027456 No.20450895 [Last50 Posts]
Welcome to Q Research General
We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.
"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."
VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH
Q's Latest Posts
>>18284019 Nov. - Dec. 2022
Q's Private Board
>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6
Find Q drops here
Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku
Q Posts Archives
* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u
* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app
* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news
* Q Raw Text Dumps: q-clock.com/q_raw.txt
* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/
* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188
* Q Research Notables: Archive Board >>>/qnotables/
* Q Adjacent infographs and moar: https://deepstatemappingproject.com/
Q Research Board
Key Resources below. Check Dough Resource thread for more: >>17225239
New to QR?
>>17240320 Welcome to Q Research | >>20424387 Board Info
Join Us
>>17322509 LEARN TO BAKE | >>17322518 E-BAKE Instructions
>>20440436 MEME WARRIOR UI 1.2 updated Feb 19, 2024 NEW
Threads
>>17253611 Dedicated Resource Threads
>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon
TOR Access
TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html
TOR Banner: https://www.youtube.com/watch?v=MLCupx1UExg
____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
027456 No.20450896
International Q Research Threads
>>20092798 ——–——– Australia #34
>>20362754 ——–——– Canada #53
>>16694358 ——–——– France #7
>>19988670 ——–——– Germany #106
>>20187083 ——–——– Japan #21
>>16694250 ——–——– Nederland #10
>>17784579 ——–——– QAJF #1
>>20038152 ——–——– Scotland #9
>>19636057 ——–——– South Africa #12
>>19804572 ——–——– UK #51
GLOBALS
Bunker = https://endchan.org/qrbunker/catalog.html
>>20022853 Posting Guidelines
>>19832150, >>19957123, >>19737197 SPAM Removal; >>20184855 Jim W. on spam
>>19089056 Ban lifts, video downloads, Q clock, Joe M's videos, Qagg Download
>>18024378, >>18561054 Updated PROTO Instructions
>>20186509 How to filter namefags
Bakers:
>>19089065 Baking Tools & Guidelines - NEW BAKERS, PLEASE READ
>>17322509, >>17322518 How to bake/e-bake
>>17835052 Formatting Q posts
>>20186534 No "Muh Joos" in notes. Discrimination based on race or religion will be removed
Plz sign out clearly when e-baking or ghosting, use RED TEXT
NOTABLES ARE NOT ENDORSEMENTS
#25087 >>20449859
>>20449916 How British Intelligence Framed Julian Assange As Russian Agent
>>20450000 Russia could 'blind' the US by taking out satellites using a nuclear space weapon, says ex-CIA chief
>>20450007 Tribute to Dr. Vladimir Zelenko
>>20450118 Joe M Archive is up-to-date and complete
>>20450133 Russian church blasts Vatican over gay blessings
>>20450640 Ex-Barclays exec Jes Staley, Jeffrey Epstein emails revealed: 'Say hi to Snow White'
>>20450740 Stanley drink cups have an added surprise in them that the manufacturers failed to mention: Lead
>>20450769 “Children should have sex partners” -- The UN agenda to normalize pedophilia
>>20450789 DJT TS w/CAP: SOL WISENBERG: “JUDGE’S DECISION IS AN ETHICAL DEBACLE…TRUMP FINE IS A THREAT TO CONSERVATIVES…”
>>20450797 X account of Yulia Navalnaya, widow of Alexei Navalny, has been suspended one day after its creation for allegedly violating X rules
>>20450843, >>20450860 Leftist Tyrant Letitia James Threatens to Seize President Trump’s Assets if He Can’t Pay Outrageous Court Fine Ordered by Judge Engoron In New York Civil Fraud Trial
>>20450847 A Federal Court Overturned The EPA’s Ban On The Neurotoxic Pesticide Chlorpyrifos. This Chemical Was Developed For Chemical Warfare During WW2
>>20450856 OANN - Massachusetts: Girls High School Sports Team Forfeits After 6-Foot Male Identifying As Female Injures 3 Players
>>20450884 #25087
#25086 >>20449071
>>20449206 First 30 min of Town Hall w/ President Donald Trump and Laura [ing]errorham (only sauce we got)
>>20449101, >>20449117, >>20449210, >>20449138, >>20449125, >>20449130, >>20449245, >>20449211, >>20449198 Holly Berries
>>20449118, >>20449132, >>20449161 Kirk Cameron Exposes How The Marxists Infiltrate The Mind Of Children
>>20449121 Columbia, Missouri: City Council approves safe haven for LGBTQ+ residents
>>20449126 #OTD in 2008, USS Lake Erie (CG 70) launched a modified Standard Missile-3 (SM-3)
>>20449222 Poll reveals 8 out of 10 Americans hold negative views about Biden Regime's handling of illegal immigration
>>20449235 1 in 28 (3.57%) of all American deaths are now caused by drug overdoses
>>20449297 Israel-Hamas War: Norman Finkelstein vs Rabbi Shmuley
>>20449331 Call your congressman and Senate Rep daily, hourly until they get the message
>>20449336 Antidote for COVID Vaccine Graphene Nano-Bioelectronic Intoxication for Prevention and Recovery
>>20449345 Revisionist historian David Irving talks about his life, his books and the importance of free speech
>>20449352 Utah's New "Sovereignty Act"
>>20449370 Biden DoJ: FBI Informant Arrested by Feds Claims ‘Russian Intelligence’ Involved in Passing Along Hunter Biden Burisma Story
>>20449386 Universe’s brightest object reportedly discovered, featuring black hole the size of 17 billion suns
>>20449409 Apparently some ways to boost your reach on the socials algorithm
>>20449456 Leftist Tyrant Letitia James Threatens to Seize President Trump’s Assets if He Can’t Pay Outrageous $400mil Court Fine
>>20449457 Attorney General Ken Paxton: Today, I’m suing to end NGO's operations in Texas
>>20449484 Marcella Tillett abruptly resigns as head of Eric Adams’ ‘Mayor’s Fund’ for NYC after just 16 months
>>20449497 California budget crisis worse than Newsom projected, as state watchdog warns deficit could reach record $73B
>>20449502 Russia Places Lindsey Graham on Their “Terrorists and Extremists” List
>>20449515 New Zealand Greens MP Efeso Collins, 49, suddenly collapses and dies at charity event ChildFund Water Run in Auckland
>>20449539 State Supreme Court Rules Embryos Are Children
>>20449546 30 minutes after departing Albuquerque, man tries to aggressively open airplane door
>>20449549, >>20449591 DoD / DoE News Releases
>>20449606, >>20449594, >>20449628, >>20449646, >>20449680, >>20449707 Anons discuss Peekaboobs wanting to seize Trump's properties
>>20449664 How Israel Merked its Own Civilians on October 7
>>20449713 The Chinese know history
>>20449776 Don't fail the children
>>20449802, >>20449807 Moar FISA
>>20449842 #25086
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
027456 No.20450898
#25085 >>20448296
>>20448595, >>20448571 Trump Town Hall with Laura Ingraham
>>20448345 Planefag
>>20448362, >>20448715 The Authoritative Personality (1950), Adorno T. W.
>>20448367 What is Smart Dust?
>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid
>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group
>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine
>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme
>>20448515, >>20448586, >>20448608 Understanding PCR
>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death
>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton
>>20448652 Egypt Stops Use Of US Dollar For Trade - Joins BRICshitters
>>20448677 NY Bill would allow children to consent to medical procedures
>>20448804 Bannon: Trump's Representing The American People, He's Putting You First - Biggest fundraiser in SC for Trump, $6.5 million
>>20448816 Tustin, California: Confirmed Explosion at a shopping center lockdowns and evacuation in place
>>20448871 United Airlines flight #UA354, a Boeing 757-224, diverts after pieces from inner leading edge slat of right-hand wing broke off
>>20448960 [ing] error
>>20449011 What are Immunization Information Systems (IIS)?
>>20449039 (2013) Nikki Haley “Sold Out Port” For $15K
>>20449055 #25085
Previously Collected
>>20448270 #25084,
>>20445764 #25081, >>20446644 #25082, >>20447482 #25083
>>20443029 #25078, >>20443831 #25079, >>20444740 #25080
>>20441455 #25075, >>20441317 #25076, >>20442191 #25077
Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com
Q Research Notables Archive Board >>>/qnotables/
Q Research Notables #21: Purpose >>19961525
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
027456 No.20450903
DOUGH
https://fullchan.net/?41f89cb31cde4fb1#BoGAyVGL5stjYHBTUCEAoySVsSags5TabYE4awpwvk1Q
Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
morn'n baker requesting handoff
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3ce30c No.20450906
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1fb82f No.20450918
Morning anons…
>>20450903
ty bake!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450928
Zelensky…
https://www.facebook.com/MILANGROBAR357/posts/pfbid02UGtXSgP3djYjj3zSvSWFjmswNsotTJQr1a8vuhMYxzYtcThY1HKq2Kky1WPHcCgGl
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59d544 No.20450930
Pelosi Goes On Unhinged Rant About Trump Being 'Blackmailed' By Putin
Nancy Pelosi has once again floated the tired conspiracy theory that Donald Trump is controlled by Vladimir Putin, and that the Russian leader is blackmailing Trump with “something financial.”…..
