue to investigate fraud in all its many forms, we urge the public to remain aware of the prevalence of online scams and exercise due diligence when making donations online.”

Central to the scheme was the impersonation by HALL of members of the President’s family, including the President’s minor child, among others, through his creation and use of social media accounts bearing those family members’ names and photographs. HALL used those accounts to amass more than 100,000 followers on social media and obtain media coverage, a public platform he then exploited to confer on himself and the Fictitious Political Organization a false imprimatur of close ties with the President’s family and to encourage victims to make monetary contributions to the Fictitious Political Organization.

https://www.justice.gov/usao-sdny/pr/pennsylvania-man-charged-using-identities-then-president-s-family-members-perpetrate

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65407

File: 1225f1707e46b9b⋯.png (243.45 KB,700x467,700:467,Clipboard.png)

Originally posted at >>>/qresearch/13940446 (192256ZJUN21) Notable: Pennsylvania Man Charged With Using Identities Of Then-President’s Family Members To Perpetrate Online Fraud Scheme

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65406

A Pa. Door Dash driver pretended to be Trump’s family online. The president fell for it. Then, the feds came knocking.

He impersonated more than five members of the Trump family, including the former president’s then 14-year-old son, Barron, and his sister Maryanne Trump Barry, a retired judge on the Philadelphia-based U.S. Court of Appeals for the Third Circuit.

And despite the relatively unsophisticated nature of Hall’s social media masquerading, he managed to amass more than 160,000 followers to his fake accounts.

“There was no nefarious intention behind it,” Hall told the New York Times in December, after the newspaper identified him as an impostor. “I was just trying to rally up MAGA supporters and have some fun.”

Hall described himself to the newspaper as a bisexual Trump supporter who had struggled to find work after dropping out of college to pursue a dream of becoming a conservative talk-show host and influencer. He used the fake accounts, he said, to steer followers toward his own social media profile — @TheBiTrumpGuy — and a GoFundMe page he’d set up in the name of a fake political organization, “Gay Voices for Trump.”

Hall encouraged followers to donate to the crowdfunding site last summer, tweeting from an account set up in the name of Trump’s brother Robert with the handle @BigRobTrump.

“I am very much a heterosexual male. It’s the Trump genes — we love women,” the fake Trump explained. “But we are trying to reach out to LGBT and other minority voters.”

https://www.inquirer.com/news/joshua-hall-trump-twitter-impersonation-gofundme-gay-voices-20210608.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65408

File: bb65ab3572a5326⋯.png (29.55 KB,814x289,814:289,Clipboard.png)

Originally posted at >>>/qresearch/13940466 (192301ZJUN21) Notable: AZ AUDIT – Randy Pullen: “THE REPORT IS GOING TO COME OUT AND THERE IS NO DOUBT THAT IT WILL BE CHALLENGED”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.westernjournal.com/az-audit-reviewing-thousands-ballots-machines-not-detect-vote-president-audit-liaison-says/?

AZ Audit Reviewing Thousands of Ballots Where Machines Did Not Detect Vote for President, Audit Liaison Says

Randy DeSoto

June 19, 2021 at 12:54pm

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65409

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13940479 (192304ZJUN21) Notable: ADL CEO: Omar Equating Hamas and Israel ‘Gives License’ That ‘It’s Open Season to Attack Jews’

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

ADL CEO: Omar Equating Hamas and Israel ‘Gives License’ That ‘It’s Open Season to Attack Jews’

During an interview with CBS on Friday, Anti-Defamation League CEO Jonathan Greenblatt stated that statements like Rep. Ilhan Omar (D-MN) equating Hamas and Israel give license to extremists on the left to say that “it’s open season to attack Jews.”

Greenblatt said, “I’ve been very bold about this, calling out the extreme right and the normalization of a kind of inflammatory rhetoric from people on the extreme right like a Marjorie Taylor Greene that give[s] license to people, as we saw on January the 6 with the Camp Auschwitz sweatshirts, right? They feel emboldened in an environment where leaders give them free license. So, by the same token, when Congresswoman Omar equates Hamas and Israel, when Congresswoman Tlaib accuses the country of ethnic cleansing, right? Those statements are simply wrong on the facts, but it gives license to extremists of a different ideology to say, okay, if the Jewish state is committing genocide, then it’s open season to attack Jews. And I’m not saying this in some abstract way, that’s literally what happened.”

https://www.breitbart.com/clips/2021/06/19/adl-ceo-omar-equating-hamas-and-israel-gives-license-that-its-open-season-to-attack-jews/

The left and right hand of the same beast are at it again

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65410

File: 7db2558b7ecbb20⋯.mp4 (2.3 MB,852x480,71:40,Clipboard.mp4)

Originally posted at >>>/qresearch/13940594 (192322ZJUN21) Notable: Coronavirus Inception Description (How They Made It!) Broadly..

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65411

File: daac9b7bdce9852⋯.jpg (267.2 KB,1080x1838,540:919,Clipboard.jpg)

Originally posted at >>>/qresearch/13940657 (192332ZJUN21) Notable: Dan: “Now, California is putting Trump's plan into practice statewide as groups of 12-person crews set about a $500 million effort to thin the state's forests with controlled burns and sweeping the forest floors of pines, redwoods and firs…”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

DAN

“Now, California is putting Trump's plan into practice statewide as groups of 12-person crews set about a $500 million effort to thin the state's forests with controlled burns and sweeping the forest floors of pines, redwoods and firs…” https://t.co/i7T5LbbAcB

https://mobile.twitter.com/DanScavino/status/1406393028097499138

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65412

File: 7dca1a0c79fcbd0⋯.png (1001.03 KB,1168x1659,1168:1659,Clipboard.png)

Originally posted at >>>/qresearch/13940659 (192332ZJUN21) Notable: Meme Masters, You know what to do.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

DAN THE MAN posted this on Instagram at 7:15 PM EST

https://instagram.com/danscavino?utm_medium=copy_link

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65413

File: d822f7bd3d54319⋯.png (296.62 KB,1242x1702,27:37,Clipboard.png)

Originally posted at >>>/qresearch/13940669 (192334ZJUN21) Notable: Meme Masters, You know what to do.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65412

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65414

Originally posted at >>>/qresearch/13940679 (192336ZJUN21) Notable: Maxine Waters: "YOU NEED TUH GIT IN THEIR FACE AND TELL THEM THEY AREN'T WELCOME HERE!" Also Maxine Waters: 'Trump Camp Organized Jan. 6 Events Along with Proud Boys, Oath Keepers, QAnon and the KKK — BUT NOT THE FBI!'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Maxine Waters: Trump Camp Organized Jan. 6 Events Along with Proud Boys, Oath Keepers, QAnon and the KKK — BUT NOT THE FBI!

Low IQMad Maxine was on CNN this weekend and she was as crazy as ever.

Waters blamed the Trump Campaign, the Proud Boys, the KKK, the Oath Keepers and Qanon for the protests in the US Capitol on Jan. 6 that resulted in the shooting death of Trump supporter Ashli Babbitt.

Of course, this idiot woman has no idea what she’s talking about — as usual.

But when asked if the FBI was involved in planning the attacks and running operatives inside the organizations supporting Trump she denied that.

Of course.

Via The Storm as Arrived on Telegram.

https://www.thegatewaypundit.com/2021/06/low-iq-maxine-waters-trump-camp-organized-jan-6-events-along-proud-boys-oath-keepers-qanon-kkk-not-fbi/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65415

File: 39384ef708b88b3⋯.jpg (392.82 KB,1383x1864,1383:1864,Clipboard.jpg)

Originally posted at >>>/qresearch/13940744 (192344ZJUN21) Notable: #17645

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13940011 Dough

Notables Are NOT Endorsements

#17645

>>65392, >>65393, >>65394 Military Promotions, Nominations, Appointments, and Recognitions

>>65395 FNC’s Carlson: FBI’s Focus on ‘Joe Biden’s Political Opponents’ a Nightmare for Civil Liberties, Threat to Democracy

>>65396 Here's the Reason for the Monumental Collapse of Nickelodeon

>>65397 Commie Party in Commiefornia Ahead of Summer Riots after the Scheduled Annual Wildfires Conceived Near Roadsides.

>>65398 Speaking of roadside… Trump sign Location Quake epicenter or fake news?

>>65399 Dan TapDancin' Man: Bust the Moves

>>65400, >>65404, >>65408 AZ AUDIT – Randy Pullen: “THE REPORT IS GOING TO COME OUT AND THERE IS NO DOUBT THAT IT WILL BE CHALLENGED”

>>65401 BLDM The BLM SCAM! Dignity and Power Now, a group started by former BLM boss Khan-Cullors in 2013, raked in hundreds of thousands in donations but claimed otherwise to the IRS, public documents show.

>>65402 Governor Vetoes Funding For Texas Legislature After Showdown Over Voting Reform

>>65403 Australia Takes China To WTO Over Wine Tariffs As Biggest Export Market Gutted

>>65405 "Is this the pen Ben-Gurion used to sign the Declaration of Independence?"

>>65406, >>65407 Pennsylvania Man Charged With Using Identities Of Then-President’s Family Members To Perpetrate Online Fraud Scheme

>>65409 ADL CEO: Omar Equating Hamas and Israel ‘Gives License’ That ‘It’s Open Season to Attack Jews’

>>65410 Coronavirus Inception Description (How They Made It!) Broadly..

>>65411 Dan: “Now, California is putting Trump's plan into practice statewide as groups of 12-person crews set about a $500 million effort to thin the state's forests with controlled burns and sweeping the forest floors of pines, redwoods and firs…”

>>65412, >>65413 Meme Masters, You know what to do.

>>65414 Maxine Waters: "YOU NEED TUH GIT IN THEIR FACE AND TELL THEM THEY AREN'T WELCOME HERE!" Also Maxine Waters: 'Trump Camp Organized Jan. 6 Events Along with Proud Boys, Oath Keepers, QAnon and the KKK — BUT NOT THE FBI!'

#17645

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65416

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13940952 (200013ZJUN21) Notable: 'WOKE' TIK TOK CRINGE

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

'WOKE' TIK TOK CRINGE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65417

Originally posted at >>>/qresearch/13940954 (200014ZJUN21) Notable: , >>13941048, ,Shills Threatening Board Admin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13940922

SELF CONFIRMING HAND OFF

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65418

Originally posted at >>>/qresearch/13940956 (200014ZJUN21) Notable: , >>13941048, ,Shills Threatening Board Admin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65417

Nope.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65419

Originally posted at >>>/qresearch/13940965 (200017ZJUN21) Notable: , >>13941048, ,Shills Threatening Board Admin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65418

They prob gonn try pull a …

pb

>>>/qresearch/13937652

>>>>/qresearch/13937623

Hahaha you're fucking cute, you taking handoff? This time?

No?

>>/13937466 (You)

>>/13936734 Muh self firm

>>/13936566 Muh self Firm

>>/13936628 Muh muh muh

>Waiting to see some notes drop down around 650?

>Me too.

Had plenty of time…

took me 20 to scrape the entire bread b what gives…

oh.. nevermind

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65420

File: 3ade10feadaede2⋯.png (322.05 KB,598x701,598:701,Clipboard.png)

Originally posted at >>>/qresearch/13940995 (200020ZJUN21) Notable: A team of researchers in Hawaii, including one from Israel, have recently completed a Phase III study on the use of dogs to sniff out coronavirus and prevent its spread…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

A team of researchers in Hawaii, including one from Israel, have recently completed a Phase III study on the use of dogs to sniff out coronavirus and prevent its spread.

https://twitter.com/Jerusalem_Post/status/1406389687946727426

>>>/qresearch/13940967

Ignorance is a choice

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65421

File: b03d433dda30234⋯.png (208.89 KB,346x345,346:345,Clipboard.png)

Originally posted at >>>/qresearch/13941019 (200023ZJUN21) Notable: JUNETEENTH Remember Why.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65422

File: b0c3b984e23349f⋯.png (309.08 KB,598x573,598:573,Clipboard.png)

Originally posted at >>>/qresearch/13941061 (200029ZJUN21) Notable: EEOC files lawsuit on behalf of employee fired for refusing to be fingerprinted

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

EEOC files lawsuit on behalf of employee fired for refusing to be fingerprinted

https://twitter.com/nypost/status/1406378656302305285

Heroes everywhere

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65423

Originally posted at >>>/qresearch/13941062 (200029ZJUN21) Notable: , >>13941048, ,Shills Threatening Board Admin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13941048

>Pretty solid odds that I will be able to soon.

>

>But you will never hear his/her name.

>

>Won't even be on a milk carton.

>

>Some times people just disappear without a trace.

You are extremely gay and boring. You already lied when you said you knew my identity.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65424

File: b3539663df97b73⋯.png (388.35 KB,596x719,596:719,Clipboard.png)

Originally posted at >>>/qresearch/13941065 (200030ZJUN21) Notable: Poorer communities of color have fewer trees to offer shade and combat climate change…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Give me a frigging break

Poorer communities of color have fewer trees to offer shade and combat climate change

https://twitter.com/ABC7/status/1406038638752792578

https://abc7.com/society/poorer-communities-have-fewer-trees-to-offer-shade-combat-climate-change/10803442/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65425

File: 038ddba6105c112⋯.png (433.36 KB,598x584,299:292,Clipboard.png)

Originally posted at >>>/qresearch/13941075 (200031ZJUN21) Notable: Trump supporter sues town for $25M: 'They're trying to silence me'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Trump supporter sues town for $25M: 'They're trying to silence me'

https://twitter.com/nypost/status/1406370168725557255

Kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65426

File: 0d2d86a4b51efd8⋯.jpg (637.11 KB,1283x859,1283:859,Clipboard.jpg)

Originally posted at >>>/qresearch/13941086 (200033ZJUN21) Notable: A team of researchers in Hawaii, including one from Israel, have recently completed a Phase III study on the use of dogs to sniff out coronavirus and prevent its spread…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65427

Originally posted at >>>/qresearch/13941111 (200037ZJUN21) Notable: Reining In the Fed

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Reining In the Fed

A specter is haunting the Federal Reserve: the specter of political activism.

It’s no secret that something strange is happening at the Fed. Visitors to the New York Fed’s homepage are greeted, not with a description of the Fed’s important monetary and regulatory mandates, but an affirmation of the Fed’s commitment to economic justice. “We are firm in the belief that economic equality is a critical component for social justice,” the banner reads.

Social equity is important. It’s certainly a valid area for policy action. But why it’s any concern of the Fed’s is a mystery.

In addition, the Fed recently waded into environmental policy. It’s started putting soft pressure on the banks it oversees to disclose what they’re doing about climate risk and is gearing up for a significant climate-related regulatory extension. There’s no serious economic model or regulatory paradigm linking climate change to financial crises, of course. And the Fed’s poor track record at forecasting big economic shocks means we have scant reason to give it the benefit of the doubt.

This is bureaucratic overreach, plain and simple. The Fed has no mandate to pursue these goals.

In late May, I wrote a public letter of concern about how the Fed’s vital monetary and regulatory missions are in danger of morphing into something sinister. The letter was warmly received by experts in monetary and financial policy. It has more than three dozen co-signatories, including distinguished academics, former high Fed and Treasury officials, members of the Shadow Open Market Committee, and prominent CEOs.

The letter expresses my worry that “the Fed’s behavior renders it increasingly sensitive to political interference.” Recent public statements by Fed Governor Lael Brainard and Minneapolis Fed President Neel Kashkari give us strong reasons to suspect the Fed is pursuing partisan agendas. This lessens the Fed’s credibility, weakens its independence, and makes it less capable of serving the public.

It’s time to put the Fed back on track. I believe Congress can and should act to rein in the Fed.

We know all too well that when it comes to bureaucratic mission creep, it’s incredibly difficult to put the genie back in the bottle. That’s why we must work to right the Fed’s course starting now. Its roles in fighting recessions and preventing financial panics are too important to be hijacked by partisanship.

The Fed can’t function as an effective macroeconomic steward unless it stays in its lane. Americans have a right to demand the central bank focus on its core duties.

https://www.aier.org/article/reining-in-the-fed/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65428

File: 132283b82a7ab61⋯.png (1.02 MB,1311x3992,1311:3992,Clipboard.png)

File: a9bd05d15abff57⋯.png (588.89 KB,1244x917,1244:917,Clipboard.png)

File: 916a5a0219e7449⋯.png (2.34 MB,1714x2135,1714:2135,Clipboard.png)

Originally posted at >>>/qresearch/13941174 (200044ZJUN21) Notable: Proud Boys linked to BLM (feds)

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

In case there was any doubt….

The Proud Boys leader Enrique Tarrio says he started selling Black Lives Matter and anti-Trump T-shirts after card-processing companies refused to work with his other businesses

acollman@businessinsider.com (Ashley Collman) 2 days ago

The Proud Boys leader told The Wall Street Journal about the group's financial problems.

Tarrio said he has struggled to make money as card processors keep refusing to work with his group.

He said he found a loophole by starting a secret business to sell political T-shirts to liberals.

Sign up for the 10 Things in Politics daily newsletter.

Protesters at Black Lives Matter and anti-Trump demonstrations could be wearing T-shirts from an unlikely source: the Proud Boys.

https://www.msn.com/en-us/money/companies/the-proud-boys-leader-enrique-tarrio-says-he-started-selling-black-lives-matter-and-anti-trump-t-shirts-after-card-processing-companies-refused-to-work-with-his-other-businesses/ar-AAL8UgY

https://www.businessinsider.com/proud-boys-enrique-tarrio-says-selling-blm-anti-trump-shirts-2021-6

The far-right group the Oath Keepers is splintering after board members accused the founder of spending its money on hair dye, steaks and guns. The leader of the Proud Boys, choked off from the financial system, is printing “Black Lives Matter” T-shirts to make money.

https://www.wsj.com/articles/proud-boys-and-oath-keepers-forceful-on-jan-6-privately-are-in-turmoil-11623859785

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65429

Originally posted at >>>/qresearch/13941178 (200045ZJUN21) Notable: , >>13941048, ,Shills Threatening Board Admin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65423

How's this for a threat?

I will open your throat.

Report me.

Let's see what happens!

Your days are numbered.

If I find out you have a family, they will suffer in front of you.

Call my bluff.

Let's keep playing!

You really are digging your own grave.

Bloodlust is a funny thing.

You won't know when it's coming until it's too late.

Again, report to me to proper LEO agencies.

Let's bring this out into the OPEN!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65430

Originally posted at >>>/qresearch/13941187 (200046ZJUN21) Notable: , >>13941048, ,Shills Threatening Board Admin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65429

>How's this for a threat?

Very weak.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65431

File: 96951f7f3ca815b⋯.jpeg (764.32 KB,1170x1639,1170:1639,Clipboard.jpeg)

File: 1e8d4cef6ff790c⋯.png (430.84 KB,743x782,743:782,Clipboard.png)

Originally posted at >>>/qresearch/13941341 (200107ZJUN21) Notable: Why is it ALWAYS Broward County….. Pride Parade FF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BREAKING: One dead after pickup truck drives into crowd attending South Florida LGBTQ Pride parade….

Why is it ALWAYS Broward County…..

Did you know that back in April, Broward County schools were hit by ransomware attack, hackers demanded $40M???

https://www.foxnews.com/us/florida-school-district-ransomware-attack-hackers

Parkland High School Shooting….BROWARD.

Package bomb suspect Cesar Sayoc and his “MAGA” covered sticker van??… BROWARD.

And let’s not forget……. Wasserman Schultz!! AWAN brothers anyone?!?! BROWARD.

On and on and on….

Where is the FBI in connecting the dots where it concerns the obvious about the nonstop terror events in Broward County?

Or, is the FBI both enabling and abetting the multi-decade crime wave originating in that notorious southeast Florida county?

Or is Broward County a hot-spot for FF planning by the Feds???

AND —————-

Broward County, it should be pointed out, hosts more Chabad Centers per square mile than any other place on Earth. These Chabad Centers are nests of Israeli Intelligence Service operatives, Secret Service agents and, of course, countless Sayanim. The MOSSAD practically owns and operates Broward County.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65432

File: efcf4e58e140d84⋯.png (1.1 MB,800x1000,4:5,Clipboard.png)

Originally posted at >>>/qresearch/13941359 (200110ZJUN21) Notable: Why is it ALWAYS Broward County….. Pride Parade FF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65431

>ALWAYS Broward County

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65433

File: d260c717fcd2db2⋯.png (483.5 KB,670x787,670:787,Clipboard.png)

File: 3263ec7fbc5d39b⋯.png (503.78 KB,703x849,703:849,Clipboard.png)

File: 8a0cf97bd0f5735⋯.png (18.11 KB,650x103,650:103,Clipboard.png)

Originally posted at >>>/qresearch/13941366 (200110ZJUN21) Notable: Four men arrested in NSW following child grooming investigation

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Four men arrested in NSW following child grooming investigation

Four men have been arrested in NSW in covert stings into alleged child grooming involving police posing as children online.

Police have swooped on four men in NSW after separate investigations into alleged child grooming in the past week.

Detectives from Strike Force Trawler arrested the men in Kogarah, Orange, Paddington and Westmead respectively after covert stings where officers allegedly posed as children online.

Officers allegedly began to engage online with all four men in the last month.

It will be alleged in court that three of the men believed they were talking with a child and went into sexually explicit details about acts they wished to perform with the minors.

A fourth man is accused of sending child abuse material via his mobile phone.

One man, from Sans Souci, was arrested on June 15 after allegedly trying to procure a 13-year-old girl for sex.

Police raided his home, seizing electronic devices, before the man was charged at Kogarah police station with using a carriage service to procure under 16 years for sexual activity.

The 43-year-old appeared at Sutherland Local Court on June 18, where he was granted strict conditional bail to reappear at the same court on August 13.

The next day, on June 16, officers swooped on a man in Orange who allegedly though he was speaking with a 14-year-old girl about sexual acts he hoped to perform with her.

Officers raided his home, seized a mobile phone and arrested the 57-year-old.

He charged with one count of using a carriage service to groom person under 16 years for sex.

The Party Games newsletter Get your political briefing from news.com.au's political editor Samantha Maiden.

The man was granted strict conditional bail to Orange Local Court on July 26.

https://www.news.com.au/national/nsw-act/crime/four-men-arrested-in-nsw-following-child-grooming-investigation/news-story/7422492a716ea5d08704ab0b43f3f6ac

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65434

File: 442fd06c03e5c26⋯.png (14.04 KB,396x196,99:49,Clipboard.png)

Originally posted at >>>/qresearch/13941402 (200114ZJUN21) Notable: Mike Pompeo / @mikepompeo 06/19/2021 20:19:20 “If we lose freedom here, there’s no place to escape to. This is the last stand on Earth.”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Mike Pompeo / @mikepompeo 06/19/2021 20:19:20

“If we lose freedom here, there’s no place to escape to. This is the last stand on Earth.”

— President Ronald Reagan

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65435

Originally posted at >>>/qresearch/13941407 (200115ZJUN21) Notable: RSL Victoria chief executive officer Jamie Twidale stood down, under investigation

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

RSL Victoria chief executive officer Jamie Twidale stood down, under investigation

RSL Victoria's chief executive officer has been stood down and is being investigated.

Key points:

RSL Victoria chief executive Jamie Twidale is on leave

The RSL says it has commissioned an independent investigation into matters regarding its chief executive

Mr Twidale took over the position in December 2019

In a statement to the ABC, RSL Victoria said it had commissioned an independent investigation into matters regarding Jamie Twidale, who is now on leave.

It said the results of the investigation were being considered by the state executive, and additional steps would be taken in accordance with RSL policy and procedures.

RSL staff were alerted to the investigation on Friday afternoon, when an all-staff email was sent by state president Robert Webster.

"We take any concerns regarding staff behaviour extremely seriously and ensure proper processes are followed," Dr Webster wrote.

Dr Webster said it would be inappropriate to make further comment while this process was underway, but the RSL was committed to providing a safe, supportive and inclusive workplace.

Mr Twidale took over the role in December 2019 after a 22-year career with the army and with the Victorian and Queensland State Emergency Service (SES).

Mr Twidale's served in deployments to Afghanistan, East Timor and the Solomon Islands, and was awarded a service medal in 2006 and an army commendation the following year.

He also ran for political office in 2018, but failed in his bid to be elected in the Victorian Upper House for the Reason Party.

At the time of his appointment, Dr Webster said the hiring of Mr Twidale had come at an important time, with the organisation undertaking a number of strategic projects, including the further development of RSL Victoria's Veteran Hubs network.

https://www.abc.net.au/news/2021-06-20/rsl-victoria-chief-executive-jamie-twidale-investigated/100229006

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65436

File: af5b18427decd5c⋯.png (573.06 KB,675x733,675:733,Clipboard.png)

Originally posted at >>>/qresearch/13941475 (200125ZJUN21) Notable: Former mayoress, 68, was found dead in her bed after suffering 'caffeine poisoning' in 'highly unusual' case four months after her husband lost battle with prostate cancer, inquest hears

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Former mayoress, 68, was found dead in her bed after suffering 'caffeine poisoning' in 'highly unusual' case four months after her husband lost battle with prostate cancer, inquest hears

Delyse Critchley, 68, was found dead in her home in Bolton, Greater Manchester

A post mortem revealed that the former mayoress died from caffeine toxicity

Police investigation into her death has found no suspicious circumstances

Her death comes four months after her husband who died of prostate cancer

A former mayoress died in 'highly unusual' circumstances after a caffeine overdose left her with caffeine poisoning, an inquest has heard.

Delyse Critchley, 68, was found dead in her home in Bolton, Greater Manchester on April 8 this year.

Her death comes just four months after that of her husband, Alderman Norman Critchley, who lost a long battle with prostate cancer earlier this year.

A post mortem revealed that the former mayoress, who served the Bolton area between 2009 and 2010, died from 'caffeine toxicity'.

A caffeine overdose may occurs when someone takes in too much caffeine through drinks, food or medications. The recommended daily amount is 400 milligrams for healthy adults, the equivalent of four cups of coffee.

Taking in high doses of caffeine can cause major health issues including seizures and irregular heartbeat.

Bolton Coroner's Court heard that police forced their way into Mrs Critchley's house following reports of concern for her welfare.

Police coroner's officer Stefan Wilson told the court: 'She was found in her bed, she was unresponsive and she was not breathing.'

He added that medication was found at the scene.

A police investigation carried out into her death found no suspicious circumstances.

The exact circumstances surrounding her death will be revealed at a full inquest at a later date.

https://www.dailymail.co.uk/news/article-9703613/Former-mayoress-68-dead-bed-suffering-caffeine-poisoning.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65437

File: 5c5735e421f9919⋯.png (32.63 KB,633x833,633:833,Clipboard.png)

Originally posted at >>>/qresearch/13941486 (200127ZJUN21) Notable: Report: Dr. Fauci participated in 'secret meeting' with scientists about COVID-19 origins in Feb. 2020

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Report: Dr. Fauci participated in 'secret meeting' with scientists about COVID-19 origins in Feb. 2020

Dr. Anthony Fauci, chief medical adviser to President Joe Biden, admitted this week that a meeting took place with prominent scientists last February to discuss the origins of COVID-19 outbreak in China.

Just days after that meeting, one scientist who previously voiced concerns that COVID-19's genome was unnatural, completely reversed their opinion, and any suggestion that COVID-19 did not naturally emerge was dismissed as a conspiracy theory.

News of the meeting is particularly noteworthy because the theory that COVID-19 escaped from the Wuhan Institute of Virology has gained significant traction in recent weeks. The theory was previously dismissed as a conspiracy theory despite a lack of evidence disproving the possibility.

What are the details?

According to USA Today, that meeting, which took place on Feb. 1, 2020, "played a pivotal role in shaping the early views of several key scientists whose published papers and public statements contributed to the shutting down of legitimate discussion about whether a laboratory in Wuhan, China, might have ignited the COVID-19 pandemic."

The call was convened after Kristian Andersen, an expert in infectious disease genomics at the prestigious Scripps Research Translational Institute in California, told Fauci he was concerned COVID-19 may have been artificially engineered.

"The unusual features of the virus make up a really small part of the genome (

Andersen's email was one of more than 3,000 Fauci's work-related emails obtained by BuzzFeed News in early June.

Among those on the call included Fauci, Andersen, Wellcome Trust director Jeremy Farrar, National Institutes of Health Director Dr. Francis Collins, "plus several other international experts on emerging infectious diseases and virology," USA Today reported.

"I remember it very well," Fauci recounted in an interview with USA Today. "We decided on the call the situation really needed to be looked into carefully."

"It was a very productive back-and-forth conversation where some on the call felt it could possibly be an engineered virus," Fauci added of the meeting.

Following the meeting, the group decided that World Health Organization Director-General Tedros Adhanom Ghebreyesu should be looped into their conversation. What came from contact with the controversial WHO is not clear.

https://www.theblaze.com/news/report-dr-fauci-participated-in-secret-meeting-with-scientists-about-covid-19-origins-in-feb-2020

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65438

File: e6cc87342f56f90⋯.jpeg (86.15 KB,750x659,750:659,Clipboard.jpeg)

File: b5b8395e94eb3a3⋯.jpeg (191.17 KB,750x923,750:923,Clipboard.jpeg)

File: 0f3dad180d8e6f3⋯.jpeg (166.17 KB,750x789,250:263,Clipboard.jpeg)

File: 66d154d8896d57e⋯.jpeg (87.8 KB,750x385,150:77,Clipboard.jpeg)

Originally posted at >>>/qresearch/13941521 (200131ZJUN21) Notable: Kameltoe involved in some sketchy estate shit

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thedailybeast.com/nina-simones-family-blame-kamala-harris-for-taking-singers-estate-away-from-them?source=articles&via=rss

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65439

File: b10574b03a4f6ff⋯.png (774 KB,1680x712,210:89,Clipboard.png)

File: 6757307ee821317⋯.png (38.43 KB,1157x474,1157:474,Clipboard.png)

Originally posted at >>>/qresearch/13941532 (200132ZJUN21) Notable: Drake Bell, linked to Seth Rich and Dan Schneider arrested for crimes against children

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13941497

well the shit i dig on exposes kikes so doubtful that any famefag or newfag would run with it

glad to see the msm and pundit articles are still kickin' tho /s

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65440

Originally posted at >>>/qresearch/13941587 (200141ZJUN21) Notable: Drake Bell, linked to Seth Rich and Dan Schneider arrested for crimes against children

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13941575

already made it in but drake bell, star of a nickelodeon show was just recently arrested for crimes against children and he's tied to a guy named seth rich as well as dan schneider, who owns the biggest youth water org there is with ties to africa and aids/hiv shit and also the obama admin so the hop between hrc is probably there if someone digs deeper

>>>/qresearch/13941576

to be fair that's pretty much all that's posted anymore

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65441

File: 458c403b41763f0⋯.jpg (425.79 KB,719x902,719:902,Clipboard.jpg)

Originally posted at >>>/qresearch/13941600 (200142ZJUN21) Notable: Who is Boris Johnson’s first wife, former Tatler cover girl Allegra Mostyn-Owen?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Who is Boris Johnson’s first wife, former Tatler cover girl Allegra Mostyn-Owen?

Who is the glamorous university girlfriend who became the wife of our freshly appointed British Prime Minister, Boris Johnson?

Allegra Mostyn-Owen was Boris Johnson’s university girlfriend and his first wife – 32 years ago. The pair were part of the ‘bright young things’ of the Oxford university elite, a golden, glossy, head-turning double act.

Allegra, the Italian for ‘joyful’ or ‘lively’, a word that is used to annotate uplifting music, was allegedly ‘not’ the state she was in following (and during) her marriage to Johnson. A union that lasted six years, between 1987 and 1993, when the couple divorced.

The Daily Mail described the wedding ‘as a cross between La Dolce Vita and Brideshead Revisited’. Allegra was the captivating daughter of art historian and Christie’s auction house Chairman, the millionaire William Mostyn-Owen and his Italian writer wife, Gaia Servadio. The family seat was Woodhouse, a grade-II-listed estate in Shropshire. The house was their wedding venue – when Allegra wove flowers through her hair and Johnson arrived with neither trousers nor shoes.

If you rewind back to the time of their meeting, Johnson was the Old Etonian President of the Union who had been awarded the Brackenbury Scholarship of Balliol for academic excellence – and Allegra was his mythological prize.

Allegra would reportedly later consider the day of their wedding, ‘the end of their relationship rather than the beginning.’

https://www.tatler.com/article/who-is-boris-johnsons-first-wife-allegra-mostyn-owen

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65442

Originally posted at >>>/qresearch/13941621 (200145ZJUN21) Notable: #17646 Partial

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

notables at around 650 give or take

#17646

>>65427 Reining in the Fed

>>65428 Proud Boys linked to BLM (feds)

>>65433 Child grooming arrests

>>65437 Fauci meeting

>>65438 Kameltoe involved in some sketchy estate shit

>>65439, >>65440 Drake Bell, linked to Seth Rich and Dan Schneider arrested for crimes against children

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65443

File: 53be144a1f73e4c⋯.jpeg (931.38 KB,1019x1162,1019:1162,Clipboard.jpeg)

Originally posted at >>>/qresearch/13941628 (200146ZJUN21) Notable: Why is it ALWAYS Broward County….. Pride Parade FF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Now why would Wasserman be targeted? Gay Jews calling it a terrorist attack….

https://www.mediaite.com/news/one-dead-1-in-critical-condition-after-pickup-truck-plowed-through-crowd-at-south-florida-pride-parade/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65444

File: 1eb5e85bd84cd91⋯.pdf (581.49 KB,Clipboard.pdf)

Originally posted at >>>/qresearch/13941645 (200148ZJUN21) Notable: Ordered, That upon the conclusion of morning business on Monday, June 21, 2021, the Senate proceed to executive session to resume consideration of the nomination of Christopher Charles Fonzone, of Pennsylvania, to be General Counsel of the Office of the Director of National Intelligence.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

UNANIMOUS CONSENT AGREEMENT

Christopher Charles Fonzone (Cal. No. 149) Kiran Arjandas Ahuja (Cal. No. 107)

Ordered, That upon the conclusion of morning business on Monday, June 21, 2021, the Senate proceed to executive session to resume consideration of the nomination of Christopher Charles Fonzone, of Pennsylvania, to be General Counsel of the Office of the Director of National Intelligence.

Ordered further, That at 5:30 p.m., the cloture motions with respect to the Fonzone nomination and the nomination of Kiran Arjandas Ahuja, of Massachusetts, to be Director of the Office of Personnel Management for a term of four years, ripen.

Ordered further, That with respect to the motions to invoke cloture on the nominations, the mandatory quorum calls required under Rule XXII be waived. (Jun. 17, 2021.)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65445

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13941698 (200155ZJUN21) Notable: Who is Boris Johnson’s first wife, former Tatler cover girl Allegra Mostyn-Owen?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65441

>Shropshire

https://en.wikipedia.org/wiki/Telford_child_sexual_exploitation_scandal

Now the vid

>Now if you'll excuse me, I've been invited to a grouse hunting party in Shropshire

>It's just a few dozen men, some stable boys, all of us in kilts naturally

>Drinking a few yards of ale, and here's the fun part, Jon

>Whoever shoots the fewest grouse has to go through the spanking machine

Air date per Comedy Central: 11/10/2003

Coincidental that Colbert would mention this type of activity in Shropshire 4 years before it was discovered, especially in a segment talking about Prince Charles

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65446

File: 2ecf97380920b68⋯.png (343.46 KB,853x708,853:708,Clipboard.png)

Originally posted at >>>/qresearch/13941759 (200201ZJUN21) Notable: IT WAS A VOTER FRAUD FACTORY: 2nd Carter Jones Report Describes Complete Breakdown of GA Election Systems — BALLOTS EVERYWHERE, NO CHAIN OF CUSTODY, COMPLETE DISARRAY and WE HAVE THE VIDEO

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

IT WAS A VOTER FRAUD FACTORY: 2nd Carter Jones Report Describes Complete Breakdown of GA Election Systems — BALLOTS EVERYWHERE, NO CHAIN OF CUSTODY, COMPLETE DISARRAY and WE HAVE THE VIDEO

By Jim Hoft

Published June 19, 2021 at 8:31pm

https://www.thegatewaypundit.com/2021/06/voter-fraud-factory-2nd-carter-jones-report-describes-complete-breakdown-election-systems-ballots-everywhere-no-chain-custody-complete-disarray-video/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65447

Originally posted at >>>/qresearch/13941763 (200203ZJUN21) Notable: Boris Johnson is totally "normal"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13941223 PB Strange Pics of Boris & kids

Richard Desmond is the guy with Boris. The image with the 2 kids from 2014 when he was Mayor of London.

Richard Desmond - pic 2014:

Boris Johnson visited London’s Shadwell Community Project which is supported by the Health Lottery.

He welcomed a £10 million pledge for the capital from the Health Lottery saying there should be “an adventure playground in every community”.

The mayor was joined by Health Lottery founder Richard Desmond.

https://www.express.co.uk/news/uk/453893/Mayor-Boris-swings-into-action-and-hails-10million-Health-Lottery-pledge

2020

The last time Richard Desmond was in the news for his ownership of Westferry printworks in London’s Docklands, he had just finished goose-stepping around a boardroom while shouting Nazi-themed abuse at a group of visiting executives.

The incident, in which Desmond also ordered staff at his Daily Express newspaper to sing “Deutschland uber Alles” at rivals from the Daily Telegraph during a dispute over their joint control of the site, confirmed everything that older media figures felt about Desmond.

He was a pornographer and a pugilistic wheeler-dealer with a fondness for cursing. In short, the fact that the self-made owner of Asian Babes, Big and Black and the Fantasy Channel had ended up as the owner of two national newspapers was a bit embarrassing.

https://www.theguardian.com/media/2020/jun/25/richard-desmond-ex-express-owner-pursuing-a-big-profit-in-property

Creepy pics IMHO

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65448

Originally posted at >>>/qresearch/13941779 (200206ZJUN21) Notable: Boris Johnson is totally "normal"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65447

see

>>65441 lb

>>65445 lb

Something smells funny

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65449

File: 660dd6f898daf1d⋯.png (80.71 KB,871x647,871:647,Clipboard.png)

Originally posted at >>>/qresearch/13941797 (200209ZJUN21) Notable: U Of Ottawa Prof: "Sex Work" Is "The Best Thing Young People Can Do Early In Their Careers"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.zerohedge.com/political/u-ottawa-prof-sex-work-best-thing-young-people-can-do-early-their-careers

U Of Ottawa Prof: "Sex Work" Is "The Best Thing Young People Can Do Early In Their Careers"

Tyler Durden's Photo

by Tyler Durden

Saturday, Jun 19, 2021 - 04:30 PM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65450

File: ed9b4af41beeba8⋯.png (41.57 KB,873x397,873:397,Clipboard.png)

Originally posted at >>>/qresearch/13941808 (200211ZJUN21) Notable: Lake Oroville in the globalist cross hairs Megadrought Could Force California's Lake Oroville Hydroelectric Power Plant To Shut Down

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.zerohedge.com/commodities/megadrought-could-force-californias-lake-oroville-hydroelectric-power-plant-shut-down

Megadrought Could Force California's Lake Oroville Hydroelectric Power Plant To Shut Down

Tyler Durden's Photo

by Tyler Durden

Saturday, Jun 19, 2021 - 01:00 PM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65451

File: 4cf837e3736bbfd⋯.png (348.26 KB,749x423,749:423,Clipboard.png)

Originally posted at >>>/qresearch/13941816 (200213ZJUN21) Notable: Justin Trudeau looks for new ways to teach you that you're racist

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Justin Trudeau looks for new ways to teach you that you're racist

Justin Trudeau is looking for a contractor to re-educate middle-aged white people about how racist they are.

The federal government’s tenders and contracts website put a call out looking for right professional scold for the job last week:

The department of Canadian Heritage requires the services of a contractor on an as-and-when requested basis to develop, implement, manage, create awareness of, facilitate the exchange of information, and report on marketing programs and content integration in support of the public education and awareness anti-racism campaign targeted to non-racialized Canadians, middle-aged adults, and non-racialized Canadian adults.

The program to lecture the David Menzies and other middle-aged white guys of the world about how awful they are is proposed to run from July 15, 2021 to March 31, 2022, with an option to extend the program twice for separate one year intervals.

Costs for the project won’t be known until the bid process is complete later this month, but one thing is certain: racial scolding never comes cheap.

https://www.rebelnews.com/justin_trudeau_looks_for_new_ways_to_teach_you_that_youre_racist

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65452

Originally posted at >>>/qresearch/13941820 (200214ZJUN21) Notable: Money Money Money… Follow it, Document and Audit Frenzy Bun

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Arizona 'audit' becomes far-right campaign stop, fuels conspiracy that election can be overturned

Yahoo|14 hours ago

Colorado adopts emergency rule to protect from 'sham' election audits

Washington Examiner on MSN.com|4 hours ago

Senate wants to dismiss bid to access audit documents

Havasu News|20 hours ago

Pennsylvania poised to begin Arizona-style election audit with subpoena power

Washington Examiner|21 hours ago

Arizona lawmaker seeks to block access to audit documents

Arizona Daily Star|23 hours ago

Ariz. 'audit' becomes campaign stop, fuels conspiracy that election can be overturned

ABC News on MSN.com|12 hours ago

Keep private money out of election administration

Orange County Register|12 hours ago

Arizona Legislature passes $100M fire funding plan

SanLuisObispo|5 hours ago

Gov. Ducey signs bill to set up $100 million fund to fight Arizona wildfires

KTAR News|20 hours ago

$100M plan for fighting fires gets final approval from Ducey

Havasu News|20 hours ago

Amid reform movement, some GOP states give police more power

St. Louis Post-Dispatch|12 hours ago

Secretary of state, ex-TV anchor join governor race

Glendale Star|18 hours ago

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65453

File: 9004674625ee412⋯.png (118.8 KB,470x596,235:298,Clipboard.png)

File: eec44e04e4d4a81⋯.png (410.35 KB,1080x720,3:2,Clipboard.png)

Originally posted at >>>/qresearch/13941822 (200214ZJUN21) Notable: Gov. Ron DeSantis Forwarded from Melania Trump In the darkness there is a light. In the suffering there is a hope. Donald Trump was the only right choice for this country and now we see why everything was better during his presidency.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Gov. Ron DeSantis Forwarded from Melania Trump

In the darkness there is a light. In the suffering there is a hope.