The comments come in the wake of Pelosi’s conspiracy bosom buddy Hillary Clinton claiming that Trump is “enamoured with Putin,” and is going to use the Army to round up Americans if he gets back into office.
https://www.zerohedge.com/political/watch-pelosi-goes-unhinged-rant-about-trump-being-blackmailed-putin
Accuse someone of that which you are guilty or will be
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
020b6a No.20450931
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20450932
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7acf1 No.20450933
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450934
https://twitter.com/TheChiefNerd/status/1760077738772156704
Chief Nerd
@TheChiefNerd
🚨 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery
"This is the head guy on the border and I asked him,…'You just said we're spending tax dollars to sell children into s** slavery.' And he said, 'Yeah.'…That's how out of control we are down there."
@joerogan
@DrPhil
0:09 / 3:00
5:03 PM · Feb 20, 2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
020b6a No.20450935
>>20450847 (pb)
That occurred last November.
It was because the EPA over-stepped their boundaries as an agency; another case dealing with this (two, really) are before SCotUS now.
Agencies are to inform congress, not create rules.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7346f1 No.20450936
YouTube embed. Click thumbnail to play. FULL TRUMP TOWN HALL VIDEO.
The Ingraham Angle 2/20/24 HD| BREAKING FOX NEWS February 20,2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20450937
https://t.me/jacksonhinkle/1643
https://www.vice.com/en/article/88qk4b/what-the-hell-is-magacommunism
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450939
https://rumble.com/v4ep6ph-american-transhumanism-the-body-biosecurity-and-the-new-nbic-science-paradi.html
AMERICAN TRANSHUMANISM | The Body, BioSecurity & The New NBIC Science Paradigm (nano-bio-info-cogno)
nonvaxer420
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20450940
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20450941
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450942
https://twitter.com/CollinRugg/status/1760147508679033110
Collin Rugg
@CollinRugg
NEW: Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.
Utter insanity.
In 2021, the Indiana Department of Child Services investigated parents Mary and Jeremy Cox and later took their son after they refused to refer to him as a girl.
He was then placed in a home that affirmed his gender identity.
The parents have reportedly filed a petition to the Supreme Court asking for their case to be heard.
Here is their story:
4:40 PM · Feb 20, 2024
·
425.4K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
020b6a No.20450943
>>20450928
Pretty sure that is out of bounds here, depicting children that way.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20450944
Navalny’s early retirement from CIA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3759a No.20450945
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20450946
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450948
https://twitter.com/litecoin_bull/status/1760070517317574679
Łitecoin Bull | The News Before The News!
@litecoin_bull
This was posted by anon on 9/4/2019 . Read and buckle up.
Image
11:34 AM · Feb 20, 2024
·
465.8K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20450949
>>20449206 lb
>>20448929 pb
how did Laura "give herself away"?
She was obviously pushing the line of the "woman don't like revenge" BS
ekkkekk
Seem like the mainstream has been pushing massive fear regarding alleged "Trump Revenge"
>>20450903
tyb
what is "Banging" In my vocabulary it means to fuck, to plant a seed.
If it was employee in current hysterical atmosphere, it'd be "Rape"
Am I wrong?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450950
https://twitter.com/JackPosobiec/status/1760154561665229028
Jack Poso 🇺🇸
@JackPosobiec
Under the fog of war, Ukraine cancels its 2024 presidential elections
From dossier.today
5:08 PM · Feb 20, 2024
·
283.9K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20450951
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41c026 No.20450952
Pretty AI is going to start creating shit tons of amazing websites. It won't stop. It'll just keep creating new sites all the time. Humans won't make the internet anymore.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450954
https://twitter.com/robbystarbuck/status/1760126503881183705
Robby Starbuck
@robbystarbuck
Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students. Police believe there may be more victims. Spread the word so all parents and grandparents in the area are informed!
Quote
Square profile picture
Lakewood Police Dept.
@LakewoodPDCO
·
Feb 19
Creighton Middle School Staff Member Arrested for Sex Assault
2/20/24
LK24-005298
On February 15, 2024, Lakewood Police were made aware of multiple complaints by male students at Creighton Middle School that a school staff member inappropriately touched them during school…
Show more
Image
Image
3:17 PM · Feb 20, 2024
·
19.4K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450955
Retraction Watch
@RetractionWatch
Paper by
@stkirsch
and others claiming ‘extensive’ harms of COVID-19 vaccines to be retracted
retractionwatch.com
Paper claiming ‘extensive’ harms of COVID-19 vaccines to be retracted
A journal is retracting a paper on the purported harms of vaccines against COVID-19 written in part by authors who have had similar work retracted before. The article, “COVID-19 mRNA Vaccines: Less…
12:16 PM · Feb 19, 2024
https://twitter.com/RetractionWatch/status/1759643161775771819
https://www.cureus.com/articles/203052-covid-19-mrna-vaccines-lessons-learned-from-the-registrational-trials-and-global-vaccination-campaign#!/
COVID-19 mRNA Vaccines: Lessons Learned from the Registrational Trials and Global Vaccination Campaign
M. Nathaniel Mead • Stephanie Seneff • Russ Wolfinger • Jessica Rose • Kris Denhaerynck • Steve Kirsch • Peter A. McCullough
Abstract
Our understanding of COVID-19 vaccinations and their impact on health and mortality has evolved substantially since the first vaccine rollouts. Published reports from the original randomized phase 3 trials concluded that the COVID-19 mRNA vaccines could greatly reduce COVID-19 symptoms. In the interim, problems with the methods, execution, and reporting of these pivotal trials have emerged. Re-analysis of the Pfizer trial data identified statistically significant increases in serious adverse events (SAEs) in the vaccine group. Numerous SAEs were identified following the Emergency Use Authorization (EUA), including death, cancer, cardiac events, and various autoimmune, hematological, reproductive, and neurological disorders. Furthermore, these products never underwent adequate safety and toxicological testing in accordance with previously established scientific standards. Among the other major topics addressed in this narrative review are the published analyses of serious harms to humans, quality control issues and process-related impurities, mechanisms underlying adverse events (AEs), the immunologic basis for vaccine inefficacy, and concerning mortality trends based on the registrational trial data. The risk-benefit imbalance substantiated by the evidence to date contraindicates further booster injections and suggests that, at a minimum, the mRNA injections should be removed from the childhood immunization program until proper safety and toxicological studies are conducted. Federal agency approval of the COVID-19 mRNA vaccines on a blanket-coverage population-wide basis had no support from an honest assessment of all relevant registrational data and commensurate consideration of risks versus benefits. Given the extensive, well-documented SAEs and unacceptably high harm-to-reward ratio, we urge governments to endorse a global moratorium on the modified mRNA products until all relevant questions pertaining to causality, residual DNA, and aberrant protein production are answered.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450957
https://twitter.com/NQthing2see/status/1760117782429979094
nQthing to see here
@NQthing2see
LGBTQ ideology is being pushed so hard these days in order to bring us to the point of normalizing pedophelia.
You are still sleeping if you don’t realize this
Image
2:42 PM · Feb 20, 2024
·
4,264
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03619b No.20450958
>>20450949
i cannot speak for bakes….
but 'banging in' i believe means breaching a door.
be it with a foot, tools, or explosives.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450959
https://twitter.com/libsoftiktok/status/1760165144946941960
Libs of TikTok
@libsoftiktok
BREAKING: Democrats in Illinois (
@RepStava_Murray
) introduced HB 4876. The bill would classify parents as child abusers if they don’t get their kids “gender affirming care” aka puberty blockers and s*x change surgery.
They will use this to take kids away from their parents to transition them.
She can be reached here: office@repstavamurray.com
Last edited
10:50 PM · Feb 20, 2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450960
https://twitter.com/Oilfield_Rando/status/1760126674920677580
Oilfield Rando
@Oilfield_Rando
“They found sawdust.”
“What? Dude, they found a shitload of coke. And some….way worse stuff. But we knew we couldn’t report that, it’s gone.”
“No. You don’t understand. You want your pension? You. Found. Sawdust.”
Quote
Square profile picture
NBC News
@NBCNews
·
17h
Federal prosecutors mistakenly claimed in a court filing that a photo of sawdust they found while searching Hunter Biden's electronics was cocaine, attorneys for the president's son say. https://nbcnews.com/politics/justice-department/hunter-bidens-lawyers-say-prosecutors-confused-picture-sawdust-cocaine-rcna139656?cid=sm_npd_nn_tw_ma&taid=65d5479476567b0001052eb5&utm_campaign=trueanthem&utm_medium=social&utm_source=twitter
3:17 PM · Feb 20, 2024
·
34.1K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a5b76 No.20450961
>>20450959
thats a conehead in disguise.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20450962
>>20450941
"drug abuse"
It's when they are poisoned.
Happen to 9/11 researcher and son of Firefighter Dan Wallace.
Standard proceeding.
Check the child / young man out?
Does he look like a drug addict?
I call foul.
They lie about EVERYTHING
The young man looks totally straight.
"appears to have died"
Drug addict. Doubt.
Unless he was shot up against his will.
Message sent.
YouTube is up for murder.
repression of Medical Info
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450963
https://www.dailymail.co.uk/news/article-13104369/joe-biden-california-power-rangers-campaign-fundraiser.html
'Scranton Joe' flies to California to
tap Hollywood elite and top up his $130M
war chest: Biden heads to $250,000-a-head
fundraiser hosted by billionaire Israeli
producer, who launched Power Rangers,
on glitzy fundraising swing
Daily Mail (UK), by Rob Crilly
Posted By: Imright, 2/20/2024 8:30:34 PM
President Joe Biden will leave Washington for yet another visit to California's deep-pocketed political donors as he seeks to build a war chest capable of competing with Donald Trump's fundraising machine. He travels to the West Coast for the second time this month to swell campaign coffers already crammed with $130 million—the highest total ever amassed at this stage in the cycle. His first event is with a billionaire Israeli-American Hollywood mogul. Tickets reportedly cost up to $250,000, making it a tidy payday for Biden's reelection effort.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450964
https://twitter.com/kylenabecker/status/1760117808770224554
Kyle Becker
@kylenabecker
Major plot twist in the Biden corruption scandal.
FBI Informant on Biden Bribery Scheme Had ‘High-Level’ Contacts With Russian Intelligence, DOJ Claims
From thepoliticsbrief.com
2:42 PM · Feb 20, 2024
·
13.9K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20450965
>>20450941
YouTube is also "up for" Election interference and Collusion in Criminal Conspiracies of several kinds.
>>20450941
he may have been slipped a bad drug.
Drug addict? Any more than any other student at Cal?
no.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a5b76 No.20450966
>>20450963
isn't the power rangers guy Haim Saban in the photo off of epstein island when clinton i think is in the water with other people.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20450967
>>20450949
>woman don't like revenge
Women love revenge.
They are savage with their revenge.
Although some people might call it justice.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450969
https://t.me/ungathegreat/5807
STUDY: mRNA Vaccines Can Reach Placenta and Fetus
Recent research shows that mRNA from vaccines does transfer to the placenta, affecting the fetus’s immune system development.
The CDC doesn’t care. Their website reads:
“Evidence continues to grow showing that COVID-19 vaccination is safe and effective before and during pregnancy”
Furthermore, the CDC attributes any possible adverse effects to COVID-19 rather than the highly experimental injections.
https://x.com/UngaTheGreat/status/1759673173010776542
@UngaTheGreat
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3652d No.20450970
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4dc25 No.20450972
Damn. I thought Russia was some backwoods 3rd world military. Now they can shoot out our satellites? My gosh they advance fast in the last year.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450973
https://t.me/drefanzor/2831
NYPD Officers Clash with Migrants During Arrest at NYC Randall's Island Shelter
https://x.com/johnhackerla/status/1759999316658172248?s=46&t=1aSPjDEulmN2vHzK32nK1A
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7acf1 No.20450974
https://twitter.com/nypost/status/1760273001432437172
Family of Kansas City shooting suspect set up GoFundMe for him
Mass shooter who terrorized hundreds at a Superbowl parade is the victim and need Yo money
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20450975
>>20450959
She looks Jewish.
Is she Jewish?
IDK they all look White to me.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450976
"WARNING - Ohio town tells citizens STAY HOME, STOCK UP - Eclipse April 8, 2024"
https://fox8.com/news/significant-problem-expected-immediately-after-eclipse/
On August 21st, 2017 the first Great American Eclipse made headlines all over the nation.
It was also known as “the Seven Salem Eclipse” because the path of that eclipse crossed over seven U.S. locations named “Salem”…
-Salem, Oregon
-Salem, Idaho
-Salem, Wyoming
-Salem, Nebraska
-Salem, Missouri
-Salem, Kentucky
-Salem, South Carolina
Salem is short for “Jerusalem”, and that is why so many early Americans chose that name for their communities.
Now the second Great American Eclipse is almost here, and the path of that eclipse will cross over seven U.S. locations named “Ninevah”…
-Nineveh, Texas
-Nineveh, Missouri
-Nineveh, Indiana
-Nineveh, Ohio
-Nineveh, Pennsylvania
-Nineveh, Virginia
-Nineveh, New York
The eclipse will also cross over a location named “Ninevah” in the province of Nova Scotia in Canada.
"Genesis chapter 10 tells us that Ninevah was built by Nimrod, and I think that is very noteworthy.
In addition, Wikipedia tells us that the path of the Bur-Sagale eclipse crossed over Ninevah on June 15th, 763 BC…
The Assyrian eclipse, also known as the Bur-Sagale eclipse, is a solar eclipse recorded in Assyrian eponym lists that most likely dates to the tenth year of the reign of king Ashur-dan III. The eclipse is identified with the one that occurred on 15 June 763 BC in the proleptic Julian calendar.
Some believe that the Bur-Sagale eclipse happened at the same time that Jonah was in Ninevah warning the population that the city would be destroyed…
The Bur-Sagale eclipse occurred over the Assyrian capital city of Nineveh in the middle of the reign of Jeroboam II, who ruled Israel from 786 to 746 B.C. According to 2 Kings 14:25, the prophet Jonah lived and prophesied in Jeroboam’s reign. The biblical scholar Donald Wiseman has speculated that the eclipse took place around when Jonah arrived in Nineveh and urged the people to repent, otherwise the city would be destroyed. This would explain the dramatic repentance of the people of Nineveh as described in the Book of Jonah. Ancient cultures, including Assyria, viewed eclipses as omens of imminent destruction, and the empire was in chaos at this time, struggling with revolts, famines and two separate outbreaks of plague.
I can understand how the appearance of such an eclipse could have been seen as strong confirmation of Jonah’s message to the people of Ninevah."
"the very first community in the U.S. that the path of the eclipse will touch will be Eagle Pass, Texas."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450977
Disclose.tv
@disclosetv
NEW - British nuclear submarine missile launch fails as Trident misfires and "plops" into the sea just yards away — The Sun
4:37 PM · Feb 20, 2024
https://twitter.com/disclosetv/status/1760071126552842568
Disclose.tv
@disclosetv
MORE - UK Defence Secretary Grant Shapps was on board HMS Vanguard to witness "the test."
4:41 PM · Feb 20, 2024
https://twitter.com/disclosetv/status/1760072157567299618
Jerome Starkey
@jeromestarkey
🚨 SUN SCOOP - A Trident missile misfired & crashed into the ocean yards from the British nuclear submarine that launched it.
Defence Secretary Grant Shapps & First Sea Lord Admiral Sir Ben Key were both on board HMS Vanguard at the time
From thesun.co.uk
4:17 PM · Feb 20, 2024
https://twitter.com/jeromestarkey/status/1760066284732199212
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7acf1 No.20450978
So apparently Googles new AI called 'Gemini' won't depict white males
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ab35b No.20450979
What are they hiding?
Why are they trying so hard to push good peopl and business out of NYC?
Take ove property?
More tunnels to protect?
Thoughts?
DMP
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7acf1 No.20450980
I said that wrong it does create white males they just look weird or are dying
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20450981
https://t.me/jacksonhinkle/1633
Blinken mogged by Mr. President
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450982
University Hospital: Trans-Women's Breast 'Milk' Just As Good As Biological Women's
https://www.zerohedge.com/medical/university-hospital-trans-womens-breast-milk-just-good-biological-womens
A UK university hospital system has claimed that milk produced by trans-women “is as good for babies” as biological women’s breast milk.
The Telegraph reports a University of Sussex Hospitals NHS Trust’s (USHT) “letter to campaigners” noted that “after a combination of drugs,” trans-women’s milk is “comparable to that produced following the birth of a baby.”
Trans-women - biological men - must take the hormone progestin in order to develop milk-producing glands. Drugs such as domperidone (which can be prescribed for biological women who have difficulty breastfeeding) are then needed for lactation.
But even domperidone’s manufacturer warns the drug “was not intended for this” as it can cause heart issues in newborns. The drug’s patient leaflet warns domperidone “should be used during breastfeeding only if your physician considers this clearly necessary.”
Nevertheless, the USHT believes domperidone is safe for trans-women, but does note hospital staff should advise those using it on the possible implications.
Oddly, the USHT’s guidance for the drug no longer exists on its own website; in its place is a link to “La Leche League” which claims it “supports everyone who wants to breastfeed or chestfeed in reaching their goals.”