Donald Trump was the only right choice for this country and now we see why everything was better during his presidency.

There is a difference!

Share this picture so everyone can acknowledge the true leader of this nation!

👇👇👇

@FlotusMelaniaTrump

https://t.me/RonDeSantisChannel/337

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65454

File: 737120bce127f3d⋯.png (188.78 KB,443x810,443:810,Clipboard.png)

Originally posted at >>>/qresearch/13941829 (200214ZJUN21) Notable: IT WAS A VOTER FRAUD FACTORY: 2nd Carter Jones Report Describes Complete Breakdown of GA Election Systems — BALLOTS EVERYWHERE, NO CHAIN OF CUSTODY, COMPLETE DISARRAY and WE HAVE THE VIDEO

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

KanekoaTheGreat, [19.06.21 19:41]

[ Video ]

GEORGIA🚨

John Solomon on the significant election failures found in Brad Raffensperger's recently obtained Fulton County documents.

More than 100 batches of absentee ballots may be missing.

More than two dozen batches of absentee ballots were double-scanned.

Five sequential batches of absentee votes are statistically impossible with the exact same vote count of 392 for Biden, 96 for Trump, and 3 for Jorgensen.

Rumble:

https://rumble.com/virsjn-john-solomon-on-brad-raffenspergers-significant-election-failures.html

Audit Documents:

https://justthenews.com/politics-policy/elections/georgia-audit-documents-show-unsecured-missing-ballot-batches-ballots

Investigator Notes:

https://justthenews.com/politics-policy/elections/ga-investigators-election-day-notes-reveal-chaotic-unsecured-ballot

https://t.me/KanekoaTheGreat/513

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65455

File: 2c21ebd4605cbd9⋯.png (538.76 KB,570x863,570:863,Clipboard.png)

File: f173343d2fea133⋯.png (404.7 KB,855x731,855:731,Clipboard.png)

Originally posted at >>>/qresearch/13941831 (200215ZJUN21) Notable: Another pissing contest between israel and pa, this time about vaccines Israel insists near-expired vaccines rejected by PA ‘perfectly sound’ as Palestinian groups demand probe into deal

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Israel insists near-expired vaccines rejected by PA ‘perfectly sound’ as Palestinian groups demand probe into deal

The Pfizer vaccines, which the Palestinian Authority (PA) rejected on Friday due to close expiration date, were identical to those given to citizens inside Israel, the country’s health ministry said.

Earlier this week, the sides agreed that Israel would transfer its short-dated doses of the US-made jab to the occupied West Bank so that PA could accelerate its lagging vaccination campaign. In exchange, the Jewish state was to receive the fresh ampules of the vaccine that Pfizer had been scheduled to deliver to Palestine this autumn.

But after receiving the first delivery of some 90,000 doses from Israel on Friday, the Palestinian Authority called off the deal over claims that the vaccines didn’t meet technical specifications and that “their expiry date was too close.”

On Saturday, Israeli Health Ministry said that it was surprised by the Palestinian move. The doses of the immunization that were sent to the PA were “perfectly sound” and “identical in every way to the vaccines currently being given to citizens of Israel,” it insisted.

The ministry didn’t see a problem in the fact that those vaccines were to expire in late June as the manufacturer deems them perfectly safe for use. The rest of the doses involved in the deal were good until the end of July.

It also claimed that the Palestinians were well aware of the expiration dates before the delivery. “We hope that the vaccination campaign in the Palestinian Authority will begin soon,” the Health Ministry said.

The news of the initial deal stirred up controversy among Palestinians, who generally don’t trust Israel. Some feared that potentially subpar vaccines could end up damaging their health instead of providing protection against the coronavirus.

https://www.rt.com/news/527070-israel-vaccine-palestine-pfizer/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65456

File: edba0bd491116d0⋯.jpeg (382.7 KB,1242x1787,1242:1787,Clipboard.jpeg)

Originally posted at >>>/qresearch/13941832 (200215ZJUN21) Notable: To be eligible for prisoner swap with US, Washington would have to confirm Navalny works for American intelligence, says Kremlin

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BOOM.

https://www.rt.com/russia/526842-navalny-prisoner-swap-america-peskov/

To be eligible for prisoner swap with US, Washington would have to confirm Navalny works for American intelligence, says Kremlin

Moscow has revealed that US negotiators did not request jailed Russian activist Alexey Navalny be included in a possible prisoner exchange, saying he would be ineligible if he is not a US citizen or a foreign intelligence agent.

Speaking on Thursday, a day after President Vladimir Putin met with his counterpart, Joe Biden, at a summit in Geneva, the Kremlin press secretary said the issue had not been discussed. Asked by the Echo of Moscow radio station whether Navalny was being considered for a prisoner swap, Dmitry Peskov said that the US team had not raised the issue.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65457

File: a89e4b698826f5d⋯.png (199.47 KB,462x604,231:302,Clipboard.png)

File: f45bff175aad41b⋯.mp4 (2.13 MB,640x640,1:1,Clipboard.mp4)

Originally posted at >>>/qresearch/13941855 (200217ZJUN21) Notable: Gov. Ron DeSantis Forwarded from Melania Trump In the darkness there is a light. In the suffering there is a hope. Donald Trump was the only right choice for this country and now we see why everything was better during his presidency.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Melania Trump

So crazy how fast the time goes 🤍 Can’t wait for the RETURN!

https://t.me/FlotusMelaniaTrump/151

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65458

File: 3273dc10c488729⋯.png (8.28 KB,446x445,446:445,Clipboard.png)

Originally posted at >>>/qresearch/13941863 (200219ZJUN21) Notable: Lin Wood, [19.06.21 22:00] The Georgia Chain Gang:

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [19.06.21 22:00]

The Georgia Chain Gang:

Governor Brian “CCP” Kemp

Lt. Gov. Geoffrey “Globalist” Duncan

Sec. of State Brad “Jordy” Raffensperger

AG Chris “See No Evil” Carr

Gabriel “ The Thief” Sterling

Jordy [Fill in the Blank] Fuchs

Cathy “Diebold/Dominion” Cox

Nick “Multi-Millionaire Millennial” Ayers

I suspect they ALL have retained criminal defense lawyers.

And they will ALL look good in orange jumpsuits.

https://t.me/linwoodspeakstruth/3329

https://t.me/linwoodspeakstruth/3329

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65459

File: d8831616d48343c⋯.png (54.72 KB,610x492,305:246,Clipboard.png)

File: 43fc3cfb2975be6⋯.png (31.65 KB,571x296,571:296,Clipboard.png)

File: f3e642d37d383dd⋯.png (62.94 KB,842x439,842:439,Clipboard.png)

File: 87e752ad1b3cb58⋯.png (46.6 KB,579x335,579:335,Clipboard.png)

Originally posted at >>>/qresearch/13941867 (200220ZJUN21) Notable: Hollywood sends riot comms to riotactors nationwide ‘Democracy is dead’: Time-travelling Katy Perry & Orlando Bloom star in ‘cringe’ pro-Democrat political ad to conservative mockery

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

‘Democracy is dead’: Time-travelling Katy Perry & Orlando Bloom star in ‘cringe’ pro-Democrat political ad to conservative mockery

Katy Perry and Orlando Bloom have been mocked by conservatives for a hammed-up political ad warning America that democracy will be “dead” in the future unless they support some Democrat-pushed voting bills.

Released on Thursday, the ad stars Perry and Bloom as a pair of ragtag freedom fighters living under a presumably Republican dictatorship in the year 2055. In a message beamed back to the present day, they warn that “Democracy is dead” in the future, and that “the regime watches our every move.”

“It started when voter suppression ran wild all over America,” Perry states, referencing a slew of state-level bills that their Republican sponsors say will tighten up election security, but Democrats argue would make it more difficult to vote.

Perry and Bloom then move on to the hard sell. “Save Democracy while you can!” Bloom shouts, while Perry demands viewers “Call your Senator now!” The video ends with jackbooted riot police kicking down the door of the two heroes’ hideout, and closes with a message: “Call your senator and tell them to pass the For the People Act.”

The act is a piece of Democrat-sponsored legislation that would automatically enroll voters, expand mail-in voting nationally, and prohibit election officials from using certain methods to question someone’s eligibility to vote or remove a person from voting rolls. It would also prohibit “onerous voter identification requirements,” which Republicans and multiple governments across the developed world argue are necessary, at least on some level, to prevent fraud.

Although it was shared and reposted by liberal activists and Perry and Bloom’s Hollywood pals, the ad was mocked into the ground by the right. “Cringe suppression now,” conservative pundit Mike Cernovich jibed, while reporter Mairead McArdle described it as “the most cringe thing I've ever seen.”

Despite Perry and Bloom’s time-traveling message, the chances of the For The People Act passing any time soon are fairly slim. Passing the legislation would require a 60-40 vote in the Senate, and the Democrats right now hold a 51-50 majority, when the tie-breaking vote of Vice-President Kamala Harris is taken into account. Without another vote to eliminate the filibuster – the rule that mandates the 60-40 vote requirement – the bill is frozen in the Senate.

https://www.rt.com/usa/527069-perry-bloom-democracy-ad-ftpa/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65460

File: c4cca929a064272⋯.png (522.86 KB,1090x753,1090:753,Clipboard.png)

Originally posted at >>>/qresearch/13941875 (200221ZJUN21) Notable: Nina Simone’s Family Blame Kamala Harris For Taking Singer’s Estate Away From Them STARTED A FIRE'''

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thedailybeast.com/nina-simones-family-blame-kamala-harris-for-taking-singers-estate-away-from-them?ref=home?ref=home

Music

Nina Simone’s Family Blame Kamala Harris For Taking Singer’s Estate Away From Them

''STARTED A FIRE'

The singer’s granddaughter claimed that Simone's family no longer runs her estate. “Wanna hold someone accountable,” she wrote. “Ask Kamala Harris why she came for my family.”

Cheyenne Roundtree

Entertainment Reporter

Published Jun. 19, 2021 4:19PM ET

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65461

File: 539573a354b1efe⋯.png (170.2 KB,598x701,598:701,Clipboard.png)

Originally posted at >>>/qresearch/13941885 (200223ZJUN21) Notable: Batwatch in Israel?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13941869

I need to research more about saturn

https://twitter.com/Jerusalem_Post/status/1406433427524665345

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65462

File: efbed426dcb072b⋯.png (151.5 KB,880x625,176:125,Clipboard.png)

File: f38e4fb83de9bd8⋯.png (103.33 KB,896x663,896:663,Clipboard.png)

Originally posted at >>>/qresearch/13941916 (200228ZJUN21) Notable: Marco Rubio slammed for tweet condemning Marxism

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.msn.com/en-us/news/politics/marco-rubio-slammed-for-tweet-condemning-marxism/ar-AALdYBy?ocid=msedgntp

Marco Rubio slammed for tweet condemning Marxism

Carly Roman 1 hr ago

The 'normies' on the left, if there is such thing, just can't think.

Rubio, who is running for reelection in 2022 and has the endorsement of former President Donald Trump, criticized Marxism Saturday for "divid[ing] people into either oppressors or victims, call[ing] for the overthrow an 'evil' system & then seiz[ing] complete power in the name of 'fairness.'"

"The old Marxism used class warfare to divide people. The new Marxism uses identity politics. But the goal is the same," he continued.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65463

Originally posted at >>>/qresearch/13941939 (200231ZJUN21) Notable: baker? notes

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

notables at 200

#17647

>>65447, >>65448 Boris Johnson is totally "normal"

>>65450 Lake Oroville in the globalist cross hairs

>>65455 Another pissing contest between israel and pa, this time about vaccines

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65464

File: c26ca94421bb3f3⋯.png (263.74 KB,598x619,598:619,Clipboard.png)

File: c0e83ebdd33498c⋯.png (285.57 KB,598x596,299:298,Clipboard.png)

Originally posted at >>>/qresearch/13941968 (200236ZJUN21) Notable: FF FF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

It´s all so tiresome…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65465

File: 4135fc096a74afa⋯.jpeg (69.46 KB,828x860,207:215,Clipboard.jpeg)

Originally posted at >>>/qresearch/13942007 (200244ZJUN21) Notable: Atlanta blames releasing lockdowns on increasing murder rate, weird flex but ok

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

So, the mayor in atlanta has admitted that keeping blacks locked up lowers murder rates.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65466

File: 37944febde7a021⋯.png (298.13 KB,478x707,478:707,Clipboard.png)

Originally posted at >>>/qresearch/13942054 (200254ZJUN21) Notable: ARMY Tweets: "There is no end to the good you can do if you don't care who gets the credit." Colin Powell

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/USArmy/status/1406416920774066176

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65467

File: 38a2581f352397f⋯.png (97.34 KB,500x339,500:339,Clipboard.png)

File: 01826a3a3987d3b⋯.mp4 (3.14 MB,426x180,71:30,Clipboard.mp4)

Originally posted at >>>/qresearch/13942080 (200300ZJUN21) Notable: Fakebook New Dan The MAN!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

New Dan on fakebook 21:44 Eastern

https://www.facebook.com/1440616002820798/videos/960051501396366

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65468

File: b5bd9fa9f02d397⋯.png (30.17 KB,481x279,481:279,Clipboard.png)

Originally posted at >>>/qresearch/13942081 (200300ZJUN21) Notable: Lin Wood - Here are three HYPOTHETICAL only questions:

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood

Here are three HYPOTHETICAL only questions:

1. Would you vote for Mike Pence for President in the 2024 SC Republican Primary?

2. Would you vote for Mike Pence for dog catcher in any election anywhere in the country at any time now or in the future?

3. Would you vote for Mike Pence to go to prison?

You know for whom I am asking - a person who loves HYPOTHETICAL questions and answers.

https://t.me/s/linwoodspeakstruth

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65469

File: 3c630c3c710e4b2⋯.png (32.73 KB,467x317,467:317,Clipboard.png)

Originally posted at >>>/qresearch/13942089 (200302ZJUN21) Notable: Lin Wood - Here are three HYPOTHETICAL only questions:

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65468

Lin Wood

My Father’s Day will likely be a quiet one this year like it was last year.

So I will go ahead and shake things up a bit on Father’s Day Eve.

Here is another question for you to consider:

What do the “wives” of Mike Pence, Barack Obama, Joey “Bribes” Biden, Bill Clinton, and George “9/11” Bush 43 have in common?

Your answer to that question may be revealing on what the husbands have in common.

I will enjoy reading your replies!!!

https://t.me/s/linwoodspeakstruth

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65470

Originally posted at >>>/qresearch/13942096 (200303ZJUN21) Notable: Perverted elite moving the needle of what is acceptable Manhattan City Council Candidate Comments on Video of Him ‘Tortured’ By Dominatrix

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Manhattan City Council Candidate Comments on Video of Him ‘Tortured’ By Dominatrix

Screenwriter and actor Zack Weiner runs for the Upper West Side’s 6th District in Manhattan. In the early primary voting that will take place on 22 June he was said to be confronted by weightier opponents.

Zack Weiner, 26, a City Council candidate running in Manhattan, commented on a leaked video showing him taking part in a BDMS session. He told the New York Post that he is not ashamed, expressed his displeasure with what he described as an invasion of privacy.

The video was tweeted by an anonymous user last week. The Twitter account was said to have been deleted and later reinstated.

“My magnificent domme friend played with Upper West Side city council candidate Zack Weiner and I’m the only one who has the footage,” the anonymous user tweeted.

The footage was said to be recorded at the Parthenon studio 18 months ago in midtown. Weiner explained that the woman is his ex-girlfriend, and he met her at a Halloween party in 2019. Weiner refused to reveal her name and stressed that he does not know for what reason the file was made public.

He told the newspaper it was “definitely a violation of trust” and said that he is “a proud BDSMer” and enjoys this kind of consensual activity.

“I didn’t want anyone to see that, but here we are. I am not ashamed of the private video circulating of me on Twitter. This was a recreational activity that I did with my friend at the time, for fun. Like many young people, I have grown into a world where some of our most private moments have been documented online,” Weiner said in a statement.

Weiner’s campaign has gained nearly $10,000 in donations and his rivals include the Manhattan borough president, Gale Brewer.

https://sputniknews.com/viral/202106201083191655-manhattan-city-council-candidate-comments-on-video-of-him-tortured-by-dominatrix/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65471

File: 711618ffbef1daa⋯.png (57.04 KB,573x532,573:532,Clipboard.png)

File: 8385899b5803037⋯.png (306.51 KB,698x693,698:693,Clipboard.png)

File: 18a958ee9b79d1f⋯.png (412.24 KB,611x546,47:42,Clipboard.png)

Originally posted at >>>/qresearch/13942113 (200306ZJUN21) Notable: FF FF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Toronto Shooting Injures 4, Including 3 Children

The shooting occurred at a birthday party, with the police called to Tandridge Crescent near Byng Avenue at around 8 p.m., local time. The authorities said they have multiple suspects.

A shooting occured in Toronto on Saturday, injuring four, including three children, Toronto police said.

The three children who were shot were 11, 5 and 1 years old, and the injured adult was identified as a 23-year-old. Police revealed that the shooting occurred at a birthday party for a 1-year-old.

The authorities also noted there are multiple suspects, but did not provide additional details.

Toronto Medics are assisting in the response to the incident, which occurred at Tandridge Crescent near Byng Avenue.

https://sputniknews.com/world/202106201083191664-toronto-shooting-injures-4-including-3-children/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65472

File: dc429bf7a45c01a⋯.png (523.5 KB,1024x682,512:341,Clipboard.png)

File: fa08cb01e739c7e⋯.png (524.8 KB,1024x682,512:341,Clipboard.png)

Originally posted at >>>/qresearch/13942144 (200312ZJUN21) Notable: Perverted elite moving the needle of what is acceptable Manhattan City Council Candidate Comments on Video of Him ‘Tortured’ By Dominatrix

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://nypost.com/2021/06/19/nyc-council-candidate-caught-with-dominatrix-in-leaked-bdsm-video/

Manhattan City Council candidate caught with dominatrix in leaked video

It’s a late-breaking case of electoral bondage.

Zack Weiner, 26, a City Council candidate running in Manhattan, has found his campaign tied up after video of him enjoying a sadomasochism session found its way onto Twitter.

“My magnificent domme friend played with Upper West Side city council candidate Zack Weiner and I’m the only one who has the footage,” reads a tweet from the anonymous account which posted the video last week.

The footage — flagged to The Post by Weiner’s own campaign manager — shows a gagged Weiner, unable to speak, subjecting himself to various abuses by a leather-bound woman who pours wax on him and clips his nipples with clothespins.

The footage was filmed at Parthenon studio in Midtown — which is known for its high-quality BDSM dungeons.

In a call with The Post, Weiner confirmed it was him in the video and said the footage was made about 18 months ago with a former girlfriend he met during a Halloween party in 2019.

“I didn’t want anyone to see that, but here we are. I am not ashamed of the private video circulating of me on Twitter. This was a recreational activity that I did with my friend at the time, for fun. Like many young people, I have grown into a world where some of our most private moments have been documented online.” Weiner said in a statement.

“I am a proud BDSMer. I like BDSM activity,” Weiner told The Post. He refused to name the woman in the video and said he had no idea how on earth the footage surfaced.

“It’s definitely a violation of trust,” he added.

Campaign manager Joe Gallagher told The Post they had reported the account to Twitter and it had been briefly taken offline, but that it was later reinstated.

“Twitter is pretty loose about this stuff,” Gallagher said.

The timing of the video suddenly puts the spotlight on Weiner, who has mostly been a nonentity in the race for the Upper West Side’s 6th District, during early primary voting.

His campaign has raised barely more than $10,000 — the lion’s share of which has come from Weiner and Gallagher.

His campaign website lists no endorsements, and he faces powerful establishment opponents like Manhattan Borough President Gale Brewer.

Weiner has a professional background in film production and is the co-founder of Stag Pictures, an independent film production company. Zack’s father, Eric Weiner, is a co-creator of the popular children’s television show “Dora The Explorer.”