From the story:
The hospital trust, which runs Royal Sussex County Hospital, Worthing Hospital and Royal Alexandra Children’s Hospital among others, was also the first in Britain to use the term “chestfeeding” in place of breastfeeding because it is considered by some to be more inclusive. …
Lottie Moore, of the Policy Exchange, which uncovered the letter, said the trust “is unbalanced and naïve in its assertion that the secretions produced by a male on hormones can nourish an infant in the way a mother’s breast milk can”.
Maya Forstater, the director of campaign group Sex Matters, said: “For a chief executive and medical director of an NHS trust to prioritise trans identities over what is best for mothers and their babies is deeply disturbing.”
The USHT said it “stand[s] by the facts of the letter” and its supporting evidence.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b18021 No.20450984
>>20450983
sauce that you speak for God.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20450985
U.K. announces they are CHANGING the way excess deaths are calculated
‘Release date:
20 February 2024
1. Main changes
Trends in population size, ageing and mortality rates are accounted for by the new method for estimating the expected number of deaths used in the calculation of excess mortality (the difference between the actual and expected number of deaths); this is not the case for the current method, which uses a simple five-year average to estimate the number of expected deaths.
Individual weeks and months that were substantially affected by the immediate mortality impact of the coronavirus (COVID-19) pandemic are removed from the data when estimating expected deaths in subsequent periods, whereas the current approach involves removing data for the whole of 2020.
Use of a statistical model means that multiple demographic, trend, seasonal and calendar effects can be included simultaneously in the estimation of expected deaths, and confidence intervals can readily be obtained.
A "bottom-up" approach to aggregation means that estimates of excess deaths are additive across age groups, sexes, and high-level geographies, and between months and years.
Having a common methodology for all four UK countries means that estimates of excess deaths are consistent and comparable across all parts of the UK, and the new methodology is largely coherent (though not identical) to that used by the Office for Health Improvement and Disparities to estimate excess deaths in English local authorities.‘
https://www.ons.gov.uk/peoplepopulationandcommunity/healthandsocialcare/causesofdeath/articles/estimatingexcessdeathsintheukmethodologychanges/february2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7e0b9 No.20450986
>>20450963
Hollywood is dead
There is zero chances it will ever return
A.I. will be new form of entertainment
Let Dopeywood waste their money on an old pervert
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20450987
>>20450982
>not intended for this
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3759a No.20450988
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20450989
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20450991
>>20450959
https://www.wjbc.com/2021/05/11/state-rep-stava-murray-sponsoring-a-bill-to-make-child-care-a-legitimate-campaign-expense/
Someone should take her kids away from her, because she is a kook.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20450992
>>20450964
kkkekekek
Now who could've predicted that?!
No Kidding
Didn't Trump years ago meow, in the debate before the stolen election ask about a payment related to the Mayor of Moscow and Biden Family?
Whereas the corrupt Talking Head cut-off Trump and wouldn't let DJT speak about it, nor ask the question of PedoJoe?
That should be on tape?
views by millions?
Think of this.
Mike Wallace son Chris;
Are they liable (now that a new standard of lawfare has been set?) for espionage, RICO charges of criminal conspiracy?
Collusion with an enemy of the State?
Collusion with rogue Intel Agencies?
Isn't Chris Wallace up for election interference? Now that we have new lower standards of what constitutes a crime?
Success? Snake story is about those who infiltrated (were invited in) our beautiful Country and who stabbed us in the back.
Won't "success" be exposing the crooks and giving some consequences.
The people who are against it fail to realize the extent of the crimes and betrayals.
Chris Wallace is guilty of election interference, which is a felony.
They should all start to show some contrition MEOW.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20450993
sleight increases myocarditis, blood clots…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20450994
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b18021 No.20450995
>>20450986
EVerything said about AI here, as statements of 'fact' for the 'future' is a psyop campaign to make people except crappy media instead of stuff that is actually interesting.
AI is merely cabal copy, computer generated, and low-brow with very poor presentation, and no understanding of aesthetics to dumb down people and get them to think that a comic book world view is normal.
anyone who says 'AI will' without using an subjunctive is an agency shill here to manipulate people
all mention of AI will now be FILTERED.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c5c4dd No.20450996
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7e0b9 No.20450997
>>20450978
That would be the Jewish version of A.I.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20450998
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
020b6a No.20450999
>>20450950
We were told on Feb 13.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451000
>>20450959
>classify parents as child abusers if they don’t get their kids “gender affirming care”
https://en.wikipedia.org/wiki/Anne_Stava-Murray
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b18021 No.20451001
>>20450999
and yet the dicatato-ship in DC wants to give the dicatato-ship in Ukraine 60 Billion dollars?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
027456 No.20451003
>>20450998
there's those crazy eyes and big chompers again
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7346f1 No.20451004
Assange Trial Live:
Day 2.
Prosecution testimony.
Sound issues have made it nearly impossble for global journalists to follow what is being said, even from within the courtroom itself.
But Claire Dobbins, the attorney for the U.S. has thusly argued that:
The CIA plot to kill Assange doesnt matter to the extradition request.
That UK law does not forbid political extradition (UK treaty, vs. 2003 reformed extradition act).
That Assange is not a political prisoner because two administrations have pursued political charges (absurdist).
And is arguing currently, after being stopped by a judge; that if such information were leaked in the UK -and was "damaging" (although the US determind no one was directly harmed by the release); then it would be prosecutable.
In short, the U.S. legal argument is completely absurd. We are witnessing a clown show.
Note* The sound issues are ridiculous, and the court has refused to fix this. One of the largest trials in history, and the prosecution is speaking behind a veil of convenient incompetence.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b18021 No.20451005
>>20451002
filtered for blasphemous content.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3759a No.20451006
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ab35b No.20451007
>>20450990
That’s the obvious one.
Just like all that great property out in Cali. Devalue and scoop.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451008
>>20451007
"Controlled Demolition"
9.11 was "The Kickoff"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7346f1 No.20451009
Assange Trial Live.
Day 2 cont.
A key moment just took place, High court Justice Johnson asked U.S. attorney if there is any guarantee or precedent to establish equal protection for foreign nationals under U.S. law.
U.S. admits there is no such evidence.
-This is key to the notion that Assange cannot be safeguarded in U.S. custody or courts. And was a central theme in the defense argument yesterday.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7e0b9 No.20451010
>>20450972
“Soviet” Russia was a giant Jewish joke
Most Russians didn’t do anything for the communists.
Biggest reason Russia lost Afghanistan was Jew controlled military
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a4f93 No.20451011
YouTube embed. Click thumbnail to play. Elvis Presley winning bigly
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
020b6a No.20451012
>>20451001
You know what this is…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20451013
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2da63c No.20451014
>>20450978
https://twitter.com/EndWokeness/status/1760280543940263994
America's Founding Fathers, Vikings, and the Pope according to Google AI:
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e83bfc No.20451015
WHERE MR PIG?
Trudy Dyer Hamby of Gainesville, daughter & son-in-law, Susan & Wayne Roberts of Ruskin, Florida, daughters, Beth Hamby & Pat Coffman of Cleveland, Wanda Brown of Gainesville and Karen Patterson of Gainesville, son & daughter-in-law, Michael & Amy Reeves of Gainesville, sons, David Reeves of Gainesville and Cody Reeves Hamby
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20451016
>>20450995
AI is a scam.
no machine / software combo has passed actual Turing Test (rules were changed and fudged for sake of con and of stock prices)
And never will
Impossible in principle.
"Emperor's New Clothes" affect.
Money can't buy stand-alone truth.
It's as if they'd like to ordain the Sun not to come up in the Morning.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451017
Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
https://rib.msb.se/filer/pdf/30307.pdf
p1
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2da63c No.20451018
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451019
>>20451010
>Jewish Autonomous Oblast (Russia)
The Jewish Autonomous Oblast is the only Autonomous Oblast in Russia. It is situated in the Far Eastern Federal District of Russia.
Flag of the Jewish Autonomous Oblast
https://en.wikipedia.org/wiki/Flag_of_the_Jewish_Autonomous_Oblast
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451020
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2da63c No.20451021
Let's just go with superstition, that'll work
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7e0b9 No.20451022
>>20451014
Kek…..Jews invented a racist computer program
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451023
>>20451019
But Anon's the Shill…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4dc25 No.20451024
>>20450998
By far the most beautiful woman ever posted on this board.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451025
>>20451017
>Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
2 of 3
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451026
>>20451017
>>20451017
>Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
3 of 3
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451027
>>20450963
>'Scranton Joe' flies to California to tap Hollywood elite and top up his $130M war chest: Biden heads to $250,000-a-head
fundraiser
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2da63c No.20451028
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451029
YouTube embed. Click thumbnail to play. Busted Dirty Cop Under Color of Law
https://www.youtube.com/watch?v=rmu4t-Zbwms
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451030
>>20451024
i don't know what kind of drugs your on, but i
agree with you entirely.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20451031
>>20451009
THATS A GREAT ARGUMENT ESPECIALLY IN THE CONTEXT OF CURRENT EVENTS
Unfortunately the rules abroad are no better.