“The creative process taught Zack about generating novel ideas,” the candidate writes on his website.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65473

File: 6342701ddb50c2e⋯.jpg (189.18 KB,1200x1632,25:34,Clipboard.jpg)

Originally posted at >>>/qresearch/13942145 (200312ZJUN21) Notable: Fucking kek

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65474

Originally posted at >>>/qresearch/13942150 (200313ZJUN21) Notable: #17647?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

notables so far

#17647

>>65447, >>65448 Boris Johnson is totally "normal"

>>65450 Lake Oroville in the globalist cross hairs

>>65455 Another pissing contest between israel and pa, this time about vaccines

>>65470 Perverted elite moving the needle of what is acceptable

>>65465 Atlanta blames releasing lockdowns on increasing murder rate, weird flex but ok

>>65473 Fucking kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65475

File: 57d04653b012448⋯.png (138.72 KB,915x357,305:119,Clipboard.png)

File: 58742534b9c8901⋯.png (276 KB,658x644,47:46,Clipboard.png)

File: e1e8d1ad2868c10⋯.mp4 (357.74 KB,490x270,49:27,Clipboard.mp4)

Originally posted at >>>/qresearch/13942157 (200315ZJUN21) Notable: ‘Painful to watch’: Joe Biden apparently gets lost at G7 summit, wanders into cafe

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.rt.com/usa/526465-biden-lost-cognitive-decline/

Painful to watch’: Joe Biden apparently gets lost at G7 summit, wanders into cafe

https://twitter.com/JewishVoice/status/1403421687861764099

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65476

Originally posted at >>>/qresearch/13942185 (200320ZJUN21) Notable: Why NOT to pay ransoms

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Why NOT to pay ransoms

https://it.slashdot.org/story/21/06/18/1933233/80-of-orgs-that-paid-the-ransom-were-hit-again-report-finds

Makes sense from a "business" perspective! They found a sucker; why not try again?

I prefer President Trump's method, hit back x10. Criminals beware. Especially those committing treason – i.e., Dominion hacking, a "for ransom" version of which might be in the near future.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65477

File: 1a51602d6e52c26⋯.png (366.47 KB,967x1024,967:1024,Clipboard.png)

Originally posted at >>>/qresearch/13942193 (200322ZJUN21) Notable: Lake Oroville in the globalist cross hairs Megadrought Could Force California's Lake Oroville Hydroelectric Power Plant To Shut Down

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65450

"How high's the water, Mama?"

696 feet and dropping. Dropped 1/2 foot in last 12 hours

cdec.water.ca.gov

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65478

File: 4daf6c11ba35bfc⋯.png (40.82 KB,610x321,610:321,Clipboard.png)

Originally posted at >>>/qresearch/13942241 (200336ZJUN21) Notable: FF FF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/thebias_news/status/1406444937567084555

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65479

File: be3d0f22cb74cc6⋯.png (431.94 KB,831x535,831:535,Clipboard.png)

Originally posted at >>>/qresearch/13942271 (200343ZJUN21) Notable: FF FF

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65478

https://www.local10.com/news/local/2021/06/19/2-people-hit-by-truck-at-pride-parade-in-wilton-manors/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65480

File: c5fec5cd6caaedf⋯.png (94.88 KB,1491x879,497:293,Clipboard.png)

Originally posted at >>>/qresearch/13942325 (200355ZJUN21) Notable: Those who know don't (or can't) sleep

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Now you guys understand why I told this faggot he couldn't bake last bread?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65481

Originally posted at >>>/qresearch/13942580 (200453ZJUN21) Notable: Pence's Wife's First Husband Dig, John Steven Whitaker was the first husband of Karen Pence, the wife of Vice President Mike Pence.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

John Steven Whitaker was the first husband of Karen Pence, the wife of Vice President Mike Pence.

Whitaker, who would become a doctor, was Pence's high school sweetheart. Dr John Steven Whitaker married Karen Batten in 1978, but they divorced soon after.

They split up when Whitaker was a medical student and his schedule became too intense, according to The List.

Karen met Mike Pence at Mass at St. Thomas Aquinas Church in Indianapolis and the two got engaged in 1984.

https://www.the-sun.com/news/1596957/john-steven-whitaker-karen-pence-vp-debate/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65482

File: 9dd837911e40d49⋯.png (982.79 KB,2880x1800,8:5,Clipboard.png)

Originally posted at >>>/qresearch/13942586 (200455ZJUN21) Notable: Pence's Wife's First Husband Dig, John Steven Whitaker was the first husband of Karen Pence, the wife of Vice President Mike Pence.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65481

https://celebpie.com/john-steven-whitake/

Biotech

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65483

File: e11caaa2722a4f7⋯.png (81.32 KB,1183x485,1183:485,Clipboard.png)

File: 7e44f68fde75f49⋯.png (94.81 KB,1199x459,1199:459,Clipboard.png)

Originally posted at >>>/qresearch/13942597 (200459ZJUN21) Notable: Pence's Wife's First Husband Dig, John Steven Whitaker was the first husband of Karen Pence, the wife of Vice President Mike Pence.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65482

https://www.omeros.com/leadership/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65484

File: fec1745652fe937⋯.jpg (453.92 KB,720x720,1:1,Clipboard.jpg)

Originally posted at >>>/qresearch/13942611 (200502ZJUN21) Notable: 'Member Dis?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65485

File: 09985044ecc2034⋯.png (5.77 KB,449x215,449:215,Clipboard.png)

Originally posted at >>>/qresearch/13942615 (200503ZJUN21) Notable: CM: …Nevermind the rule that election servers should not be connected to any other network…+

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CodeMonkeyZ, [19.06.21 23:14]

Dont want to provide election router data?

Just connect your election servers to every other network in the county.

“We cant provide the election router because it was connected to every other network in the county.”

Nevermind the rule that election servers should not be connected to any other network.

https://t.me/CodeMonkeyZ/518

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65486

File: 1aae76bac25f296⋯.png (2.59 KB,312x92,78:23,Clipboard.png)

Originally posted at >>>/qresearch/13942618 (200503ZJUN21) Notable: CM: …Nevermind the rule that election servers should not be connected to any other network…+

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CodeMonkeyZ, [19.06.21 23:16]

It is simple.

They did the risk analysis.

https://t.me/CodeMonkeyZ/519

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65487

File: 26983cd60cfac72⋯.png (3.83 KB,435x102,145:34,Clipboard.png)

Originally posted at >>>/qresearch/13942620 (200503ZJUN21) Notable: CM: …Nevermind the rule that election servers should not be connected to any other network…+

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CodeMonkeyZ, [19.06.21 23:17]

Admission of connecting election servers to other networks is less of a penalty than it being proven that they were letting people access the election servers remotely.

https://t.me/CodeMonkeyZ/520

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65488

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13942623 (200504ZJUN21) Notable: the money laundering - the fed and tracking bitcion

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

the money laundering - the fed and tracking bitcion

Dream - The Infiltration Of The Dark Net

In 2013 a mysterious dark net market would appear that would remain in the shadows for quite some time. Today we will discuss a mysterious theory as it pertains to one such marketplace. Dream

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65489

File: faf6b37808fbc11⋯.png (208.39 KB,476x847,68:121,Clipboard.png)

Originally posted at >>>/qresearch/13942624 (200504ZJUN21) Notable: Kraken Wood, [20.06.21 00:04] Ken tells John Fredericks that they are still waiting on the passwords and the router logs from the slimy Maricopa County Supervisors…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Kraken Wood, [20.06.21 00:04]

[Forwarded from Arizona Conservatives Take Action (Patriot)]

Ken Bennett Update on the Arizona Audit June 17

Ken tells John Fredericks that they are still waiting on the passwords and the router logs from the slimy Maricopa County Supervisors. The audit team is unable to get past a partition on the 385 tabulator machines without a second password. The Supervisors’ excuse that sensitive health and social security data contained on the router logs prevents them from granting access is ludicrous, Ken points out.

Although the Coliseum portion of the audit will wrap up at the end of this month, the team will still have several more weeks of work to confirm that envelopes had signatures, review voter registration anomalies (canvassing), complete the analysis of the machines, and possibly do another vote tabulation using the ballot images. Ken expects the results report to be released a few weeks after all of that work is complete, likely in August. No mention of an interim hand count update.

Watch 👉🔗 Arizona Conservatives (https://m.youtube.com/watch?v=32CwLdlSKoY)

Read 👉🔗 TGP Summary (https://www.thegatewaypundit.com/2021/06/watch-maricopa-audit-liaison-says-need-investigate-anomalies-like-52-ballots-submitted-two-bedroom-home/)

https://t.me/RealKrakenWood/766

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65490

File: 614c88ce9a56f5a⋯.jpeg (149.01 KB,750x1254,125:209,Clipboard.jpeg)

Originally posted at >>>/qresearch/13942627 (200505ZJUN21) Notable: 'Member Dis?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65484

9/11 in five minutes

https://youtu.be/HXYswf3lzU8

New York area fire commissioners have called for a new investigation into 9/11, claiming that "overwhelming evidence" of "pre-planted explosives…caused the destruction of the three World Trade Center buildings." The Franklin Square and Munson Fire District outside of Queens, New York made history by becoming the first legislative body in the country to support a new investigation into the events of 9/11, according to Architects and Engineers for 9/11 Truth.

The resolution, read aloud and passed during a July 24, 2019 meeting and calling for the investigation was drafted by Commissioner Christopher Gioia and was unanimously approved by the five commissioners. 

According to Activist Post, Commissioner Christopher Gioia said: “We’re a tight-knit community and we never forget our fallen brothers and sisters. You better believe that when the entire fire service of New York State is on board, we will be an unstoppable force. We were the first fire district to pass this resolution. We won’t be the last."

https://i.pinimg.com/originals/73/49/90/73499048c7cadecfd9df26efd717ad50.gif

https://www.zerohedge.com/news/2019-07-31/ny-fire-commissioners-call-new-911-investigation-citing-overwhelming-evidence-pre

On September 10, 2001 Donald Rumsfeld announced that there was 2.3 TRILLION dollars "unaccounted" for in the Pentagon budget. That amount was 7x the ENTIRE Pentagon budget for the year.

Only the government could lose their ENTIRE budget SEVEN times in one year AND get away with it!

The next day, three hijacked planes, reportedly flying at approximately 2x beyond the structural limits of their flight speed at sea level, crashed into buildings destroying all the accounting records and there could be no further investigation.

These facts are NOT disputed among government officials.

https://youtu.be/IVpSBUgbxBU

What is happening here?

Shall we ask Robert Mueller? He was head of the FBI at the time and tasked with “investigating” the crime.

If we don’t demand justice then who will?

Yes… 9/11 was an inside job and the people responsible still wield tremendous power and influence in our government.

Robert Mueller was trotted out of retirement for a reason. “They” needed Robert Mueller to “investigate” another matter.

Robert Mueller is a traitorous deepstate cover up artist.

Now is the time to be concerned.

3000 architects and building

engineers agree

The laws of physics

cannot be broken

Newton’s three laws of motion and

Conservation of momentum PROVE that both towers and WTC 7 could NOT have fallen at free fall speed unless they met NO resistance as they fell.

Hundreds of thousands of tons of concrete and structural steel had to be removed by demolition to achieve the observed actions in ALL three buildings.

free fall speed = demolition

unimpeachable fact

https://www.collective-evolution.com/2018/09/11/donald-trump-implies-911-was-a-controlled-demolition/

https://archive.defense.gov/releases/release.aspx?releaseid=2306

“We are now 18 years away from the U.S.-government-coordinated, Saudi-financed, Israeli-conducted, British-covered up terrorist attacks of September 11, 2001.

And, “YES!”, they were terrorist attacks except that they were carried out by the U.S. Federal Government and Armed Forces in tandem with the enemy foreign powers listed above.”

http://stateofthenation2012.com/?p=127834

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65491

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13942636 (200507ZJUN21) Notable: 'Member Dis?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65490

>https://youtu.be/HXYswf3lzU8

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65492

File: 95c3c17ca8eef87⋯.png (10.95 KB,481x400,481:400,Clipboard.png)

Originally posted at >>>/qresearch/13942650 (200512ZJUN21) Notable: Lin Wood, [19.06.21 22:26] There has not been an honest election in the State of Georgia since at least 2002 when Mercer Law School Dean Cathy “Diebold/Dominion” Cox was the Secretary of State.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [19.06.21 22:26]

There has not been an honest election in the State of Georgia since at least 2002 when Mercer Law School Dean Cathy “Diebold/Dominion” Cox was the Secretary of State.

Diebold was purchased by Dominion. Cox’s Chief of Staff is now the spokesperson for Dominion. Cox did television ads promoting Diebold.

Cox is up to her neck in the Georgia swamp of election fraud. It is a shame that the reputation of Mercer Law School and Mercer University will be permanently damaged when Cox’s role is exposed.

https://newswithviews.com/guest_opinion/guest29.htm

https://t.me/linwoodspeakstruth/3335

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65493

File: 7d559628f1d6905⋯.png (9.35 KB,449x372,449:372,Clipboard.png)

Originally posted at >>>/qresearch/13942651 (200512ZJUN21) Notable: Lin Wood, [19.06.21 22:26] There has not been an honest election in the State of Georgia since at least 2002 when Mercer Law School Dean Cathy “Diebold/Dominion” Cox was the Secretary of State.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [19.06.21 22:35]

In an honest statewide election in Georgia with paper ballots, Stacey Abrams would not receive 25% of the vote.

Georgia is a rock solid conservative red state but uses Dominion computer voting machines and vote tabulators.

South Carolina is a rock solid conservative red state but has the most liberal “Republican” legislature in the country. South Carolina uses ES&S computer voting machines and vote tabulators.

If South Carolina votes by paper ballots, a Trump Patriot would beat Lindsey Graham 80% to 20% in a closed Republican primary.

Of course, the South Carolina Republican Cabal does not push for closed primaries or an investigation of the ES&S machines and tabulators.

Wonder why not???

https://t.me/linwoodspeakstruth/3336

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65494

File: 600c7d55994a616⋯.png (169.3 KB,449x394,449:394,Clipboard.png)

Originally posted at >>>/qresearch/13942653 (200513ZJUN21) Notable: Lin Wood, [19.06.21 22:26] There has not been an honest election in the State of Georgia since at least 2002 when Mercer Law School Dean Cathy “Diebold/Dominion” Cox was the Secretary of State.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lin Wood, [19.06.21 22:42]

Here is Senator Tim Scott with Mike Pence’s good buddy, Paul Ryan.

https://t.me/linwoodspeakstruth/3337

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65495

File: 0106058b42bec92⋯.webm (2.89 MB,1280x720,16:9,Clipboard.webm)

File: f734e146663f554⋯.webm (2.92 MB,1280x720,16:9,Clipboard.webm)

File: febc81c4ae33617⋯.webm (2.92 MB,640x360,16:9,Clipboard.webm)

Originally posted at >>>/qresearch/13942683 (200521ZJUN21) Notable: 'Member Dis?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65496

File: 265a6815c7f8f99⋯.png (2.22 MB,2880x1800,8:5,Clipboard.png)

File: 57bb042d32fa978⋯.png (532.58 KB,2880x1800,8:5,Clipboard.png)

File: 07d30919c9a7b02⋯.png (2.19 MB,2880x1800,8:5,Clipboard.png)

Originally posted at >>>/qresearch/13942699 (200526ZJUN21) Notable: Pence's Wife's First Husband Dig, John Steven Whitaker was the first husband of Karen Pence, the wife of Vice President Mike Pence.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65482

Omeros

Ominous

Onerous

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65497

File: 72a91df876c12cc⋯.png (477.82 KB,858x648,143:108,Clipboard.png)

Originally posted at >>>/qresearch/13942826 (200607ZJUN21) Notable: Sorry California. Dams to provide water for ya? We're gonna blow 'em up.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Sorry California. Dams to provide water for ya?

We're gonna blow 'em up.

Thanks Gavin!

https://www.oregonlive.com/environment/2021/06/plan-to-remove-4-dams-near-oregon-california-border-clears-major-hurdle.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65498

Originally posted at >>>/qresearch/13942840 (200613ZJUN21) Notable: CM: …Nevermind the rule that election servers should not be connected to any other network…+

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Diebold was founded in 1859 and was acquired by ES&S in 2009 and later changed names to Dominion. This was all nothing more than a name change. Is it a surprise to anyone that a business originally based in a corrupt CA would somehow rig elections? If you have any doubt, please look into the Wonderful Company.

https://www.thegatewaypundit.com/2021/05/exclusive-auditor-harry-hursti-uncovered-fatal-flaws-diebold-memory-cards-2005-hiding-flaws-windham-nh-audit-week/

Following this In late 2006, Diebold decided to remove its name from the front of the voting machines in what its spokesperson called "a strategic decision on the part of the corporation". In August 2007 Diebold Election Systems changed its name to "Premier Election Solutions".

https://www.thegatewaypundit.com/2020/11/dominion-voting-systems-connecting-dots/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65499

File: 2bd351179696e79⋯.jpg (420.95 KB,1908x1146,318:191,Clipboard.jpg)

File: ea1bb69b312f301⋯.jpg (180.67 KB,1200x900,4:3,Clipboard.jpg)

Originally posted at >>>/qresearch/13942960 (200646ZJUN21) Notable: Revealed: Bodyguard survivor of Princess Diana crash has rebuilt his life and is now AstraZeneca's global head of security

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Revealed: Bodyguard survivor of Princess Diana crash has rebuilt his life and is now AstraZeneca's global head of security

Trevor Rees-Jones is the only survivor of the crash in which Princess Diana died

Mr Rees, 53, has recovered to land job as global head of security for AstraZeneca

He was in the front passenger seat of the car and was trapped in the wreckage

He was in an induced coma for ten days and was left with severe facial trauma

Bodyguard Trevor Rees-Jones, the only survivor of the crash in which Princess Diana died, has rebuilt his life and is global head of security for AstraZeneca, the Mail can reveal.

Despite suffering appalling injuries and severe memory loss, he has recovered sufficiently to land a huge job with the pharmaceutical giant behind one of the world's most effective Covid-19 vaccines.

It is not known if his role involves protecting key personnel involved in the vaccine programme, or guarding the firm's laboratories and intellectual property.

https://www.dailymail.co.uk/news/article-9702359/Bodyguard-survivor-Princess-Diana-crash-rebuilt-life.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65500

File: d4994f5185eaae5⋯.png (242.45 KB,652x689,652:689,Clipboard.png)

Originally posted at >>>/qresearch/13943115 (200727ZJUN21) Notable: Ebrahim Raisi's victory gives Israel 'no Choice' but to attack Iran's nuclear programme, report says

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Ebrahim Raisi's victory gives Israel 'no Choice' but to attack Iran's nuclear programme, report says

https://twitter.com/SputnikInt/status/1406508549451272194

>>>/qresearch/13943033

Suicide weekend

Last resort.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65501

Originally posted at >>>/qresearch/13943340 (200917ZJUN21) Notable: Baker Change

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

i am signing off though, boys

i never intended to take the bake, so this will be ghosted once again

see you on the flip side, frens

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65502

Originally posted at >>>/qresearch/13943346 (200919ZJUN21) Notable: France votes in first round of regional elections

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

France votes in first round of regional elections

20/06/2021

https://www.rfi.fr/en/france/20210620-france-votes-in-first-round-of-regional-elections-far-right-marine-le-pen-emmanuel-macron

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65503

File: 02f385e09b12864⋯.jpg (105.84 KB,1032x840,43:35,Clipboard.jpg)

File: 14dac4d7eadc1f8⋯.jpg (168.08 KB,1913x1072,1913:1072,Clipboard.jpg)

Originally posted at >>>/qresearch/13943348 (200919ZJUN21) Notable: After O'Keefe interview Journalist Ivory Hecker has over $175K pledged on a fundraising campaign

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Big: After O'Keefe interview Journalist Ivory Hecker has over $175K pledged on a fundraising campaign

My daughter Ivory’s efforts to speak out and take a stand for true journalism has been appreciated by so many. Her position as reporter at FOX26 appears to have been terminated, and I’ve been asked to supply a fundraiser to help with her support. Thank you so much.