In fact, who put Biden in the White House?
Who's Media sends the 4AM talking points?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451032
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7e0b9 No.20451033
>>20450999
Screen cap!
US elections will not happen this year
Biden will be crowned King of the Jews in Jan 2025
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451034
https://t.me/WeTheMedia/97680
NEW SUBSTACK:
Is Adrenochrome a Drug? Yup
Scientists Already Proved it (And Used It)
https://juliansrum.substack.com/p/is-adrenochrome-a-drug-yup
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
141bb2 No.20451035
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
37bb9d No.20451036
>>20450942
Indiana DCS is trafficking children through foster homes. No sauce- very sorry. I know people that know people…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4eefbd No.20451037
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4dc25 No.20451039
>>20451030
Reishi tincture with a dab of Turkey Tail with coffee.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
253aca No.20451040
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f246c2 No.20451041
>>20450965
>Any more than any other student at Cal?
The ones that haven't died of a drug overdose?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451042
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7e0b9 No.20451043
>>20451028
Fake dental laminates
They are snaggletoothed lizards underneath
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a72ff No.20451044
>>20450978
Ask it to depict a dead white male.
Just curious.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451045
Pervert<Posess<Progress
Problem<Reaction<Solution
TheY only have one MO to control.
Ridiculous Bullshit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f246c2 No.20451046
>>20450965
>Drug addict?
I'm going to say dying of a drug overdose puts you into a category of drug addict PAST your average Cal student.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a285b0 No.20451047
@disclosetv 12m
NOW -Massive farmer protest paralyzes Madrid, Spain.
https://gab.com/disclosetv/posts/111969619148664490
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451048
>>20451031
>Who's Media sends the 4AM talking points?
Bitcoin Jesus
Anon's need to give Bitcoin Jesus some Legal arguments to protect Julian Assange.
"Held without Bond" = Slavery
"Innocent until proven guilty" + 13th Amendment
Section 1.
Neither slavery nor involuntary servitude, except as a punishment for crime whereof the party shall have been duly convicted, shall exist within the United States, or any place subject to their jurisdiction.
Section 2.
Congress shall have power to enforce this article by appropriate legislation.
https://constitutioncenter.org/the-constitution/amendments/amendment-xiii
No conviction, no jail.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451049
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4dc25 No.20451050
>>20451047
For anyone to believe these are farmers just shows how stupid all of humanity is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451051
>>20451021
>Switching arms for vaccines could help boost your immunity, study finds
study finds…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451052
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451053
https://t.me/jermwarfare/20154
The WHO now says it didn't impose anything on anybody, anywhere.
Like I said, history is being rewritten in front of us.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451054
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7e0b9 No.20451055
>>20451053
The WHO is a bunch of dumbasses
They thought handing out condoms in Africa would solve all the problems there
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451056
Angela Chao's first husband was also a billionaire. He died in 2009, just months after they wed…
Chao had previously been married to billionaire banker Bruce Wasserstein.
He died in 2009, just months after they wed, following a stint in the hospital for an irregular heartbeat.
"Mr. Wasserstein is survived by his wife, Angela Chao, an executive at her family’s shipping company and the sister of Elaine Chao, the former labor secretary, and seven children. He adopted the daughter of his sister, the Pulitzer Prize-winning playwright Wendy Wasserstein, who died in 2006. He was divorced three times."
https://www.nytimes.com/2009/10/15/business/15wasserstein.html
Most recent husband:
Jim Breyer
https://en.wikipedia.org/wiki/Jim_Breyer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
12f20d No.20451057
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451058
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451059
>>20451053
They didn't
It was the un-elected Big-Titted bitches at your County Health Department that are funded by mandatory childhood vaccines for public school attendance that made the Mandates.
It was the local police that brought guns in to back up those cunts.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7346f1 No.20451060
A note to U.S. citizens:
The U.S. has lost hundreds of millions of taxpayer dollars in military equipment this week alone as it continues a pattern of losing its footing in the middle east.
- 2 drones, each valued at 30 million plus, and 400 million dollars in surface to air missiles that did no measurable damage to any target.
The total cost of their current pattern of aggression has reached several billion in taxpayer funds this year, with no measurable success or even an idea of a success they want to achieve.
They are simply indiscriminately firing weapons, in order to make more weapons. So they can bill taxpayers for more weapons; and keep defense stocks growing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451061
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451062
https://downdetector.com/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451063
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451064
>>20450903
Bangin the opposing counsel
That's not conflict of interest
That's getting screwed ….legally….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451065
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451066
>>20451056
>Bruce Wasserstein.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451067
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451068
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451069
https://twitter.com/realMikeLindell/status/1759992973234745478
Mike Lindell
@realMikeLindell
"Could Ronna's Replacement Already Be Involved In Election Fraud?" To watch the entire interview, click here: https://frankspeech.com/Video/could-ronnas-replacement-already-be-involved-in-election-fraud
@EmeraldRobinson
6:26 AM · Feb 20, 2024
·
19.5K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451070
>>20451060
"We're gonna need to check the DEI stats and PT scores of the members of those units."
Perhaps assigning more black, lesbian, marathoners from Kenya will fix the accountability issues?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451071
https://t.me/PepeDeluxed/55879
Trucker Says Boycotting New York City Is Bigger Than Trump
Has more contempt with complaining truck drivers that won't stand up but still complain
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451072
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451073
>>20451061
I don't feel, I know, both online and IRL. Don't care though, not in the slightest. Clowns have developed at least two personas devoted to imitation before one decided to LARP as a peddler of fraudulent absolution.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451074
Canadian law could soon see Christians jailed for quoting the Bible
https://www.campaignlifecoalition.com/clc-blog/id/348/title/bill-c-367-threatens-christian-speech
Bill C-367 Threatens Christian Speech
Should Christians be arrested for quoting portions of the Bible in public? Should pastors be charged with a “hate crime” when they preach against certain sins? Should churches be closed if the government does not approve of their beliefs?
You might think these are ridiculous questions. After all, this is Canada – the “true north strong and free”! Our national motto is “a mari usque ad mare”, quoted from Psalm 72:8, which says that Christ shall have dominion “from sea to sea”. This is not communist China!
However, with the introduction of Bill C-367, all these questions are on the table. I call this bill the “Closet the Christians Bill”, because that is exactly what it intends to do – put Christians in the closet. Under threat of jail-time, it will silence believers who oppose the woke ideology that is overrunning our country.
This repressive, christophobic proposal from Bloc Québécois leader Yves-François Blanchet is currently before Parliament and may be voted on shortly. If the Trudeau Liberals support this bill, it will most certainly pass, striking a fatal blow against freedom of religion and freedom of expression in this Dominion.
Bloc Québécois leader Yves-François Blanchet
We need to speak up while we still can and call on our Members of Parliament to reject Bill C-367. You can do that right now via our Action Alert Email page.
Christians know the Bible is a powerful book. As someone once said, “When you open your Bible, God opens His mouth.” It is a book full of hope, wisdom, peace, and God’s message of salvation. However, the Bible is also a book of warning and correction for those who wander astray. It’s a book that tells us: “Say to them: ‘As I live,’ says the Lord God, ‘I have no pleasure in the death of the wicked, but that the wicked turn from his way and live. Turn, turn from your evil ways!’” (Ezekiel 33:11).
For some people in Canada, the Bible’s message is an affront to their lifestyle and pride. They don’t want to hear it, their consciences can’t tolerate it, and they will try to silence those who proclaim it.
For example, LGBT activists have gone after one courageous Christian named Bill Whatcott for many years, whom they accuse of “hate crimes” against homosexuals. When he handed out leaflets that warned about the medical and spiritual dangers of LGBT practices at the Toronto “pride parade” in 2016, those LGBT activists were furious. They clamoured for his arrest in 2018 under the government of Kathleen Wynne, who was then-premier of Ontario and an open lesbian.
p1
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451075
CEO of Moderna was also the CEO of the company that built the Wuhan lab?
The NIH co owns the Moderna Covid 19 patent?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451076
>>20451074
Mr. Whatcott went to trial two years later and was finally found not guilty in December of 2021. However, the government of Doug Ford has appealed his acquittal and is continuing to prosecute Mr. Whatcott for sharing what the Bible says about sexual sin.
A number of Canadian pastors have also faced “hate crime” charges for their public witness against sexual immorality and child sexualization. Pastor Derek Reimer and Pastor David Lynn are just two examples, both of whom were vindicated from the accusation of “hate”.
So far, “hate crime” charges against Christians have been very difficult to prove because of an important protection in our Canadian Criminal Code. There is a “religious exemption” in Section 319 that states: “No person shall be convicted of a [hate crime] offence… if, in good faith, the person expressed or attempted to establish by an argument an opinion on a religious subject or an opinion based on a belief in a religious text.”