-Renee Hecker

You know what to do. O'Keefe says he has others willing to go public. Let's make sure they have an incentive to do so.

https://givesendgo.com/supportivory

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65504

File: c1ad8a48eb4d7c4⋯.jpg (89.76 KB,720x934,360:467,Clipboard.jpg)

File: 1ca5189dd63f915⋯.mp4 (12.33 MB,480x848,30:53,Clipboard.mp4)

Originally posted at >>>/qresearch/13943368 (200930ZJUN21) Notable: I want my mother* Trump back

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://mobile.twitter.com/DanScavino/status/1406260280301137924

I want my motherfuckin Trump back

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65505

File: 08d57a66e4622f7⋯.png (193.4 KB,773x674,773:674,Clipboard.png)

File: 2474408ac7aec91⋯.png (122.3 KB,653x626,653:626,Clipboard.png)

Originally posted at >>>/qresearch/13943380 (200937ZJUN21) Notable: Reminder: Trump pledges to make Juneteenth federal holiday in bid for Black voters

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

SEPTEMBER 25, 20204:31 PM UPDATED 9 MONTHS AGO

Trump pledges to make Juneteenth federal holiday in bid for Black voters

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65506

Originally posted at >>>/qresearch/13943404 (200953ZJUN21) Notable: We are the news is down

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

We are the news is down

https://wearethene.ws/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65507

Originally posted at >>>/qresearch/13943474 (201016ZJUN21) Notable: BlackRock in The White House

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

BlackRock in The White House

June 20, 2021 | sundance |

With Joe Biden in the White House you can expect to hear the name “Blackrock” in the headlines connected to a variety of issues from real estate purchasing to green energy projects with massive domestic and international investments.

BlackRock, Inc. (together with its subsidiaries) is a massive publicly traded multinational investment firm with over $8.68 trillion in assets under management [December 31, 2020 financial statement] in more than 100 countries across the globe. To say that Blackrock is invested in globalism, climate change and leftist politics, would be a severe understatement {See Here}. Larry Fink is the CEO and people like Cheryl Mills, Hillary Clinton’s attorney of record, are on the board.

Inside BlackRock there is a division called the BlackRock Investment Institute (BII) {See Here}.

Essentially the role of the BII is to tell BlackRock what is going to happen around the globe, and be the tip-of-the-spear in directing BlackRock where to invest money by predicting political events.

The Chairman of the BlackRock Investment Institute is Tom Donilon, President Obama’s former National Security Advisor (before Susan Rice), and a key advisor to Joe Biden throughout his career in politics.

You cannot get more deeply connected in the swamp financial schemes than Tom Donilon……

Donilon took the lobbying gig because he was previously Executive Vice President for Law and Policy at Fannie Mae where he was responsible for Fannie Mae’s legal, regulatory, government affairs, and public policy issues. Tom Donilon’s BlackRock Biography reads like a who’s-who of connections to the swamp {READ HERE}

Here’s where it really gets interesting.

♦Tom Donilon’s brother, Mike Donilon is a Senior Advisor to Joe Biden {link} providing guidance on what policies should be implemented within the administration. Mike Donilon guides the focus of spending, budgets, regulation and white house policy from his position of Senior Advisor to the President.

♦Tom Donilon’s wife, Catherine Russell, is the White House Personnel Director {link}. In that position Donilon’s wife controls every hire in the Office of the Presidency.

♦Tom Donilon’s daughter, Sarah Donilon, who graduated college in 2019, now works on the White House National Security Council {link}

So let me just summarize this…. The Chairman of the BlackRock Investment Institute, the guy who tells the $8.7 trillion investment firm BlackRock where to put their money, has a brother who is the Senior Advisor to Joe Biden; has a wife who is the White House Personnel Director; and has a daughter who is now on the National Security Council.

Put another way… Tom Donilon’s literal job description for BlackRock is to: “leverage the firm’s expertise and generate proprietary research to provide insights on the global economy, markets, geopolitics and long-term asset allocation,” and his wife is in charge of White House personnel, his brother is Senior Advisor to the President, and his daughter is on the National Security Council.

You seeing this? Conflicts and insider information much?

The only thing missing is Hunter Biden being moved to the BlackRock board.

Now, I say again:.

Watch Where “BlackRock” and Biden Put Their Money

https://theconservativetreehouse.com/blog/2021/06/20/blackrock-in-the-white-house/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65508

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13943482 (201018ZJUN21) Notable: Tom MacDonald Lyrics "Snowflakes"

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Tom MacDonald Lyrics

"Snowflakes"

If you lie to the government they'll put you in prison

But when they lie to all of us it's called being a politician

You think taking guns away will save our kids from the killings

But your pro-choice abortion kills way more children

If America's so terrible and racist

It probably isn't safe to encourage immigration, just saying

All the contradictions are embarrassing

You know who hates America the most? Americans

Trigger warnings used to be on TV for seizures

And now they're everywhere to protect millennials' feelings

He, she, his, him, hers, them, they

Screw a pronoun, 'cause everyone's a retard these days

I hear 'em preaching at a protest that hatred's the problem

But hating straight men, white folks, and Christians is common

Coca Cola telling people they should be less white

They preaching tolerance but if you disagree, they fight

There's a race war here, elections based on fear

Black lives only matter once every four years

Soldiers died for this country and every one of us benefits

Give welfare to the bums and forget about the veterans

Black folks and white folks divided by the news

But we're all the same, we are red, white, and blue

Ashamed to be American? Okay, that's cool

'Cause honestly, we are all ashamed of you too

Y'all are so fake, oh no

The forecast said that there'd be snowflakes, whoa-oh

You can't make us see it your way, no way, gasoline and propane

More flames, oh no

No more snowflakes

They set us up to fail, that's what they built the system for

Put an ammunition shop across the street from a liquor store

Empowering women used to be different than this before

The role models got OnlyFans or dance on a stripper pole

Screw it, I ain't tripping, I don't mean to be mean

But if our children are the future then our future is bleak

They take an Adderall to focus, hit McDonald's to eat

They're addicted to phones and they take Xanax to sleep

They blurred the lines dividing communism and democracy

In 2021 we paint the patriots as Nazis

The men playing women's sports get trophies for winning

Like great, let's celebrate a man for beating some women

If you're black, your life matters, you're supposed to embrace it

If you're rich or you're smart then you're probably Asian

If you're gay then you're brave, all of that I'm okay with

But if you're white, the stereotype is you are a racist

Blaming capitalism like that's the reason things are tough

While you tweet from an iPhone and sip on a Starbucks

You're supporting what you stand against you don't think you are but

A Percocet addict don't donate money to pharma

Damn dog, we're all afraid to speak the truth

And the more afraid we get, the more we hate the ones who do

You're ashamed to be American, okay that's cool

'Cause honestly, we are all ashamed of you too

Y'all are so fake, oh no

The forecast said that there'd be snowflakes, whoa-oh

You can't make us see it your way, no way, gasoline and propane

More flames, oh no

No more snowflakes

We could all get along but there's no stopping, ay

Everybody's wrong, that's a real problem, ay

They don't wanna hear it but they still talking, ay

Soon enough we running outta options, ay

This ain't gonna end till it's in a coffin, ay

We ain't gon' be friends till we try to squash it, ay

I don't know how we can make amends or we drop it

Snowflakes melt when it's hot, kid

Y'all are so fake, oh no

The forecast said that there'd be snowflakes, whoa-oh

You can't make us see it your way, no way, gasoline and propane

More flames, oh no

No more snowflakes

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65509

Originally posted at >>>/qresearch/13943486 (201021ZJUN21) Notable: Lawfare Activists Apoplectic Because The Arizona Senate Will Not Provide Advanced Details of Internal Audit Documents

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Lawfare Activists Apoplectic Because The Arizona Senate Will Not Provide Advanced Details of Internal Audit Documents

June 19, 2021 | sundance |

The Lawfare activists are screaming foul because the Arizona Senate is not turning over documents from ongoing investigative measures taking place during the audit of Maricopa County. The group known as American Oversight is a Lawfare group working on behalf of the DNC and allied left-wing activists. They have filed suit against the Arizona senate trying to find evidence they can use to marginalize the audit before the findings are made public.

Seemingly pretending not to know about the separation of power between the state legislative body and the state judicial branch, the activists are filing suits to get access to the evidence in an ongoing Senate investigation. Essentially, this is akin to demanding to sue for legislative content before the Senate can create the law and/or the harm from that law.

It is a clear Lawfare fishing expedition.

Remember, in order for far-left ideologues to advance their ideology, and/or ideological narratives, they must pretend not to know things. Another way to look at this is the Arizona Senate subpoena -which initiated the audit- is akin to an ongoing investigation. The Lawfare group are trying to get custody of details of the investigative techniques being used (forensic audit) in order to undermine the investigation itself.

To advance this narrative the leftists are using another Alinsky maneuver: “make your opposition live up to their own rules”. The Lawfare tribe is accusing the Arizona Senate of not being transparent in their process.

An easy smack-down (with a current familiarity) would be to juxtapose this Lawfare demand against the House Judiciary Committee as they worked to assemble the articles of impeachment behind closed doors. The leftist tribe would clutch their pearls if anyone sued them to find out in advance what details were being assembled in the articles before they were made public…. but that’s essentially what their demand is in Arizona.

PHOENIX — Senate President Karen Fann is taking the position that Arizona courts cannot force her or any other member of the Arizona Legislature to comply with the state’s Public Records Act.

In a new court filing, attorney Kory Langhofer, who represents the Prescott Republican and the entire Senate, is asking Maricopa County Superior Court Judge Michael Kemp to throw out a claim by a self-described nonpartisan watchdog group to get access to all documents and materials related to the Senate’s audit of the 2020 election results.

The Senate has, or will produce documents in its possession, Langhofer said. Ditto with those in the possession of Ken Bennett, who was tapped by Fann to be her liaison with Cyber Ninjas, the private company hired to conduct the audit. The only exception, Langhofer said, are those documents protected as privileged or confidential.

He said, though, what American Oversight wants are documents that are in the hands of Cyber Ninjas or other companies it has, in turn, hired as subcontractors. Langhofer said the Public Records Act does not apply to private companies. And he rejected arguments by attorney Roopali Desai that the records are public because the only reason Cyber Ninjas got the materials in the first place was because they were subpoenaed by the Senate.

But Langhofer has a backup legal argument just in case the judge does not read the scope of the Public Records Act as narrowly as he does. He told Kemp he has no jurisdiction in the fight.

The Arizona law spells out that public records and other matters in the custody of any officers “shall be open to inspection by any person at all times during office hours.” Langhofer concedes that the Senate is a “public body” and lawmakers are “public officers” who, in any other circumstance, would be covered by the law. Only thing is, he said, they are not subject to it….

https://theconservativetreehouse.com/blog/2021/06/19/lawfare-activists-apoplectic-because-the-arizona-senate-will-not-provide-advanced-details-of-internal-audit-documents/#more-213187

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65510

Originally posted at >>>/qresearch/13943502 (201027ZJUN21) Notable: To all fathers, Happy Father's Day.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

To all fathers, Happy Father's Day.

To each and everyone, Happy DECLAS Day.

Expect widespread outages (Twitter, FB, etc) today.

New platform ready.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65511

File: 3578f12898af472⋯.png (325.3 KB,574x461,574:461,Clipboard.png)

Originally posted at >>>/qresearch/13943524 (201035ZJUN21) Notable: Ralph Ellison, the author of 'Juneteenth' is the same author of 'Invisible Man'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://gab.com/IPOT1776/posts/106435356162592937

IPOT1776 @IPOT1776

Fun Juneteenth Fact: Ralph Ellison, the author of 'Juneteenth' is the same author of 'Invisible Man' which does much to imply the evils of the white man, but conveniently ignores the fact that his own book was funded by white 'Jewish' money. A Julius Rosenwald grant.

The same Rosenwald that helped defend Sabbatean Leo Frank after his rape and murder conviction of 13 yr old Mary Phagan, in which he attempted to blame it on a black man. This was how the ADL was formed. So that people don't point out things like this without being called 'antisemitic' or racist.

Tell that to your 'woke' friends.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65512

Originally posted at >>>/qresearch/13943599 (201057ZJUN21) Notable: To all fathers, Happy Father's Day.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65510

ty NSA frens…

>Happy Father's Day

Happy Fathers day to…

-all anons…much Love!

-all watchers..grow a pair!

-all DIA…THANK YOU!

-some NSA…THANK YOU!

-JDIF…FUCK YOU!

-ELs…knock knock…

>To each and everyone, Happy DECLAS Day.

LIGHT THAT CANDLE!!!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65513

Originally posted at >>>/qresearch/13943600 (201057ZJUN21) Notable: Joe makes Hunter look like a piker

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Damn Poppa Joe makes Hunter look like a piker

https://theconservativetreehouse.com/blog/2021/06/20/blackrock-in-the-white-house/#more-213196

Here’s where it really gets interesting.

♦Tom Donilon’s brother, Mike Donilon is a Senior Advisor to Joe Biden {link} providing guidance on what policies should be implemented within the administration. Mike Donilon guides the focus of spending, budgets, regulation and white house policy from his position of Senior Advisor to the President.

♦Tom Donilon’s wife, Catherine Russell, is the White House Personnel Director {link}. In that position Donilon’s wife controls every hire in the Office of the Presidency.

♦Tom Donilon’s daughter, Sarah Donilon, who graduated college in 2019, now works on the White House National Security Council {link}

So let me just summarize this…. The Chairman of the BlackRock Investment Institute, the guy who tells the $8.7 trillion investment firm BlackRock where to put their money, has a brother who is the Senior Advisor to Joe Biden; has a wife who is the White House Personnel Director; and has a daughter who is now on the National Security Council.

Put another way… Tom Donilon’s literal job description for BlackRock is to: “leverage the firm’s expertise and generate proprietary research to provide insights on the global economy, markets, geopolitics and long-term asset allocation,” and his wife is in charge of White House personnel, his brother is Senior Advisor to the President, and his daughter is on the National Security Council.

https://www.blackrock.com/us/individual/about-us/road-to-net-zero

Innovation on the road to net zero

We’re committed to helping more and more people experience financial well-being, and we believe the transition to a net zero economy by 2050 is a big part of that ambition. That’s why we’re dedicated to advancing climate innovation, research and analytics – to help our clients invest sustainably and build a net zero economy that serves us all.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65514

File: 08fbc00e620ad0b⋯.png (425.29 KB,740x444,5:3,Clipboard.png)

Originally posted at >>>/qresearch/13943636 (201109ZJUN21) Notable: To all fathers, Happy Father's Day.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Happy Father's Day, Donald

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65515

File: 41aa838847b83f6⋯.jpg (132.88 KB,750x1500,1:2,Clipboard.jpg)

Originally posted at >>>/qresearch/13943645 (201112ZJUN21) Notable: China claims it has administered its billionth dose of the #COVID19 vaccine over the weekend

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/disclosetv/status/1406570027562713088?s=19

JUST IN - China claims it has administered its billionth dose of the #COVID19 vaccine over the weekend. 100 million doses were given in the last five days, according to Chinese state media. https://t.co/Z7YU29zcqC

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65516

File: 9b9dde1d1a2972b⋯.jpeg (260.71 KB,1241x976,1241:976,Clipboard.jpeg)

File: e573fc1d43aeb45⋯.jpeg (313.03 KB,1241x1333,1241:1333,Clipboard.jpeg)

Originally posted at >>>/qresearch/13943662 (201119ZJUN21) Notable: 16 y/o child has managed to get both doses of Pfizer against her parents' will.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/SarahEdmondsPhD/status/1406407482344316928?s=20

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65517

File: 575bfc1bb5e3082⋯.jpg (131.15 KB,720x990,8:11,Clipboard.jpg)

File: 9bddf207c6acb0b⋯.mp4 (1.41 MB,640x480,4:3,Clipboard.mp4)

Originally posted at >>>/qresearch/13943671 (201122ZJUN21) Notable: Did Greta flip, telling the truth? saying the climate crisis doesn't exist on msnbc

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/Thirdtimeluck15/status/1406553481725595655?s=19

"Since the climate crisis doesn't exist…"

Disclosure in full swing folks 🥳 https://t.co/bo3yiHVQxI

Did Greta flip, telling the truth? saying the climate crisis doesn't exist on msnbc

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65518

File: ed97d3cc6c62e0d⋯.png (25.66 KB,436x851,436:851,Clipboard.png)

Originally posted at >>>/qresearch/13943673 (201123ZJUN21) Notable: Dr. Douglas Frank: 2020 Election Data Research Reveals Troubling Patterns

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

KanekoaTheGreat, [20.06.21 02:36]

Dr. Douglas Frank: 2020 Election Data Research Reveals Troubling Patterns

“I discovered the algorithms that were controlling the election,” said Frank (@FollowTheData). “To us on the outside watching the election, we see these behaviors and don’t understand them – [but] I can [now] predict them based on what I know is underlying it.”

When Frank charted the number of ballots received by each age, he found an uncanny correlation between that graph and the graph of registered voters and census data. They virtually matched each other, he said.

Upon further study, Frank determined that a precise formula was used to control the election results, and he was able to ultimately derive the actual numerical values that were used in the formula. He said that once he discovered the formula, he was able to predict the exact turnout by age in other counties in Pennsylvania.

Frank told viewers on the livecast that voting machines were connected to the internet, and that voter registration rolls are accessible online. He has concluded that voter registration rolls were artificially inflated with “low-propensity” voters in order to supply a pool for “phantom ballots.”

“Each county’s registration rolls are artificially inflated,” said Frank. “For example, people who have passed away – you don’t remove them from the registration roll, so that gives you extra voters.”

Frank said that, based on his calculations, he estimated a significant percentage of the votes cast in the 2020 election were actually “phantom votes.” Phantom votes, he said, are legally invalid ballots because they are attributed to people who, for example, died before the election, have moved out of state, already voted, are convicted felons, are underage or who say they did not actually vote. To corroborate his estimate, he assembled a team of canvassers who went door to door in Pennsylvania with a randomly selected list of people who supposedly (according to election results) cast a ballot in the 2020 election. The canvassers found, according to Frank, not about 20% as he initially believed, but over 30% of the ballots cast were from phantom voters.

After studying Pennsylvania, Frank studied Michigan, Wisconsin, Colorado, and other jurisdictions. He finds that the same essential patterns are in every state. And, Franks says, there is significant corroborating evidence of the scheme across the nation.

https://www.einnews.com/pr_news/542874813/dr-frank-2020-election-data-research-reveals-troubling-patterns

https://t.me/KanekoaTheGreat/518

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65519

File: a884568cb29057b⋯.jpeg (244.96 KB,1241x1117,1241:1117,Clipboard.jpeg)

Originally posted at >>>/qresearch/13943689 (201129ZJUN21) Notable: Twitter silenced my account. Facebook restricted our page. Our original web hosting provider disabled our website. They even censored published medical studies.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/drsimonegold/status/1406373502630891523?s=20

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65520

File: db0cc27d8538dc6⋯.png (132.05 KB,648x610,324:305,Clipboard.png)

Originally posted at >>>/qresearch/13943691 (201130ZJUN21) Notable: For keks

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Victoria's Secret To Replace Angels With Fattest Woman Of All Time: Your Mom

NEW YORK, NY—In a massive coup for the clothing giant, Victoria's Secret stunned the fashion world today by announcing they will no longer use thin models and will instead use the fattest woman of all time: your mom.

"When you are seeking to redefine the very meaning of the word sexy, you swing for the fences," said CEO Janet Daniels. "And we found an absolute heifer: your mom. Honestly, she's so big, she plays pool with the planets."

The crowd of reporters then all started hooting and hollering, shouting, "DAAAAANG!" and "YOU JUST GOT MOTED, SON!"

Your mom has been slated to make her first runway appearance at the Paris fashion show, in which she is expected to be displaying Victoria's Secret new, extremely large line of lingerie – we're talking like big enough to be an Army parachute. OH, DANG! BURNED!

"I feel like I've been training my whole life for this," said your mom in a press conference, which had to be held in a giant outdoor football stadium to hold her. She then modeled the first piece of clothing in the Your Mom Collection by Victoria's Secret, walking out on the runway in high heels but walking back in flip-flops. OOOOOOOOOH!!!

At publishing time, Victoria's Secret had confirmed that future catalogs will have to be printed on extra-large drafting paper to fit your mom.

DAAAAAAAANG!!!

https://babylonbee.com/news/victorias-secret-introduces-new-angel-your-mom

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65521

Originally posted at >>>/qresearch/13943695 (201131ZJUN21) Notable: victoria-chief-executive-jamie-twidale-investigated

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.abc.net.au/news/2021-06-20/rsl-victoria-chief-executive-jamie-twidale-investigated/100229006

Relevant

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65522

File: caab7c66bd085c2⋯.png (11.05 KB,1458x180,81:10,Clipboard.png)

Originally posted at >>>/qresearch/13943702 (201132ZJUN21) Notable: Technology company remotely turns up Texas smart thermostats during heat spike, update

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://justthenews.com/government/local/report-texas-company-turns-smart-thermostat-remotely-during-heat-spike

Technology company remotely turns up Texas ‘smart thermostats’ during heat spike, report

"They woke up sweating," one man says of family.

Updated: June 19, 2021 - 7:10pm

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65523

Originally posted at >>>/qresearch/13943713 (201135ZJUN21) Notable: 1 dead, another injured after pickup truck drives into crowd at Stonewall Pride Parade in Wilton Manors

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.wptv.com/news/state/broward/wilton-manors-stonewall-parade-crash

Ft. Lauderdale comes through for the cabal /ds agenda

1 dead, another injured after pickup truck drives into crowd at Stonewall Pride Parade in Wilton Manors

Police say they're questioning driver

Police say one man was killed and another was injured when a pickup truck drove into a crowd at a Pride parade in Wilton Manors.

	By: Peter BurkePosted at 8:46 PM, Jun 19, 2021 and last updated 11:16 PM, Jun 19, 2021

WILTON MANORS, Fla. — One man was killed and another injured when a pickup truck plowed into them at the start of the Stonewall Pride Parade and Street Festival on Saturday night in Wilton Manors, police said.

Fort Lauderdale police Detective Ali Adamson said two people were struck by a pickup truck on Northeast Fourth Avenue.

Adamson said one man was pronounced dead at Broward Health Medical Center. She said the other man was expected to survive.

Recent Stories from wptv.com

1 dead at South Florida Pride parade

Fort Lauderdale Mayor Dean Trantalis was at the event and said he witnessed the incident. He described it as an attack on the LGBTQ community.

It's not yet immediately known whether the crash was intentional.

Wilton Manors Commissioner Chris Caputo wrote on Twitter that it "seems increasingly probable it was an accident."

Adamson said police are speaking with the driver and witnesses.

She said the FBI is also involved in the investigation.

Video at the scene showed U.S. Rep. Debbie Wasserman Schultz, D-Fla., in tears while sitting in a convertible at the parade.

Wilton Manors police said the parade was canceled because of "a tragic event" but that the public was not in danger.

Broward County Sheriff Gregory Tony said the "tragedy took place within feet" of him and his fellow Broward Sheriff's Office deputies.

"I'm proud of all the BSO and local first responders who leaped into action, running into the unknown and instantly provided care for the victims," Tony said. "Our prayers are with the victims and their families. Be sure to hug the ones you love tonight."

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65524

File: 029abbc65420255⋯.png (171.58 KB,468x584,117:146,Clipboard.png)

Originally posted at >>>/qresearch/13943714 (201136ZJUN21) Notable: Dan ScavinoFlag of United StatesEagle

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dan ScavinoFlag of United StatesEagle

@DanScavino

Families are our most important institution, but they’re under attack. Local & state politicians put special interest groups ahead of our children daily — For Father’s Day sign the pledge & stand up for Big Family - not Big Tech, Big Business, or Big Govt!

10:35 PM · Jun 18, 2021·Twitter for iPhone

https://twitter.com/DanScavino/status/1406078100107141121

Link to sign the pledge:

https://www.bigfamilypledge.com/?utm_source=exc_TW&utm_campaign=3c41aff6

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65525

File: 23e4f38206e82f6⋯.png (2.18 MB,1500x1125,4:3,Clipboard.png)

Originally posted at >>>/qresearch/13943728 (201140ZJUN21) Notable: To all fathers, Happy Father's Day.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Happy Father's Day to all the FatherAnons out there! Enjoy your day!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65526

File: 4b86b8e20740f6d⋯.png (396.1 KB,667x585,667:585,Clipboard.png)

Originally posted at >>>/qresearch/13943752 (201145ZJUN21) Notable: Congress Passes Law To Recognize Juneteenth, The Day Republicans Freed All The Democrats' Slaves

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13943723

>>>/qresearch/13943726

Congress Passes Law To Recognize Juneteenth, The Day Republicans Freed All The Democrats' Slaves

WASHINGTON, D.C.—The Senate has unanimously passed a resolution to recognize Juneteenth as a federal holiday, commemorating the glorious day Republicans freed the last of the Democrats' slaves.

"We are so proud to show the world how not racist we are by officially recognizing the day the Republicans came charging in to free all our slaves," said Senate Democrat Chuck Schumer. "Yeah– we Democrats did a little 'whoopsie' with that whole slavery thing, but the Republicans corrected it. Thanks, Republicans!"

During this year's Juneteenth, the nation will gather to celebrate the American political party that was founded on protecting human rights of people of all skin colors. Democrats around the country will write letters of apology and organize celebrations for the vast network of Christians, Catholics, Quakers, and Republicans who fought and died to end the scourge of slavery in America.

Congress has also approved the building of a giant elephant statue in D.C. to honor the party responsible for the freeing of slaves from Democrat plantations.

Biden has confirmed he will organize a celebration at the White House after he lays a wreath on the grave of his best friend Robert Byrd.

https://babylonbee.com/news/congress-passes-law-to-recognize-juneteenth-the-day-republicans-freed-all-the-democrats-slaves

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65527

File: da6640e279c90c6⋯.png (163.11 KB,628x536,157:134,Clipboard.png)

Originally posted at >>>/qresearch/13943768 (201151ZJUN21) Notable: Dan Scavino OHIO — 7 DAYS!!! #MAGAFlag of United StatesEagle

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dan Scavino

OHIO — 7 DAYS!!! #MAGAFlag of United StatesEagle

(1:47)

784.4K views

7:40 PM

https://twitter.com/DanScavino/status/1406396556597727234

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65528

File: ffdb5509443903b⋯.jpg (137.55 KB,720x1226,360:613,Clipboard.jpg)

File: 139e56525d64159⋯.mp4 (1.08 MB,360x640,9:16,Clipboard.mp4)

Originally posted at >>>/qresearch/13943779 (201154ZJUN21) Notable: This is Chicago Warning graphic.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

This is Chicago

https://twitter.com/DoyouknoDway/status/1406481142711267336?s=19

Warning graphic.

Is this the White supremacy they keep talking about?this shit is getting old I'm tired of people killing each other. there is too much evil In this world..

Jesus we need you

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65529

Originally posted at >>>/qresearch/13943795 (201158ZJUN21) Notable: New Hampshire Libertarian Party Sees A Coup As New Libertarian Options Arise

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

New Hampshire Libertarian Party Sees A Coup As New Libertarian Options Arise

https://www.youtube.com/watch?v=94VWO8HDwug

NH Libertarian Party Chairwoman Unilaterally Dissolves and Replaces Executive Committee, Bylaws

https://independentpoliticalreport.com/2021/06/nh-libertarian-party-chairwoman-unilaterally-dissolves-and-replaces-executive-committee-bylaws/

Concerned about the growing influence of the right libertarian Mises Caucus, New Hampshire Libertarian Party chairwoman Jilletta Jarvis yesterday took the unusual step of dissolving the state party’s duly elected executive committee and replacing it with members of her choosing. She also threw out the existing party bylaws, drafted new bylaws, changed the password on social media accounts, and relocated party assets.

She posted the rationale for her moves on the New Hampshire Party website:

During the last two months I have watched a hostile take-over happen to an organization that was fighting for the equality and freedom of every individual in this state. An organization that wanted to see all people treated with respect, to have the liberty to choose freedom. I believed that with these same goals we could learn to work together.

I confess that I was wrong. I have watched secret plots occurring and been shushed about it and advised that I was simply misunderstanding, and that non-supportive behavior on my part would not be tolerated. Meanwhile, these same individuals have made public statements about their intention to rid my organization of those who had fought to build it over all these years in this state. Their strategy of so-called “bold messaging” is not designed to promote freedom and educate people on how to peacefully take back the freedoms guaranteed to them in the Constitution. Their strategy is, frankly, designed to discredit the Libertarian Party in the state and in our nation.

There is a right way to be bold. There is a right way to make demands for freedom. There is a right way to move people to want to fight for their rights. But, as humans, we are fallible and sometimes we don’t learn the lessons of history – even our own immediate history. January 6th showed us what can happen when people are riled up into a frenzy and given little direction. For the last two months, the Libertarian Party of New Hampshire has been using this strategy, the strategy of riling up mobs to frenzy and giving them no direction. These new members have stated their intention was to take us over and then move on to do the same thing in the Republican Party. While the Republican Party is my opposition, I am not willing to have this Party used to support such a goal. I am not willing to allow this Party to be turned into a force that takes apart the hard work of thousands of individuals across this country; the candidates who had to work three times as hard as their opponents just to get on the ballot, let alone win their races. These individuals deserve our respect and support, not angry mobs.

When I was elected as Chair, I was hopeful for the opportunity to grow and diversify of the Party, to build a strong core of politically motivated individuals ready to write policy proposals, testify against bills that stole the freedom of the individuals of New Hampshire, and stand up for individual rights and equality. I was enthused that there was a desire for bold messaging to promote these ideals and large committees of people ready to stand up for the individual.

While my desire for these things has not lessened, neither has the division in the Party between those who have those same goals and those who have an alternate agenda. We have always had diverse opinions in the LPNH. This is not new, but this is the first year that the distinction between them was so rigid that individuals cannot see through them to work towards a common goal.

There are now two groups in the Libertarian Party of New Hampshire where there used to be one. One group that is the Libertarian Party of New Hampshire and another that wants to work towards their vision of Liberty in a more “bold,” more bellicose manner. It is not up to me to say which of these strategies is correct, but it is my responsibility to lead my Party towards the success of the goals of both the State and National Libertarian Party."

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65530

File: 7caaa348d3c488b⋯.png (185.42 KB,792x816,33:34,Clipboard.png)

Originally posted at >>>/qresearch/13943823 (201204ZJUN21) Notable: Contact Your Local Senators and #DemandAudits

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

CALL FOR SUPPORT

Contact Your Local Senators and #DemandAudits

The 2020 Election was Stolen, You know it, I know it… The Whole World Knows it.

Time to get vocal and and Demand an Audit of the 2020 Election. IN ALL STATES!!!

Contact your local Senator and Demand an Audit of the 2020 Election; You paid for it.

This is a website of names and numbers of all our US Senators.

Let 'Them' Hear Your Voice!

http://contactsenators.com/

If you are uncomfortable calling your local senator, use a social network like Twitter.

'They' are all on them.

Thank (You) and God's Strength to all.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65531

File: e95d29d5791ea79⋯.jpeg (54.14 KB,503x646,503:646,Clipboard.jpeg)

Originally posted at >>>/qresearch/13943851 (201210ZJUN21) Notable: Plandemic?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Plandemic?

SHARE SHARE AND SHARE SOME MOAR

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65532

File: 09d9e2b4351b3af⋯.jpeg (403.04 KB,1241x1915,1241:1915,Clipboard.jpeg)

File: c9368675010026a⋯.jpeg (281.24 KB,1241x1355,1241:1355,Clipboard.jpeg)

File: 2a1d77c7778ddfd⋯.jpeg (301.85 KB,1241x1444,1241:1444,Clipboard.jpeg)

Originally posted at >>>/qresearch/13943888 (201221ZJUN21) Notable: @RealPNavarro takes us behind the scenes at the White House on why Dr. Fauci nixed data proven lifesaving COVID solutions.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://twitter.com/ChanelRion/status/1405921905924837386?s=20

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65533

File: b5ecfe7c4aebfef⋯.png (400.96 KB,623x372,623:372,Clipboard.png)

Originally posted at >>>/qresearch/13943892 (201222ZJUN21) Notable: Beijing Guodian Gaoke Technology Co has successfully put a satellite named after Jiaxing

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Holy Crap Batman !

https://www.globaltimes.cn/page/202106/1226584.shtml

Chinese commercial satellite company Beijing Guodian Gaoke Technology Co has successfully put a satellite named after Jiaxing, East China’s Zhejiang Province, the convening venue of the first congress of the Communist Party of China (CPC), into orbit from the Xichang Satellite Launch Center to pay tribute to the CPC's centennial.

As one of a series of small Chinese experimental Low Earth Orbit (LEO) satellites dubbed the Apocalypse constellation, the satellite will actively serve in smart city, tourism emergency, transportation and power, and ecological environmental protection, the company confirmed with the Global Times on Sunday.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65534

Originally posted at >>>/qresearch/13943901 (201223ZJUN21) Notable: Newsome bailed out weed industry? Who are they laundering for, for realz?

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Newsome bailed out weed industry? Who are they laundering for, for realz?

https://pjmedia.com/vodkapundit/2021/06/16/californias-100-million-bailout-for-pot-sellers-yes-pot-sellers-n1454977

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65535

File: fa8af1e6ae5fee9⋯.png (534.6 KB,864x811,864:811,Clipboard.png)

Originally posted at >>>/qresearch/13943912 (201226ZJUN21) Notable: Georgia Secretary of State Raffensperger Received Report Showing Egregious Election Issues Yet He Concealed Report and Claimed State Had “Safe, Secure, and Honest Elections”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/outrageous-georgia-secretary-state-raffensperger-received-report-showing-egregious-election-issues-yet-concealed-report-claimed-state-safe-secure-honest-elections/

OUTRAGEOUS: Georgia Secretary of State Raffensperger Received Report Showing Egregious Election Issues Yet He Concealed Report and Claimed State Had “Safe, Secure, and Honest Elections”

By Joe Hoft

Published June 20, 2021 at 7:15am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65536

File: 51895b56c88549e⋯.png (254.07 KB,624x355,624:355,Clipboard.png)

File: 2b6904a1f1c7c57⋯.png (221.35 KB,600x421,600:421,Clipboard.png)

Originally posted at >>>/qresearch/13943921 (201230ZJUN21) Notable: Amazon dumps Frontline Doctors site for 'misinformation about vaccines'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.wnd.com/2021/06/4924491/

The real news is why would these somewhat aware doctors think they could host their counter narrative website on Amazon?

==Amazon dumps Frontline Doctors site for 'misinformation about vaccines'

'Jeff Bezos and Amazon cannot argue with our scientific data and facts'==

WND Staff	By WND Staff

Published June 19, 2021 at 7:42pm

Amazon's internet hosting service took down the website of the group of doctors known for promoting proven treatments for COVID-19 such as hydroxychloroquine and ivermectin.

America's Frontline Doctors was accused of "hosting misinformation about vaccines and was reported as objectionable content to AWS."

The Gateway Pundit reported Amazon shut down the site on about May 31. The doctors' website has since been restored through another host.

Here is a copy of what AFLDS received from Amazon: (pic 2)

The doctors said Amazon gave them four days notice to remove the website from Amazon's server or it would be deleted.

AFLDS said its team "frantically worked around the clock to rebuild our website from scratch while utilizing servers around the world at great expense."

"We were forced to take immediate action because we will never allow Jeff Bezos and Amazon to censor us from speaking freely about medical treatments, medical studies, individual liberty, or challenging the government narrative surrounding COVID-19 vaccines," AFLDS said.

Is Amazing suppressing proven treatments for COVID-19?

Yes No

Completing this poll entitles you to WND news updates free of charge. You may opt out at anytime. You also agree to our Privacy Policy and Terms of Use.

The doctors said Amazon's motives "are suspect, as they are closely aligned with the Biden Administration, due to massive government contracts" that are worth billions while Amazon pays almost no corporate taxes.

"Jeff Bezos and Amazon cannot argue with our scientific data and facts, so they would rather delete us entirely," AFLDS said.

"We have already been blacklisted on social media, and cannot host videos on YouTube. We must build our own internet servers that cannot be silenced by Big Tech, Big Pharma, or Big Government."

'Misinformation'

In July 2020, a video posted by America's Frontline Doctors of a press conference in front of the Supreme Court in Washington was removed by Facebook, YouTube and Twitter after more than 10 million hits because it was deemed to have shared "misleading" claims about the virus.

In particular, the social media giants didn't like the claims that hydroxychloroquine was an effective coronavirus treatment and that masks did not slow the spread of the virus.

But since then, more than 200 peer-reviewed studies have shown that hydroxychloroquine is a safe treatment that significantly cuts the risk of severe illness and death from COVID-19. And many studies using official data, particularly comparing states and countries with and without mask mandates, indicate masks have not slowed the spread of the novel coronavirus.

When the AFLDS video was removed one year ago, the New York Times opined the video "had been designed specifically to appeal to internet conspiracists and conservatives eager to see the economy reopen, with a setting and characters to lend authenticity."

The Times cited Lisa Kaplan, founder of Alethea Group, a start-up that helps fight disinformation.

“Misinformation about a deadly virus has become political fodder, which was then spread by many individuals who are trusted by their constituencies," she said.

"If just one person listened to anyone spreading these falsehoods and they subsequently took an action that caused others to catch, spread or even die from the virus — that is one person too many.”

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65537

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13943923 (201231ZJUN21) Notable: :QUANTUM-GRAMMAR-CHANNEL::Part 1 of the Six-Part-Video-Communications.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

:QUANTUM-GRAMMAR-CHANNEL:

Dr Fred Bell Health Science & Energy Show 1 27 07

:Part 1 of the Six-Part-Video-Communications.

https://youtu.be/XLoCizlVP-U

1818 views views•Jun 6, 2019

>>>/qresearch/13943856 (OP)

>>>/qresearch/13943819 (OP)

>>>/qresearch/13943772 (OP)

>>>/qresearch/13943744 (OP)

>>>/qresearch/13943697 (OP)

>>>/qresearch/13943672 (OP)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65538

File: 1b7c8898a4c9b9d⋯.jpeg (373.76 KB,1241x1589,1241:1589,Clipboard.jpeg)

Originally posted at >>>/qresearch/13943924 (201231ZJUN21) Notable: POTUS on OANN this am

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

POTUS on OANN this am

https://twitter.com/OANN/status/1405565444057042948?s=20

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65539

Originally posted at >>>/qresearch/13943941 (201236ZJUN21) Notable: Baker Change

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65501

>i am signing off though, boys

BAKER CLAIMING THIS DOUGH FOR (YOU)

do we have notes?

Scraping nao, call em out anons…. call em out.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65540

File: adbfe222b4937a9⋯.png (200.71 KB,866x561,866:561,Clipboard.png)

Originally posted at >>>/qresearch/13943953 (201239ZJUN21) Notable: University Of Florida Lab Finds Dangerous Pathogens On Children's Face Masks

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.zerohedge.com/markets/university-florida-lab-finds-dangerous-pathogens-childrens-face-masks

University Of Florida Lab Finds Dangerous Pathogens On Children's Face Masks

Tyler Durden's Photo

by Tyler Durden

Saturday, Jun 19, 2021 - 10:30 PM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65541

Originally posted at >>>/qresearch/13943971 (201244ZJUN21) Notable: The work of the #USArmy is a complex combination of missions, tasks and responsibilities — all in constant motion.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13943930

https://twitter.com/USArmy/status/1406056112609271809

looks mighty stormy.

notable

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65542

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13944012 (201256ZJUN21) Notable: Portion of the letter that Archbishop Carlo Maria Viganò penned to President Trump.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

June 7, 2020…Holy Trinity Sunday…Mr. President,

Portion of the letter that Archbishop Carlo Maria Viganò penned to President Trump.

We will also discover that the riots in these days were provoked by those who, seeing that the virus is inevitably fading and that the social alarm of the pandemic is waning, necessarily have had to provoke civil disturbances, because they would be followed by repression which, although legitimate, could be condemned as an unjustified aggression against the population. The same thing is also happening in Europe, in perfect synchrony. It is quite clear that the use of street protests is instrumental to the purposes of those who would like to see someone elected in the upcoming presidential elections who embodies the goals of the deep state and who expresses those goals faithfully and with conviction. It will not be surprising if, in a few months, we learn once again that hidden behind these acts of vandalism and violence there are those who hope to profit from the dissolution of the social order so as to build a world without freedom:Solve et Coagula, as the Masonic adage teaches.

Although it may seem disconcerting, the opposing alignments I have described are also found in religious circles. There are faithful Shepherds who care for the flock of Christ, but there are also mercenary infidels who seek to scatter the flock and hand the sheep over to be devoured by ravenous wolves. It is not surprising that these mercenaries are allies of the children of darkness and hate the children of light: just as there is a deep state, there is also a deep church that betrays its duties and forswears its proper commitments before God. Thus the Invisible Enemy, whom good rulers fight against in public affairs, is also fought against by good shepherds in the ecclesiastical sphere.

https://americansbulletin.com/archbishop-viganos-powerful-letter-to-trump/

Anyone that speaks of, writes of, publishes of anything that is New Age is a Luciferian Satanist. The same is said for those who propagate UNIVERSALISM and UNITY OF ALL "RELIGIONS". There is NO UNITY and UNIVERSALISM in Yeshua Jesus Christ (John 14:6 & John 3:16-17). Yeshua HATED the "Religions" of this wretched world. GOD ALMIGHTY cannot have nor can anyone stand before Him and within Him that is of the "Religions" of this world. GOD'S STANDARD is His Holy Son, Yeshua Jesus Christ.

This is why I state that there will be NO PEACE without Yeshua Jesus Christ. A Real True Christian CANNOT separate him or herself from the Holy Love of God through Yeshua Jesus Christ and accept and dwell within and about the "Religions" of this world. Only The Cross of Yeshua Jesus Christ is Salvation and Peace,, and UNITY.

This "Movement" has been HIJACKED by Luciferian Satanist via this "New Age" CRAP GARBAGE.

Over my dead body I bow down to this CRAP GARBAGE. They can kill my body, but they SHALL NOT KILL MY SOUL.

Galatians 1:8

“But though we, or an angel from heaven, preach any other gospel unto you than that which we have preached unto you, let him be accursed.”