In other words, if you are saying what the Bible says about sexuality, gender, marriage, family, or anything – no matter how unpopular, offensive, or “hateful” it might sound to someone else, you have the freedom to express yourself under Canadian law. Christians have the right to quote the Bible in Canada.
The Holy Bible
But if Bill C-367 passes, that protection will be removed from the Criminal Code. We will then expect to see a flurry of charges against pastors, churches, Christian organizations, and ordinary believers who dare to speak the truth in love in the public square. This will, in turn, create a chilling effect that will diminish everyone’s freedom of speech.
No longer will we be allowed to share God’s design for human sexuality and marriage in public. No longer will we be able to speak out in the name of God against drag shows for kids, child drag, or child sex change. All this could be misconstrued as “hate speech” against the LGBT community. Even our pro-life message could be spun as a “hate crime” against women.
Christians may possibly be charged for claiming that Jesus is “the way, the truth, and the life” (John 14:6), because it discriminates against other religions. In fact, to criticize the teachings and practices of other religions may be tantamount to a “hate crime”! Will pastors who refuse to comply be hauled off to prison from their pulpits?
The ostensible reason for Bill C-367 is the recent rise in antisemitic demonstrations in Canada. Some politicians would claim extremists are being allowed to call for the annihilation of the Jews because our Criminal Code protects religious speech, so religious speech must be silenced. But, really, this is just an excuse for an opportunistic attack on the religious freedom of Christians (and other faiths too).
But is the answer to antisemitic rhetoric in Canada the elimination of everyone’s religious freedom? Rather, if the government truly believes that someone is advocating or promoting the annihilation of Jews, should it not enforce existing laws which already make that illegal? It is already illegal to advocate genocide according to Section 318 of the Criminal Code! Clearly, this proposal is just a cynical attack on people of faith by the anti-religious Bloc Québécois leader.
In fact, if Bill C-367 were to pass, I can almost guarantee you that antisemitic demonstrations would still be permitted to continue as “political” protests, while the changes to the Criminal Code would be used to prosecute Christian pastors and laypeople for proclaiming Bible-based truths about sexual morality. In time, Jewish rabbis and Muslim imams would not be exempt, and they would also come under the hammer of the state.
No, Bill C-367 is a dangerous threat to every citizen’s freedom of expression and religion. It will only serve the nefarious agenda of pro-LGBT activists and christophobic politicians who want to impose their woke ideology on our country and silence all opposition.
Bill C-367 must be stopped, and we need your help to stop it! Take a moment to send an Action Alert Email to your Member of Parliament today and ask him or her to stand up for our right to share our Christian values and beliefs in the public square.
If we want to keep Canada free – both for ourselves and our children – we need to speak up now.
Urge your MP to reject Bill C-367 here: https://www.votervoice.net/CALIFE/Campaigns/112075/Respond
2 of 2
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
253aca No.20451077
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451078
YouTube embed. Click thumbnail to play. >>20451071
TRUCKER BOYCOTT Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE
https://www.youtube.com/watch?v=CTMzG5ushKI
Starve them fucking Jews out boys!!
Whoo Hoo!
Just like the Nazis back in the Day.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451079
https://twitter.com/MarioNawfal/status/1760211246903644618
Mario Nawfal
@MarioNawfal
🚨BILLIONAIRES' APOCALYPSE BUNKERS NOW HAVE FIRE MOATS AND DECONTAMINATION ROOMS
From Mark Zuckerberg's $100 million fortress in Hawaii to Peter Thiel's New Zealand hideaway, billionaires are sparing no expense on survival bunkers.
The ultra-rich are focusing on survival, pouring millions into bunkers now reportedly with fire moats, water cannons, MRI machines, and even a parking spot for a submarine.
What do they know that we don't?
Source: Vice
Quote
Mario Nawfal
@MarioNawfal
·
Jan 20
🚨CELEB BUNKER BOOM: MULTI-MILLION DOLLAR DOOMSDAY PLANS REVEALED
Mark Zuckerberg reportedly tops the list with a $270-million Hawaiian bunker haven, while Rick Ross is said to rival Elon Musk with his own subterranean sanctuary.
Taylor Swift allegedly joins the fray, her…
Show more
1:53 AM · Feb 21, 2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e46c96 No.20451080
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451081
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20451082
>>20450895
tyb
What do they mean when they write "bang"?
That always meant fuck? didn't it?
>>20450903
>>20449206 lb
>>20448929 pb
how did Laura "give herself away"?
She was obviously pushing the line of the "woman don't like revenge" BS
ekkkekk
>>20450967
Seem like the mainstream has been pushing massive fear regarding alleged "Trump Revenge"
>>20450953
FALSE
>>20450967
wow, as if woman don't themselves do revenge! Ur right.
But woman often have different strategies from a man? emotional blackmail, poison?
turn the child against (but men do that too; espeically in the age of alleged equality between men and woman!
Men are more likely to use a gun. Woman use a car?; i.e. Laura Bush.
>>20450958
need to see the details on the EnGore Ghoul
>>20451048
seems very simple. for people who can read.
Truth is short. Lies go on a long time (form of distraction - dig to the premises and cut the crap - that's why they control the speech and voting machines and filabuster.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451083
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451084
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
025619 No.20451085
Machu Picchu was built by giants using fallen angel technology in an attempt to survive the coming flood. The remote location, altitude and a building technique all designed to be barrier, still failed to stop the deluge from wiping them out. Incas tell that these buildings and walls were there before they arrived. (You can see Inca building techniques on top of the original wall).
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4eefbd No.20451086
Gitmo express on route to deliver some new guests
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451087
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451088
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451089
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451090
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451091
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451092
Spot the new "Parade Route"…
Danish farmers must cut production to achieve climate goal, says government advisor
Feb 21st, 07:26:46
COPENHAGEN (Reuters) - Denmark's farmers must reduce production by as much as one-fifth by 2030 if the country is to achieve its ambitious climate goals, a government-commissioned group said on Wednesday.
Denmark, a major pork and dairy exporter, could become the first country in the world to levy an emissions tax on farming, a move that has broad political backing in the country, after New Zealand last year pushed back such a tax to the end of 2025.
The agriculture sector has become a political battleground as the European Union strives to meet its net zero emissions target by 2050. Farmers across the bloc have been protesting for weeks, saying they are facing rising costs and taxes, red tape, and excessive environmental rules.
https://PiQSuite.com/reuters/danish-farmers-must-cut-production-to-achieve-climate-goal-says-government-advisor
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451093
"Accidental (fake) emergency broadcast bulletin about nuclear attack on CONUS lists 8 cities that get nuked. Is one yours?"
https://www.bitchute.com/video/QVwJKjG4Bvqv/
"Apparently was broadcasted to some people in the North East part of the United States.
10 hours ago at least. Must be some really slow missiles. Traveling at the speed of a fart.
What bullshit.
But they shot down 4 of them! There goes all the water and the toilet paper again. Stand by for videos on this channel of dumb asses fighting over hot pockets and pop tarts at grocery stores."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
399319 No.20451094
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451095
https://x.com/nbcnews/status/1760295901673693659
Lizard comms are the best comms.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451096
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451097
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451098
https://en.wikipedia.org/wiki/Jewish_Autonomous_Oblast
Judaism, despite being the associated religion of the oblast's titular ethnoreligious group, is practiced by just 1% of the population, which is only slightly higher than the national average and is close to that of communities in other federal subjects.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451099
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451100
>>20451075
CFO James Mock and Margaret Sanger.
Creepy shit indeed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2c7614 No.20451101
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451102
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451103
https://www.express.co.uk/news/world/1868460/argentina-milei-inflation-government-surplus
Argentina's hard-Right leader sees nation in first monthly surplus for a year
The South American country's new president has introduced sweeping measures to curb government spending and inflation - but time will tell if the strategy will pay off.
Javier Milei
The Argentine government last month saw its first monthly budget surplus in over a decade following the election of a new far-right leader - but at great cost.
President Javier Milei is continuing to push for substantial spending cuts, his Economy Ministry announced, as his first full month in office ends with an improved budget but many economic issues are still unchecked. Public sector finances ended January with $589million at the official exchange rate, the government said late Friday.
This includes payment of interest on the public debt. The Economy Ministry said in a statement to the Telam news agency it is “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
025619 No.20451104
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
027456 No.20451105
>>20450903
morn'n baker requesting handoff
got about 25 min till i gotta wurkfag
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451106
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451107
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451108
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451109
>>20451107
Perfect boomerang indeed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
468561 No.20451110
>>20451093
>https://www.bitchute.com/video/QVwJKjG4Bvqv/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451111
https://t.me/WesternJournal/31903
Dem Sen. Bob Menendez Showed Off Money-Filled Safe to Nude Lover 15 Years Before FBI Gold Bars Raid, According to Dossier
READ: http://w-j.co/s/02db4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7346f1 No.20451112
Egypt has officially joined a growing list of countries to abandon the U.S. dollar entirely. It enacted this yesterday, and will no longer accept the U.S. dollar as a trade currency whatsoever.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
025619 No.20451113
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451114
>>20451112
hmmmm… does not necessarily seem like a good thing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152d32 No.20451115
Biden Family Business Tied to $Trillions in Lithium Acquired by China through U.S. Afghanistan Withdrawal
ByJon Fleetwood September 11, 2021
The Biden family profits from the U.S. withdrawal from Afghanistan and China’s subsequent acquisition of Afghanistan’s lithium.