FALSE TEACHINGS/TEACHERS: MATTHEW CHAPTER 24

ISLAM, LDS MORMONS, BUDDHISM, HINDU, KRISHNA, EGYPTIAN MYTHOLOGY, NORDICISM, BABYLONIAN MYSTICISM, LUCIFERIAN SATANISM, FREEMASONRY, THEOSOPHY, FABIANISM, MARXISM, SOCIALISM, COMMUNISM, NAZISM, TOTALITARIANISM, AUTHORITARIANISM, REPLACEMENT THEOLOGY, ETC…

ALL ARE OF LUCIFER SATAN THE DEVIL.

EXPOSING GESERA & NESERA and SO MUCH MORE

https://youtu.be/_XSsGjImpgc

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65543

File: 5600d4bde628ab7⋯.png (530.72 KB,849x787,849:787,Clipboard.png)

Originally posted at >>>/qresearch/13944013 (201256ZJUN21) Notable: Bogus Fact-Check Site Used by Google Lists All Conservative Outlets as “Low Credibility” – But Lists All Far Left and Liberal Mainstream Outlets as High Credibility

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://www.thegatewaypundit.com/2021/06/bogus-fact-check-site-used-google-lists-conservative-outlets-low-credibility-lists-far-left-liberal-mainstream-outlets-high-credibility/

Bogus Fact-Check Site Used by Google Lists All Conservative Outlets as “Low Credibility” – But Lists All Far Left and Liberal Mainstream Outlets as High Credibility

By Alicia Powe

Published June 20, 2021 at 7:35am

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65544

Originally posted at >>>/qresearch/13944023 (201259ZJUN21) Notable: #17649

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Some Notes for any collectors @ 650ish #17649

>>65507 BlackRock in The White House

>>65509 Lawfare Activists Apoplectic Because The Arizona Senate Will Not Provide Advanced Details of Internal Audit Documents

>>65515 China claims it has administered its billionth dose of the #COVID19 vaccine over the weekend

>>65517 Greta says Climate Crisis doesnt exist?

>>65520 For keks

>>65522 Technology company remotely turns up Texas smart thermostats during heat spike, update

>>65532 Behind the scenes at the WH on why Dr. Fauci nixed proven lifesaving COVID solutions

>>65533 Beijing Guodian Gaoke Technology Co has successfully put a satellite named after Jiaxing

>>65534 Newsome bailed out weed industry? Who are they laundering for, for realz?

>>65538 POTUS on OANN this AM

Happy Fathers Day

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65545

Originally posted at >>>/qresearch/13944053 (201309ZJUN21) Notable: #17647, #17648, #17649

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13943319 #17649

>>65501, >>65539 Baker Change

>>65502 France votes in first round of regional elections

>>65503 After O'Keefe interview Journalist Ivory Hecker has over $175K pledged on a fundraising campaign

>>65504 I want my mother*** Trump back

>>65505 Reminder: Trump pledges to make Juneteenth federal holiday in bid for Black voters

>>65506 We are the news is down

>>65507 BlackRock in The White House

>>65508 Tom MacDonald Lyrics "Snowflakes"

>>65509 Lawfare Activists Apoplectic Because The Arizona Senate Will Not Provide Advanced Details of Internal Audit Documents

>>65510, >>65512, >>65514, >>65525 To all fathers, Happy Father's Day.

>>65511 Ralph Ellison, the author of 'Juneteenth' is the same author of 'Invisible Man'

>>65513 Joe makes Hunter look like a piker

>>65516 16 y/o child has managed to get both doses of Pfizer against her parents' will.

>>65518 Dr. Douglas Frank: 2020 Election Data Research Reveals Troubling Patterns

>>65517 Did Greta flip, telling the truth? saying the climate crisis doesn't exist on msnbc

>>65519 Twitter silenced my account. Facebook restricted our page. Our original web hosting provider disabled our website. They even censored published medical studies.

>>65521 victoria-chief-executive-jamie-twidale-investigated

>>65523 1 dead, another injured after pickup truck drives into crowd at Stonewall Pride Parade in Wilton Manors

>>65524 Dan ScavinoFlag of United StatesEagle

>>65526 Congress Passes Law To Recognize Juneteenth, The Day Republicans Freed All The Democrats' Slaves

>>65527 Dan Scavino OHIO — 7 DAYS!!! #MAGAFlag of United StatesEagle

>>65528 This is Chicago Warning graphic.

>>65529 New Hampshire Libertarian Party Sees A Coup As New Libertarian Options Arise

>>65530 Contact Your Local Senators and #DemandAudits

>>65531 Plandemic?

>>65532 @RealPNavarro takes us behind the scenes at the White House on why Dr. Fauci nixed data proven lifesaving COVID solutions.

>>65535 Georgia Secretary of State Raffensperger Received Report Showing Egregious Election Issues Yet He Concealed Report and Claimed State Had “Safe, Secure, and Honest Elections”

>>65536 Amazon dumps Frontline Doctors site for 'misinformation about vaccines'

>>65537 :QUANTUM-GRAMMAR-CHANNEL:

:Part 1 of the Six-Part-Video-Communications.

>>65538 POTUS on OANN this am

>>65540 University Of Florida Lab Finds Dangerous Pathogens On Children's Face Masks

>>65541 The work of the #USArmy is a complex combination of missions, tasks and responsibilities — all in constant motion.

>>65542 Portion of the letter that Archbishop Carlo Maria Viganò penned to President Trump.

>>65543 Bogus Fact-Check Site Used by Google Lists All Conservative Outlets as “Low Credibility” – But Lists All Far Left and Liberal Mainstream Outlets as High Credibility

>>65544 #17649

>>65515 China claims it has administered its billionth dose of the #COVID19 vaccine over the weekend

>>65520 For keks

>>65522 Technology company remotely turns up Texas smart thermostats during heat spike, update

>>65533 Beijing Guodian Gaoke Technology Co has successfully put a satellite named after Jiaxing

>>65534 Newsome bailed out weed industry? Who are they laundering for, for realz?

FINAL CHEKM ANONS BAKING NOW

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65546

File: 06ca4d631a5dcfb⋯.png (646.13 KB,1096x624,137:78,Clipboard.png)

File: a3de5b130359f4b⋯.png (887.64 KB,1100x792,25:18,Clipboard.png)

Originally posted at >>>/qresearch/13944128 (201333ZJUN21) Notable: Vaccinated people are being TRACKED in real time

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Don't know if this is legit, but would not consider a stretch. Short vid in link of the Russian hacker intel.

Vaccinated people are being TRACKED in real time

June 20, 2021

https://steverotter.com/vaccinated-people-are-being-tracked-in-real-time/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65547

File: bffee8fe5a75409⋯.jpg (23.91 KB,378x262,189:131,Clipboard.jpg)

Originally posted at >>>/qresearch/13944139 (201337ZJUN21) Notable: How to watch the full "strawberry" moon, the last supermoon of 2021

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

How to watch the full "strawberry" moon, the last supermoon of 2021

From a lunar eclipse to a partial solar eclipse to supermoons, 2021 has been a spectacular year for lunar events. But this month marks the year's final supermoon, with the full "strawberry" moon illuminating the night sky next week.

A supermoon occurs when the moon is at its closest point to Earth in its orbit, known as perigee. It appears slightly larger and brighter than a typical full moon. However, scientists have yet to agree on exactly how to officially classify the phenomenon, so there is some disagreement as to whether June's moon counts as a supermoon.

"For 2021, some publications consider the four full Moons from March to June, some the three full Moons from April to June, and some only the two full Moons in April and May as supermoons," NASA's Gordon Johnston said.

The June full moon is often called the strawberry moon, named by Native American tribes for the strawberries harvested in parts of North America during this time of year, according to the Farmer's Almanac. Unfortunately, the moon's color won't match its name.

The strawberry moon typically marks the last full moon of spring or the first of summer. It has also been called the blooming moon, green corn moon, hoer moon, birth moon, egg laying moon and hatching moon, honey moon and mead moon, The Farmer's Almanac said.

The phrase "honeymoon" may be tied to this full moon, possibly due to the tradition of marrying in June or because the "honey moon" is the "sweetest" moon of the year.

The full moon will reach peak illumination on Thursday, June 24, at 2:40 p.m. ET, but won't be visible until it rises above the horizon later that evening. It will appear full for about three days surrounding this time, from about Wednesday morning through Saturday morning.

You can find the exact moonrise and moonset times for your location from timeanddate.com.

Don't have a clear view of the celestial event from your location? You can watch it live from your home instead, with Virtual Telescope Project's livestream of the moon over Rome on June 24, starting at 3 p.m. ET.

https://www.yahoo.com/news/watch-full-strawberry-moon-last-122507384.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65548

File: 7c934a6a241da3e⋯.png (333.11 KB,543x669,181:223,Clipboard.png)

Originally posted at >>>/qresearch/13944145 (201338ZJUN21) Notable: Muh teen

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

check against timestamp mil time….this seems dasting!

not in a stormy daniels kinda way….

thank to the anon who nomme'd it…

https://twitter.com/USArmy/status/1406056112609271809

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65549

File: 9dfb24c2a580c7a⋯.png (109.52 KB,1394x534,697:267,Clipboard.png)

Originally posted at >>>/qresearch/13944151 (201340ZJUN21) Notable: The ‘Defund the Police’ Movement Has a Broader Agenda and Its Not to Stop the Killing of Black People: Brandon Tatum

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The ‘Defund the Police’ Movement Has a Broader Agenda and Its Not to Stop the Killing of Black People: Brandon Tatum

June 19, 2021

https://www.theepochtimes.com/the-defund-the-police-movement-has-a-broader-agenda-and-its-not-to-stop-the-killing-of-black-people-brandon-tatum_3864676.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65550

File: 51c793a7d91e9de⋯.png (1.07 MB,1024x683,1024:683,Clipboard.png)

Originally posted at >>>/qresearch/13944168 (201347ZJUN21) Notable: Muh teen

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65548

>https://twitter.com/USArmy/status/1406056112609271809

17 words-

Every #Soldier knows that their duty is to accomplish their tasks as part of a larger #ArmyTeam!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65551

Originally posted at >>>/qresearch/13944189 (201354ZJUN21) Notable: , , Happy Father's Day Messages

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://gab.com/realdonaldtrump/posts/106443363904255919

Happy Father’s Day to all, including the Radical Left, RINOs, and other Losers of the world. Hopefully, eventually, everyone will come together!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65552

Originally posted at >>>/qresearch/13944224 (201404ZJUN21) Notable: #17648

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13944122

BAKER IS BACK

#17648

>>65485 CodeMonkeyZ, Dont want to provide election router data? Just connect your election servers to every other network in the county.

>>>/qresearch/13942616 screenshots of this Memo which was on Professor Neil Ferguson’s computer yesterday.

>>65489 still waiting on the passwords and the router logs from the slimy Maricopa County Supervisors.

>>65491 911 explained in 5 minutes

>>65493In an honest statewide election in Georgia with paper ballots, Stacey Abrams would not receive 25% of the vote.

>>>/qresearch/13942685 Did the Titanic Really Sink? The Olympic Switch Theory

>>>/qresearch/13942697, >>>/qresearch/13943103 Was this a hit on Debbie Wasserman?

>>>/qresearch/13942798 Steve Pieczenik explains the election was a sting and there's an ongoing military coup:

>>>/qresearch/13942804 The murder rate in St. Louis, Missouri, which is at a 50-year high, is reportedly the highest in the country.

>>65497 Sorry California. Dams to provide water for ya?

>>65498 Diebold was founded in 1859 and was acquired by ES&S in 2009 and later changed names to Dominion

>>>/qresearch/13942881, >>>/qresearch/13942892 Missing 13th Amendment?

>>>/qresearch/13942964 What is Anon. (cap)

>>>/qresearch/13943111 CIA veterans explain how they used spy tactics to raise their kids

>>>/qresearch/13943148 Dream Yoga (PDF)

>>>/qresearch/13943185 SEEK THE TRUTH!

>>>/qresearch/13943259 Biden Land Management nominee ‘collaborated with eco-terrorists,’ traded testimony for immunity

>>>/qresearch/13943268 Newly discovered frog species named after Led Zeppelin

>>>/qresearch/13943270 Retired Navy SEAL running for office in WI.

>>>/qresearch/13943280 Truck runs over two people, killing one, at Florida Pride parade

>>>/qresearch/13943298 HAPPY FATHER'S DAY anons!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65553

File: 1e2583e6916c0f4⋯.mp4 (2.16 MB,240x426,40:71,Clipboard.mp4)

Originally posted at >>>/qresearch/13944240 (201406ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65554

Originally posted at >>>/qresearch/13944272 (201412ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

>FAUCI NECK JUMPING AROUND LIKE CGI OR MASK

notable

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65555

Originally posted at >>>/qresearch/13944277 (201413ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

wow. that's a fake

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65556

Originally posted at >>>/qresearch/13944286 (201415ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

anyone have the sauce?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65557

Originally posted at >>>/qresearch/13944289 (201415ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

unmasking!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65558

File: 340a0f30713fc63⋯.jpg (205.39 KB,912x428,228:107,Clipboard.jpg)

Originally posted at >>>/qresearch/13944298 (201419ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

Sloppy job, Ellen

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65559

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13944300 (201419ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

Sauce

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65560

File: 50c64b7b8247620⋯.png (1.41 MB,1345x4185,269:837,Clipboard.png)

File: 166173646fb7225⋯.mp4 (11.43 MB,426x320,213:160,Clipboard.mp4)

Originally posted at >>>/qresearch/13944302 (201419ZJUN21) Notable: Vaccinated people are being TRACKED in real time

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65546

>https://steverotter.com/vaccinated-people-are-being-tracked-in-real-time/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65561

File: 23c7b1f217856c5⋯.jpg (139.67 KB,657x708,219:236,Clipboard.jpg)

Originally posted at >>>/qresearch/13944317 (201423ZJUN21) Notable: …Pro-Abortion Congressman Ted Lieu ‘Dares’ Bishops to Deny Him Holy Communion…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Pro-Abortion Congressman Ted Lieu ‘Dares’ Bishops to Deny Him Holy Communion

https://www.breitbart.com/politics/2021/06/20/pro-abortion-congressman-ted-lieu-dares-bishops-to-deny-him-holy-communion/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65562

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13944320 (201423ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65559

Oops correction

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65563

File: 88234e87f3495dc⋯.mp4 (2.73 MB,600x330,20:11,Clipboard.mp4)

Originally posted at >>>/qresearch/13944326 (201424ZJUN21) Notable: Dr. Steve Pieczenik "we are in the midst of a military coup

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Dr. Steve Pieczenik "we are in the midst of a military coup

>>>/qresearch/13942798 /lb

>>>/qresearch/13942911 /lb

>>>/qresearch/13943028 /lb

>I know how most feel about AJ here, but Steve Pieczenik explains the election was a sting and there's an ongoing military coup:

>https://banned.video/watch?id=60ce3e71de2c0c19ed4542ed

>Start 3 hours in, 180 minutes.

Lemme help ya out a minute…

-ripped

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65564

File: 859c329625f18c3⋯.jpg (82.95 KB,713x620,23:20,Clipboard.jpg)

Originally posted at >>>/qresearch/13944333 (201426ZJUN21) Notable: Dr. Steve Pieczenik "we are in the midst of a military coup

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65563

There a vid of him on his Twitter ripping into bidan concerning calling putin a killer..but its too big to post..

He is an interesting follow

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65565

File: 30e836451bf1bfc⋯.png (369.08 KB,677x451,677:451,Clipboard.png)

Originally posted at >>>/qresearch/13944343 (201429ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65562

you're right that's the video Feb 2021

>>65559

yes this one is more recent May 2021. Looks like the CGI is improved? Now looks like a legit flap of skin that happens to fit his shirt perfectly.

It reminds me of the Jaws actor who just happens to have a ridge above his nose where his glasses fit perfectly. Naivety

with reactions: >>65553

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65566

Originally posted at >>>/qresearch/13944350 (201429ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

Fake.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65567

File: 4a820039d272acd⋯.png (738.18 KB,1586x1078,793:539,Clipboard.png)

File: aa85006aac223cb⋯.png (626.77 KB,1540x1084,385:271,Clipboard.png)

Originally posted at >>>/qresearch/13944374 (201434ZJUN21) Notable: Vaccinated people are being TRACKED in real time

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65560

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65568

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13944378 (201435ZJUN21) Notable: Still no MSM reports on the biggest discovery in biomedical history. Far bigger than Harvey's circulation of blood, the manipulation of biogenetic field allows us to restore youthful functionality or regrow entire limbs or organs.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Still no MSM reports on the biggest discovery in biomedical history. Far bigger than Harvey's circulation of blood, the manipulation of biogenetic field allows us to restore youthful functionality or regrow entire limbs or organs.

This is the best of the Levin YT interviews, as it describes the discovery and the experiments they've done in manipulating the field by control ion channels etc.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65569

File: 3f6e07e69cac9a8⋯.png (1.17 MB,2810x1300,281:130,Clipboard.png)

Originally posted at >>>/qresearch/13944395 (201438ZJUN21) Notable: PF Reports

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Venus93

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65570

File: 8f2abefa2c54f8b⋯.png (89.08 KB,382x721,382:721,Clipboard.png)

File: a37371b4cf1f397⋯.png (319.96 KB,1080x1482,180:247,Clipboard.png)

Originally posted at >>>/qresearch/13944407 (201440ZJUN21) Notable: , , Happy Father's Day Messages

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

POTUS45 's FATHER'S DAY MESSAGE:

https://twitter.com/realLizUSA/status/1406610410845921289

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65571

File: 1cf4b3e5b5ef4a8⋯.png (1.14 MB,1280x720,16:9,Clipboard.png)

Originally posted at >>>/qresearch/13944422 (201444ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

Nice.

Catch.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65572

File: e9948d334bf07e6⋯.jpg (139.67 KB,644x347,644:347,Clipboard.jpg)

Originally posted at >>>/qresearch/13944423 (201444ZJUN21) Notable: Non-profit tied to BLM co-founder Patrisse Cullors 'failed to disclose at least $175,000 in donations to the IRS' leading to demands for audit

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Non-profit tied to BLM co-founder Patrisse Cullors 'failed to disclose at least $175,000 in donations to the IRS' leading to demands for audit

https://www.dailymail.co.uk/news/article-9705323/Non-profit-tied-BLM-founder-Patrisse-Cullors-failed-disclose-donation-report-says.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65573

Originally posted at >>>/qresearch/13944430 (201446ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

Is that Tom Cruise?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65574

File: 0ef88ebd17fd54b⋯.jpg (139.67 KB,651x459,217:153,Clipboard.jpg)

Originally posted at >>>/qresearch/13944436 (201447ZJUN21) Notable: Just in time… Fury as New York prosecutors DROP looting charges against HUNDREDS arrested during riots last summer - with Manhattan DA 'too busy building his case against Trump'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Fury as New York prosecutors DROP looting charges against HUNDREDS arrested during riots last summer - with Manhattan DA 'too busy building his case against Trump'

https://www.dailymail.co.uk/news/article-9705219/Fury-New-York-prosecutors-DROP-looting-charges-against-hundreds-arrested-summer.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65575

File: ab9e8110659a9f1⋯.jpeg (272.56 KB,657x913,657:913,Clipboard.jpeg)

Originally posted at >>>/qresearch/13944444 (201449ZJUN21) Notable: RSR

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65576

File: cdbf0c6a41c06e2⋯.png (79.82 KB,1022x728,73:52,Clipboard.png)

File: 590ff2731131d00⋯.png (105.52 KB,1225x823,1225:823,Clipboard.png)

File: dc2222a36f27cec⋯.png (94 KB,1224x832,153:104,Clipboard.png)

Originally posted at >>>/qresearch/13944457 (201450ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

>>65562

People have noticed its fake/a mask

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65577

File: 26ee213d56cd743⋯.mp4 (10.53 MB,640x360,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13944464 (201452ZJUN21) Notable: Fake News Social Engineering Exhibit One. Later on Newsweek…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65553

>>65573

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65578

File: 24699139b74e107⋯.png (191.84 KB,395x642,395:642,Clipboard.png)

Originally posted at >>>/qresearch/13944466 (201452ZJUN21) Notable: RSR

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65575

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65579

File: f441e0cad3ad787⋯.png (138.12 KB,1012x613,1012:613,Clipboard.png)

Originally posted at >>>/qresearch/13944469 (201453ZJUN21) Notable: Remember The Alamo… (Texas) California!