QUICK FACTS:
Hunter Biden owns 10% of Chinese state-owned private equity firm Bohai Harvest RST.
Bohai Harvest owns Contemporary Amprex Technology Co. Limited, the world’s largest lithium-ion battery maker.
Days before Biden’s Afghan withdrawal, Contemporary Amprex Technology announced it was soon to raise $9 billion to fund six projects aimed at boosting its production capacity of lithium-ion batteries.
Biden’s withdrawal from Afghanistan left the country’s $3 trillion in lithium reserves to Taliban-friendly China and its state-controlled equity firms like Hunter Biden’s Bohai, which owns the world’s largest lithium-ion battery maker.
Article continues with a detailed and useful timeline. Here is the relevant excerpt.
Biden’s administration disastrously withdrew U.S. troops from Afghanistan in mid-August 2021.
Only days after the U.S. military withdrew from Afghanistan, the Taliban took control of major cities and installed themselves in the presidential palace in Kabul.
The Biden admin. left billions of dollars worth of U.S. weaponry to be seized by the Taliban.
In early September 2021, the Taliban announced a partnership with China, namely that China will be their “main partner” in helping rebuild Afghanistan. The Taliban have an interest in China’s Belt and Road Initiative and see it as a revival of the ancient Silk Road, according to The Post Millennial.
Taliban announces partnership with Chinahttps://t.co/EXnsxbqJq4
— Dinesh D'Souza (@DineshDSouza) September 3, 2021
Biden’s withdrawal ultimately handed Afghanistan’s valued $3 trillion lithium reserves (here) to China.
https://americanfaith.com/biden-family-business-tied-to-trillions-in-lithium-acquired-by-china-through-u-s-afghanistan-withdrawal/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451116
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451117
>>20451014
>completely eliminate and erase whitey as well as like-minded dissidents from history
>all worker bees and foot soldiers will be a mixed mud race
>ruling class will run everything behind the scenes through their merger with sentient conscious vessels that are now immortal gods with not diseases or sickness for them only
>brave new world
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451118
>>20451107
The direct translation of Bloodclaat is Blood Cloth, meaning the sanitary napkin that females use during their menstrual cycle.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
025619 No.20451119
Antidote to Graphene Contamination/PollutionLB
According to a 2014 study by Hu, Mu, Kang, Zhou, et. al., and subsequent confirmations publisheded by this leading Chinese research team, “Humic Acid Acts as a Natural Antidote of Graphene by Regulating Nanomaterial Translocation and Metabolic Fluxes
https://medicalveritas.org/graphene-antidote-for-covid-vaccine-nano-bioelectronic-intoxication-for-prevention-and-recovery/
A cure for the chyna virus vax from a chinese guy…
Grift
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451120
https://twitter.com/LizLemeryJoy/status/1760126567802401001
Liz Joy
@LizLemeryJoy
🚨Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!
3:17 PM · Feb 20, 2024
·
5,718
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451121
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451122
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451123
>>20451090
TUCKER CARLSON can speak, and the COMMON MAN, in the rarefied air of the elites, because he has all the sanctimonious credibility from being raised IN the American Nobility of Opus DEI infiltrated "Catholicsish" Institutions of the Church, and it's Government appendages like the CIA and the NSA.
Tucker is "one of them" gently asking very gentile questions about the enslavement of the Common Man in what WAS originally established as a Nation Free from the Forced Religions,Tax Mandates, and Debtors Prisons found in every other MONARCHY in the world.
The Globalists all skip over the DoI, the US Constitution, and Bill of Rights as meaningless pieces of pape, relevant only before the Divine 9 in the SCOTUS and their Pretty Poodles.
Like the BO here.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06ed7 No.20451124
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451125
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451126
https://twitter.com/OldRowOfficial/status/1760087967937290690
Old Row
@OldRowOfficial
This is what they stole from you.
Quote
Historic Vids
@historyinmemes
·
23h
Air conditioned lawnmower, 1957
Image
12:44 PM · Feb 20, 2024
·
55.8K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451127
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451128
>>20451078
TRUCKER BOYCOTT Causes 30% Receiver Fee INCREASE For NYC Load Deliveries
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451129
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451130
>>20451107
Killed in Prison by Lethal Injection
US Prisons have vaccine mandates?
Julian gonna get "The Kill Shot"?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451131
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451132
https://www.businesswire.com/news/home/20230912456530/en/Echodyne-Receives-FCC-Authorization-for-High-Accuracy-EchoShield-Radar/
Echodyne Receives FCC Authorization for High-Accuracy EchoShield Radar
Demand for high-performance radar growing across all customer markets and applications
September 12, 2023 03:00 AM Eastern Daylight Time
SEATTLE(BUSINESS WIRE)Echodyne, the radar platform company, today announces it has received Federal Communications Commission (FCC) Authorization for its EchoShield radar. The FCC Authorization allows EchoShield to be used for non-experimental purposes and arrives as demand for its breakthrough radars grows across all markets and applications. Echodyne’s software-defined, multi-mission, commercial-off-the-shelf (COTS) radars are used for situational awareness by Defense, Government, and Critical Infrastructure customers, and as a navigational sensor by Advanced Air Mobility (AAM) and Uncrewed Aircraft Systems (UAS) markets.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451133
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451134
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451135
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20451136
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451137
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
128f19 No.20451138
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
842871 No.20451139
Tora3 embed. Click thumbnail to play. >>20451082
>Truth is short. Lies go on a long time (form of distraction - dig to the premises and cut the crap - that's why the controlers censor the speech and rig the voting machines and use the filabuster to avoid facing the music)
Turn the child against (but men do that too; espeically in the age of alleged equality between men and woman!)
Probably both genders do that; for a long time.
In the 19th c. and early 20th it would be men mostly, since men controlled woman back them. It was a custom.
So more likely man would take the child, if he could and wanted to; and turn it against mother.
This happened in the case of Klaus Schwab. His Dad was a NAZI and took Klaus, Klaus' mother sent into exile and never mentioned (she was Jewish , so NAZI had to hide her)
>>20449206 lb
>>20448929 pb
how did Laura "give herself away"?
She was obviously pushing the line of the "woman don't like revenge" BS
Women might be more conflict averse; plot secretly, appear innocent, and are afraid of Trump's image, as presented by the Mass Media.
Used to be woman liked to appear innocent; Now they are supposed to look badASS?
True?
"Who you are" is by large extent; created.
So the communist attempt to create a generations where there is no gender.
alleged equality, but no specializtion.
It's a commie totalitarian "One World Order" goal
A. W. Watts explains how the image of self is often largely self-created rather then intrinsic?
(in the 60's naturally)
lecture linked
Self-identity is somewhat fungible;
https://tora3.com/video/450db53f2f0500834040a0e2d8e331eb
woman who had bad experiences with their fathers, would be most affected by the straw man projected by the Trump-haters.
Past trauma could be triggered?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451140
>>20450949
You can tell by the way that judge Engoron acts he has a criminal mind. Just like those clowns down in Georgia. That is the jist of the current problem, criminal minds have crept into the wheelhouses of power and are steaming the ship of state towards the rocks.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451141
https://www.techrxiv.org/doi/full/10.36227/techrxiv.22704643.v1
Radar-based Human Activity Recognition: Is it Ready for Aging in Place?
bioengineeringcomputing and processingsignal processing and analysis
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c1e4e9 No.20451142
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451143
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451144
>>20451126
Rolling terrarium vs A/C? Mower would need its own nuke to power that gradient.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451145
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451146
https://www.embs.org/jtehm/articles/passive-radar-opportunistic-monitoring-e-health-applications/
Passive Radar for Opportunistic Monitoring in e-Health Applications
This paper proposes a passive Doppler radar as a non-contact sensing method to capture human body movements, recognize respiration, and physical activities in e-Health applications. The system uses existing in-home wireless signal as the source to interpret human activity. This paper shows that passive radar is a novel solution for multiple healthcare applications which complements traditional smart home sensor systems. An innovative two-stage signal processing framework is outlined to enable the multi-purpose monitoring function. The first stage is to obtain premier Doppler information by using the high speed passive radar signal processing. The second stage is the functional signal processing including micro Doppler extraction for breathing detection and support vector machine classifier for physical activity recognition. The experimental results show that the proposed system provides adequate performance for both purposes, and prove that non-contact passive Doppler radar is a complementary technology to meet the challenges of future healthcare applications.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451147
>>20451098
The JAO was designated by a Soviet official decree in 1928, and officially established in 1934. At its height, in the late 1940s, the Jewish population in the region peaked around 46,000–50,000, approximately 25% of its population.[14] By 1959, its Jewish population had fallen by half.