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13944459

Did someone say thermostat?

https://www.prnewswire.com/news-releases/ohmconnect-to-give-away-1-million-free-smart-thermostats-to-end-california-blackouts-301312735.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65580

File: f4e1beb8fba89a2⋯.png (198.62 KB,751x594,751:594,Clipboard.png)

File: 0b764b083bb253b⋯.png (31.51 KB,911x831,911:831,Clipboard.png)

File: 669a1e3ec9371b1⋯.png (27.82 KB,958x826,479:413,Clipboard.png)

File: e3314db1d7b2d31⋯.png (24.34 KB,1016x697,1016:697,Clipboard.png)

Originally posted at >>>/qresearch/13944471 (201454ZJUN21) Notable: CDC senior scientist: 'We trashed data showing vaccine-autism link in African-American boys'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://sharylattkisson.com/2021/06/read-cdc-senior-scientist-we-trashed-data-showing-vaccine-autism-link-in-african-american-boys/

(READ) CDC senior scientist: 'We trashed data showing vaccine-autism link in African-American boys'

Dated: June 19, 2021 by Sharyl Attkisson 9

Drip drip floooooooood.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65581

File: fad3719c54c6195⋯.png (63.62 KB,400x600,2:3,Clipboard.png)

Originally posted at >>>/qresearch/13944490 (201458ZJUN21) Notable: George Poage

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

https://en.wikipedia.org/wiki/George_Poage

Why in the world the black community, in general, has had chosen for them, by their commie leaders, george floyd as someone to be a roll model.

Here is someone I never heard of and he achieved many first for African Americans.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65582

File: b9703f983645d99⋯.mp4 (2.05 MB,852x480,71:40,Clipboard.mp4)

Originally posted at >>>/qresearch/13944505 (201501ZJUN21) Notable: CDC senior scientist: 'We trashed data showing vaccine-autism link in African-American boys'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65583

File: 9a6f71e065d36d7⋯.png (39.43 KB,496x302,248:151,Clipboard.png)

Originally posted at >>>/qresearch/13944510 (201503ZJUN21) Notable: , , Happy Father's Day Messages

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Mike Pompeo

@mikepompeo

“Peace I leave with you; my peace I give you. I do not give to you as the world gives. Do not let your hearts be troubled and do not be afraid.” John 14:27

#SundayScripture Latin cross

9:48 AM · Jun 20, 2021·Twitter Web App

https://twitter.com/mikepompeo/status/1406609898541027330

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65584

File: f7f11b9413510ea⋯.jpeg (649.49 KB,743x1559,743:1559,Clipboard.jpeg)

Originally posted at >>>/qresearch/13944514 (201504ZJUN21) Notable: Justin Knight, president of the Fort Lauderdale Gay Men’s Chorus, said Saturday evening that both the driver and the victims of a tragic accident at a Gay Pride parade were part of his group, after the local mayor claimed the crash was “deliberate.”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Justin Knight, president of the Fort Lauderdale Gay Men’s Chorus, said Saturday evening that both the driver and the victims of a tragic accident at a Gay Pride parade were part of his group, after the local mayor claimed the crash was “deliberate.”

https://www.breitbart.com/politics/2021/06/19/gay-mens-chorus-leader-this-was-not-an-attack-on-the-lgbtq-community-fort-lauderdale/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65585

File: 1ee81db31e8f15f⋯.mp4 (6.71 MB,1280x720,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13944515 (201504ZJUN21) Notable: US Navy released the footage of the 40,000-pound bomb explosion that triggered a M3.9 quake during a "shock trial" on the aircraft carrier USS Gerald R. Ford.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

UPDATE - US Navy released the footage of the 40,000-pound bomb explosion that triggered a M3.9 quake during a "shock trial" on the aircraft carrier USS Gerald R. Ford.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65586

File: 8859ce63ee2ed17⋯.jpg (139.67 KB,849x230,849:230,Clipboard.jpg)

Originally posted at >>>/qresearch/13944523 (201506ZJUN21) Notable: Race Riot Fuel Anyone? George Soros Interested in Funding Reparations Program in Los Angeles, According to Report

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

George Soros Interested in Funding Reparations Program in Los Angeles, According to Report

https://www.thegatewaypundit.com/2021/06/george-soros-interested-funding-reparations-program-los-angeles-according-report/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65587

Originally posted at >>>/qresearch/13944542 (201510ZJUN21) Notable: Nice work

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>>/qresearch/13943584 #17650

>>>/qresearch/13943584 Q Research General #17650: Boom Week Edition (#QResearch)

>>>/qresearch/13943997, >>>/qresearch/13944130, >>>/qresearch/13944146, >>65551, >>>/qresearch/13944204, >>>/qresearch/13944234, >>>/qresearch/13944266 Happy Father's Day!

>>>/qresearch/13944079 #17649

>>>/qresearch/13944096 Baker reqst to collect partials.

>>65547 How to watch the full "strawberry" moon, the last supermoon of 2021

>>65548 Check against timestamp mil time

>>65549 The ‘Defund the Police’ Movement Has a Broader Agenda and Its Not to Stop the Killing of Black People

>>>/qresearch/13944160 Here’s Reagan’s October 23, 1947 testimony to the The House Un-American Activities Committee

>>>/qresearch/13944180 Reminder: Pope Francis Suggests Changing The Words To The 'Lord's Prayer'

>>65552 #17648

>>65553 Is Fauci Dep Fake Vid?

>>>/qresearch/13944249 "Since the climate crisis doesnt exist." -Gretable

>>>/qresearch/13944271 Dr. Douglas G. Frank on Analyzing the 2020 Election

>>65561 Pro-Abortion Congressman Ted Lieu ‘Dares’ Bishops to Deny Him Holy Communion

>>65563 Dr. Steve Pieczenik "we are in the midst of a military coup

>>>/qresearch/13944394 Cicada 3301 Markers

>>65569 Plane Report: Venus93

>>65570 POTUS45 's FATHER'S DAY MESSAGE:

>>65572 Non-profit tied to BLM co-founder Patrisse Cullors 'failed to disclose at least $175,000 in donations to the IRS' l

>>>/qresearch/13944438 wearethene.ws only showing white page 24+ hours now

>>65546 Vaccinated people are being TRACKED in real time

>>65580 CDC senior scientist: 'We trashed data showing vaccine-autism link in African-American boys

>>>/qresearch/13944479 Jürgen Conings found dead in Hoge Kempen National Park

>>>/qresearch/13944513 Georgia’s Dominion Voting System Implementation Manager Gabe Sterling Negotiated a $144,000 Salary Increase for Himself Last Year

>>65584 Fort Lauderdale mayor claimed the crash was “deliberate.”

>>65585 Bqqm Test.

>>65586 George Soros Interested in Funding Reparations Program in Los Angeles, According to Report

CHECK THAT SHIT ANONS!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65588

File: 07279a5e011a9ed⋯.jpg (139.67 KB,851x243,851:243,Clipboard.jpg)

Originally posted at >>>/qresearch/13944547 (201512ZJUN21) Notable: OUTRAGEOUS: Georgia Secretary of State Raffensperger Received Report Showing Egregious Election Issues Yet He Concealed Report and Claimed State Had “Safe, Secure, and Honest Elections”

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

OUTRAGEOUS: Georgia Secretary of State Raffensperger Received Report Showing Egregious Election Issues Yet He Concealed Report and Claimed State Had “Safe, Secure, and Honest Elections”

https://www.thegatewaypundit.com/2021/06/outrageous-georgia-secretary-state-raffensperger-received-report-showing-egregious-election-issues-yet-concealed-report-claimed-state-safe-secure-honest-elections/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65589

File: 004c0d4f67a2f6d⋯.png (284.74 KB,650x504,325:252,Clipboard.png)

Originally posted at >>>/qresearch/13944548 (201512ZJUN21) Notable: , , Happy Father's Day Messages

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65587

Reminder:

Our Father: Pope Francis approves changes to words of Lord's Prayer, reports say

https://eu.usatoday.com/story/news/world/2019/06/06/our-father-pope-francis-approves-changes-words-lords-prayer/1366459001/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65590

File: e24da5c5a8f0871⋯.jpg (139.67 KB,845x211,845:211,Clipboard.jpg)

Originally posted at >>>/qresearch/13944553 (201513ZJUN21) Notable: New Book Alleges Mike Pence Praised Trump Aide For Unloading on Trump Over Charlottesville Response

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

New Book Alleges Mike Pence Praised Trump Aide For Unloading on Trump Over Charlottesville Response

https://www.thegatewaypundit.com/2021/06/new-book-alleges-mike-pence-praised-trump-aide-unloading-trump-charlottesville-response/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65591

File: 427341fee404729⋯.png (169.8 KB,598x515,598:515,Clipboard.png)

File: 4bd107eb324baaa⋯.mp4 (389.64 KB,480x270,16:9,Clipboard.mp4)

Originally posted at >>>/qresearch/13944558 (201515ZJUN21) Notable: US Navy released the footage of the 40,000-pound bomb explosion that triggered a M3.9 quake during a "shock trial" on the aircraft carrier USS Gerald R. Ford.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

US Navy aircraft carrier USS Gerald R. Ford CVN78 shock test video. #aviation https://t.me/operline_ru/27097

https://twitter.com/clemente3000/status/1406626612796440579?s=20

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65592

File: 510955ebfed014f⋯.jpg (139.67 KB,854x292,427:146,Clipboard.jpg)

Originally posted at >>>/qresearch/13944563 (201516ZJUN21) Notable: IT WAS A VOTER FRAUD FACTORY: 2nd Carter Jones Report Describes Complete Breakdown of GA Election Systems — BALLOTS EVERYWHERE, NO CHAIN OF CUSTODY, COMPLETE DISARRAY and WE HAVE THE VIDEO

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

IT WAS A VOTER FRAUD FACTORY: 2nd Carter Jones Report Describes Complete Breakdown of GA Election Systems — BALLOTS EVERYWHERE, NO CHAIN OF CUSTODY, COMPLETE DISARRAY and WE HAVE THE VIDEO

https://www.thegatewaypundit.com/2021/06/voter-fraud-factory-2nd-carter-jones-report-describes-complete-breakdown-election-systems-ballots-everywhere-no-chain-custody-complete-disarray-video/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65593

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13944571 (201517ZJUN21) Notable: Rabies Bun… 28 days to stop flatten the curve…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

spotted this RABIES thread…

Fox That Attacked Girl in Ocean County, NJ, Had Rabies: Health Department

Young Lilith was one of two people in Jackson Township who were exposed to the animal over the weekend, the Ocean County Health Department said in a statement Wednesday. The 4-year-old was bit by the fox on Saturday

https://www.nbcnewyork.com/news/local/fox-that-attacked-girl-in-ocean-county-nj-had-rabies-health-department/3113613/

Imported dog with rabies came through O'Hare

A rabid dog imported into the United States this month has sparked a public health investigation across several states.

https://www.msn.com/en-us/lifestyle/pets/imported-dog-with-rabies-came-through-ohare/ar-AALcGtP

Rabies-infected bat found in Warwick

https://www.abc6.com/rabies-infected-bat-found-in-warwick/

Man dies of rabies

https://www.geo.tv/latest/355677-man-dies-of-rabies-after-refusing-to-get-vaccinated

Skunk tests positive for rabies in Big Horn County

https://billingsgazette.com/news/local/skunk-tests-positive-for-rabies-in-big-horn-county/article_a512740a-4d8a-5ac5-b984-1cbedd74028c.html

Another dog-bite victim dies within a week

“The patient [arrived] at the hospital with full-blown rabies, suffering from hydrophobia and aerophobia,”

https://www.dawn.com/news/1630041/another-dog-bite-victim-dies-within-a-week

Fox that bit 4-year old Jackson girl tests positive for rabies

The Ocean County Health Department has announced that the Fox, who bit a 4-year old girl outside a home between Aldrich Road and West Connecticut Concourse in Jackson over the weekend, has tested positive for rabies.

https://wobm.com/jackson-4-year-old-undergoing-treatment-as-fox-that-bit-her-tests-positive-for-rabies

Another human rabies death[/b] after patient declines PEP

Fourteen persons have so far died due to rabies

http://outbreaknewstoday.com/karachi-another-human-rabies-death-after-patient-declines-pep-36861/

___

did some digging…

(as rabies is also a 'bat virus', among other things)

pt1

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65594

File: 0e3d6e26c56f1d5⋯.jpg (81.69 KB,1018x1280,509:640,Clipboard.jpg)

Originally posted at >>>/qresearch/13944575 (201518ZJUN21) Notable: US Navy released the footage of the 40,000-pound bomb explosion that triggered a M3.9 quake during a "shock trial" on the aircraft carrier USS Gerald R. Ford.

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65585

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65595

File: e7c71a0c4a58ab2⋯.jpg (70.27 KB,986x586,493:293,Clipboard.jpg)

File: 9623766d8c38ee2⋯.jpg (104.61 KB,780x654,130:109,Clipboard.jpg)

File: 52a52b6ed42f5db⋯.jpg (363.98 KB,1200x675,16:9,Clipboard.jpg)

File: 87ea60539b093fb⋯.jpg (89.03 KB,577x638,577:638,Clipboard.jpg)

File: ec9296ace1863bc⋯.jpg (68.46 KB,399x606,133:202,Clipboard.jpg)

Originally posted at >>>/qresearch/13944576 (201519ZJUN21) Notable: Rabies Bun… 28 days to stop flatten the curve…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65593

pt. 2

Anons, do not fret, there is anmrna rabies vaccine for healthy adults!

Curevac makes "CV7201 is composed of 1 RNActive®mRNA that encodes the rabies virus glycoprotein."

dosage is at28 dayintervals

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65596

File: cb9cf46b9e779f6⋯.jpg (1.26 MB,2000x3000,2:3,Clipboard.jpg)

File: 2261eef79ee6e44⋯.jpg (137.67 KB,940x643,940:643,Clipboard.jpg)

File: 1173794ac05493a⋯.jpg (134.16 KB,940x643,940:643,Clipboard.jpg)

File: 6e00f8222adeff9⋯.jpg (73.51 KB,912x580,228:145,Clipboard.jpg)

File: d1aab9894f6a7af⋯.jpg (76.9 KB,957x548,957:548,Clipboard.jpg)

Originally posted at >>>/qresearch/13944580 (201520ZJUN21) Notable: Rabies Bun… 28 days to stop flatten the curve…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65593

>>65595

28 dayintervals

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65597

File: bd607452a626163⋯.jpg (106.49 KB,778x560,389:280,Clipboard.jpg)

File: acc4300da0a233b⋯.jpg (122.2 KB,789x620,789:620,Clipboard.jpg)

File: d00281d8b559e69⋯.jpg (113.19 KB,804x644,201:161,Clipboard.jpg)

File: c1182c22bb3b933⋯.jpg (97.14 KB,948x619,948:619,Clipboard.jpg)

File: 5d372f5f2af2883⋯.jpg (150.65 KB,931x647,931:647,Clipboard.jpg)

Originally posted at >>>/qresearch/13944587 (201523ZJUN21) Notable: Rabies Bun… 28 days to stop flatten the curve…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65596

>>65593

>>65595

Curevac company makes mrna vaccines for healthy people for rabies… AND 'covid'.

CVnCov

Notable

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65598

File: 32d6c5ef1b550dd⋯.png (443.96 KB,1192x666,596:333,Clipboard.png)

File: f488f3cc71486b6⋯.png (313.43 KB,1305x762,435:254,Clipboard.png)

File: d5e543ec1087a62⋯.png (447.77 KB,1226x730,613:365,Clipboard.png)

File: e7303857bd2e9d9⋯.png (368.46 KB,1298x737,118:67,Clipboard.png)

Originally posted at >>>/qresearch/13944615 (201529ZJUN21) Notable: TRUTH. British report calls for complete cessation of COVID vaccines in humans due to injuries

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Video on Tommy Robinson News

TRUTH. British report calls for complete cessation of COVID vaccines in humans due to injuries

I can't find this on the OANN website.

Can anyone confirm original URL?

Sorry too big to upload. Can download it from

t.me/WeTheMedia /23283

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65599

File: e530bc244d35de2⋯.png (2.02 MB,1518x1178,759:589,Clipboard.png)

Originally posted at >>>/qresearch/13944628 (201533ZJUN21) Notable: Fake News Gaslighting Private Citizens

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Kek, well played.

https://www.dailymail.co.uk/news/article-9705817/St-Louis-attorney-Mark-McCloskey-buys-new-gun-days-wife-surrendered-firearms.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65600

File: f1b49a8155d7f7d⋯.png (222.51 KB,644x820,161:205,Clipboard.png)

Originally posted at >>>/qresearch/13944634 (201534ZJUN21) Notable: TRUTH. British report calls for complete cessation of COVID vaccines in humans due to injuries

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65598

Chinese Virus Vaccine Produces ‘Toxic’ Effects, British Researchers Call On Govt. To Halt Use Immediately

OAN Newsroom

UPDATED 7:04 PM PT – Thursday, June 17, 2021

Researchers in Britain are calling on the government to halt their use of the coronavirus vaccine immediately after discovering potentially “toxic” side effects. One America’s Pearson Sharp has more.

https://www.oann.com/chinese-virus-vaccine-produces-toxic-effects-british-researchers-call-on-govt-to-halt-use-immediately/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65601

File: 79dc0c853d84522⋯.png (4.43 MB,2880x3708,80:103,Clipboard.png)

File: 165d2734a3138a9⋯.jpg (1.06 MB,2263x4091,2263:4091,Clipboard.jpg)

Originally posted at >>>/qresearch/13944647 (201536ZJUN21) Notable: ,Combating Social Engineers and Communist Idealist Subverters

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65587

>14c021 ←Vatican retard pretending to bake, notice his notable is green due to removal

>>65589

>14c021 ← Immediately repost the same article but forgets to IP hop.

Here's the best part though, if you pay close attention you will realize the GB/Vatican Retard are the same person. (picrel)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65602

File: ed3e625563faef4⋯.jpg (124.04 KB,663x660,221:220,Clipboard.jpg)

Originally posted at >>>/qresearch/13944656 (201538ZJUN21) Notable: …Pro-Abortion Congressman Ted Lieu ‘Dares’ Bishops to Deny Him Holy Communion…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Catholic Democrats Appeal to ‘Primacy of Conscience’ in Abortion Support

https://www.breitbart.com/politics/2021/06/19/catholic-democrats-appeal-primacy-conscience-abortion-support/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65603

Originally posted at >>>/qresearch/13944663 (201540ZJUN21) Notable: …Pro-Abortion Congressman Ted Lieu ‘Dares’ Bishops to Deny Him Holy Communion…

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65602

Sixty Catholic Democrats in Congress have written an open “Statement of Principles” explaining why the Catholic Church should not deny Holy Communion to professed Catholics who promote abortion.

https://delauro.house.gov/sites/delauro.house.gov/files/documents/Statement%20of%20Principles%206.18.21.pdf

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65604

File: 01d03ec8402cd46⋯.png (331.83 KB,599x638,599:638,Clipboard.png)

Originally posted at >>>/qresearch/13944687 (201544ZJUN21) Notable: "Just tell em you're a freedom fighter, slave." Shamima Begum 'wore an ISIS badge on her blazer to pressure classmates at Bethnal Green school into joining terror group'

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Shamima Begum 'wore an ISIS badge on her blazer to pressure classmates at Bethnal Green school into joining terror group'

https://twitter.com/DailyMailUK/status/1406635483518672900

GREEN

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65605

Originally posted at >>>/qresearch/13944692 (201544ZJUN21) Notable: ,Combating Social Engineers and Communist Idealist Subverters

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65601

>>65601

>>>/qresearch/13944668

>GB/Vatican Retard are the same person

I've been telling you guys for months. GB is the blocker for the COMMS faggots. He plays a bunch of different personas but they are all meant to aggravate and distract/annoy anons. "Look here, not over there."

When they were bakers he played "Rainman" to protect the bakers he liked but screaming Baker comped over nothing until anons ignored it so much they ignored real fuckery.

As Vatican shill he attacks good bakers and annoys/gaslights them until they quit.

And as GB he rushes in to protect the COMMS faggots whenever they are called out in the stream.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65606

YouTube embed. Click thumbnail to play.

Originally posted at >>>/qresearch/13944695 (201545ZJUN21) Notable: AZ UPDATE

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

EXPLOSIVE AZ Update

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65607

File: f1614608d6f0088⋯.png (448.24 KB,1618x396,809:198,Clipboard.png)

Originally posted at >>>/qresearch/13944704 (201546ZJUN21) Notable: ,Combating Social Engineers and Communist Idealist Subverters

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65605

See, I call it out and the attacks go full force.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.65608

Originally posted at >>>/qresearch/13944718 (201549ZJUN21) Notable: ,Combating Social Engineers and Communist Idealist Subverters

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

>>65607

>See, I call it out and the attacks go full force.

They attempt to rally up and see who is supportive, what ACTUAL supporters they have, and who they can target to drive further awai.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7dc76a No.66361

Follow-up thread

>>98

>>98

Follow-up thread

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.



[Return][Go to top][Catalog][Nerve Center][Random][Post a Reply]
[]
[ / / / / / / / / / / / / ] [ r8k / ck / wooo / fit / random / cuteboys / erp / furry / htg / join / k / tingles / warroom ]