Article 65 of the Constitution of Russia provides that the JAO is Russia's only autonomous oblast. It is one of two officially Jewish jurisdictions in the world, the other being Israel.
The Soviet government entertained the idea of resettling all Jews in the USSR in a designated territory where they would be able to pursue a lifestyle that was "socialist in content and national in form". The Russians also wanted to offer an alternative to Zionism, the establishment of the Mandate of Palestine as a Jewish homeland
After the war ended in 1945, there was renewed interest in the idea of Birobidzhan as a potential home for Jewish refugees. The Jewish population in the region peaked at around 46,000–50,000 Jews in 1948, around 25% of the entire population of the JAO.[14]
. In 1991, after the breakup of the Soviet Union, the Jewish Autonomous Oblast became the federal subject of Russia and thus was no longer subordinated to Khabarovsk Krai. However, by that time, most of the Jews had emigrated from the Soviet Union
https://en.wikipedia.org/wiki/Jewish_Autonomous_Oblast
The ones that left went to Israel. They can go back too,
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451148
https://www.nbcnews.com/politics/justice-department/ex-fbi-agent-feds-say-urged-jan-6-rioters-kill-police-worked-terrorism-rcna82775
Ex-FBI agent who feds say urged Jan. 6 rioters to kill police worked terrorism task force
Jared Wise was part of the FBI's Joint Terrorism Task Force and was supervisory special agent in charge of the Homegrown Violent Extremism unit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451149
>>20450998
I thought it was a fucked up AI version of AOC
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451150
YouTube embed. Click thumbnail to play. 9:00 AM EST
China in the Global South: Development and Influence in a Shifting Global Order - Day 1
Atlantic Council
https://www.atlanticcouncil.org/event/china-in-the-global-south/
https://www.youtube.com/watch?v=i7wfhnoP2jw
-
TBD
Discussion on China's Influence Across Global South
Panelists from the U.S. government, academia, and private sector discuss China’s influence across the Global South at the Atlantic Council in Washington, DC.
https://www.c-span.org/video/?533705-1/discussion-chinas-influence-global-south
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451151
I'm sure the namefagging HRN thinks he's taking something. His coworker burnt out from 8 months of that routine and now runs a fraudulent absolution script, so I'm sure the new namefagger is going to have an even worse time. They're just pixels.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451153
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451154
https://t.me/CIG_telegram/43465
An Israeli citizen threw the Polish flag in the mud at the Hrebenne crossing with Ukraine during a farmers' demonstration
Those who witnessed the action held the Israeli accountable forcing to lift the flag and put it back.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
027456 No.20451155
>>20450903
>>20451105
baker has toghost
notes are guud up to this post
notables bun @215
czech em and have a good day
#25088 >>20450903
>>20450934 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery
>>20450942, >>20450959 Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.
>>20450950 Under the fog of war, Ukraine cancels its 2024 presidential elections
>>20450954 Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students…
>>20451017, >>20451025, >>20451026 Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
>>20451047 Massive farmer protest paralyzes Madrid, Spain.
>>20451071, >>20451078 Trucker Says Boycotting New York City Is Bigger Than Trump - Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE
>>20451103 Argentina under Milei: The Economy Ministry said: “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”
>>20451120 Liz Joy w/CAP: Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
35886d No.20451156
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
092417 No.20451157
>>20451107
oops muh narrative
>>20451121
kEK
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451158
Well, that certainly busts a trend…
Switzerland to ban Hamas after Israel attacks
Feb 21st, 07:47:31
ZURICH (Reuters) - Switzerland's government said on Wednesday it wants to ban Hamas after the Palestinian militant group's attacks in Israel last year which killed nearly 1,200 people and sparked a war in Gaza.
Bern said it was taking action after the attacks on October 7 which killed two Swiss nationals and resulted in nearly 250 people being taken hostage.
In response, Israel launched a military assault on Gaza that local health authorities say has killed nearly 29,000 Palestinians with thousands more feared lost amid the ruins.
The Swiss government said under the new legislation Hamas and "cover or successor organisations" as well as organisations or groups that act on its behalf or in its name will be banned.
https://PiQSuite.com/reuters/switzerland-to-ban-hamas-after-israel-attacks
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451159
THANK YOU ANON
knew one of you would get it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451160
The Israeli civil administration in the territories constructed the hospital complex's Building Number 2, which has a large cement basement that housed the hospital's laundry and various administrative services.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451161
>>20450998
Is that an aoc clone? They all get chipped n cloned.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06ed7 No.20451162
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451163
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451164
>>20451144
exhaust indicates good ol' fashioned horsepower
before the government stepped in with all the tree hugging hippie regulations and mommas crying because cars were just too powerful
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
318a91 No.20451165
YouTube embed. Click thumbnail to play. Panama Canal suffering major disruption | BBC News
https://youtu.be/UnW7v3L_2s4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451166
>>20451120
Remember when we didn't have to know about every bill because we had elected representatives who did that for us? What happened to the congresses? Why are they working against us?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451167
21 Feb, 2024 12:53
Lavrov comments on Russian favorite in race for White House
Neither contender is willing to course-correct bilateral relations, the top diplomat said
Russia is interested in policies, not personalities, and has no expectation that the US intends to change its antagonistic stance, regardless of who wins the November presidential election, Russian Foreign Minister Sergey Lavrov told Brazilian media on Tuesday.
The top diplomat was asked whether Moscow preferred a return of Donald Trump to the White House next year over President Joe Biden staying in office. The interviewer from the Globo media group cited opinions that a new Trump presidency would make it easier to wrap up the Ukraine conflict.
“The ruling elites in the US consider Russia an enemy and a threat regardless of their political affiliation,” Lavrov said.
While Biden “did nothing” in four years to improve relations with Russia, “we do not delude ourselves into expecting the anti-Russian course of the US to change anytime soon,” the minister added.
Claims and counterclaims over which presidential candidate is a “favorite” of Moscow have been an element of US electoral cycles for decades. The ongoing race, in which Biden and Trump are presumed to be nominated by their respective parties, is no different.
While Russian officials traditionally say they will work with whoever American voters choose, Putin somewhat deviated from this position in an interview last week. He said Biden is his preferred candidate, because he is old-school, experienced and predictable.
Allegations that President Trump was backed by Russia and beholden to it, which stemmed from the Democratic Party’s explanation of why Hillary Clinton lost to him in 2016, undermined his administration. Contrary to what his critics claimed, some of the Republican’s actions at the helm were escalatory, such as his decision in 2017 to supply weapons to Ukraine.
Last week, journalists Michael Shellenberger, Matt Taibbi and Alex Gutentag published the first part of their investigation into the ‘Russiagate’ saga. They claim that US intelligence services engaged foreign partners to spy on the Trump campaign and manipulated evidence to create an impression that it had “colluded” with Moscow.
(Interesting pic RT pic, Bidan is tiny compared to Trump and is looking at his watchIs that when they released covid?)
https://www.rt.com/russia/592842-lavrov-preferred-candidate-us/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451168
>>20451164
Kek. Guid luck climbin' dat hill!
But ya gotta luv the dreams!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451169
>>20451147
But flags really are meaningless…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5338 No.20451170
https://www.breitbart.com/2nd-amendment/2024/02/20/remington-ceo-cites-legislative-environment-new-york-company-moves-georgia/
Remington CEO Cites ‘Legislative Environment’
in New York as Company Moves to Georgia
Breitbart 2nd Amendment, by AWR Hawkins
Posted By: Imright, 2/21/2024 8:13:48 AM
Remington is leaving New York, and CEO Ken D’Arcy noted that the direction legislation took in the Empire State was a cause for concern. The Associated Press (AP) noted that D’Arcy used a news release to indicate that New York’s “legislative environment” is concerning to the firearm industry as a whole.The pending closure of Remington’s Ilion, New York, plant — launched in 1828 — marks the end of generations of New Yorkers working for the American gun maker.Jim Conover began working at the Ilion plant in 1964 and continued to work for Remington for four decades. He commented on the pending closure,
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06ed7 No.20451171
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451172
Why did the US military let Satanists take over our country?
Why is it taking so long to fix this obvious and tragic failure?
Who is in control? Of what?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20451173
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451174
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451176
>>20451164
The Club of Rome. The Limits to Growth. 1972
Global takeover.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451177
Italy arrests 12 people over speed boat migrant trips from Tunisia
Feb 21st, 07:58:01
ROME (Reuters) - Italian police said on Wednesday they had arrested 12 suspected human traffickers for allegedly organising high-speed transfers for at least 73 illegal migrants from Tunisia to Europe.
Expert pilots operated the speed boats crossing from Tunisia to Marsala in Sicily between June and September last year, police said in a statement, describing them as "VIP trips".
The traffickers transferred relatively small groups of up to 20 people on each of four trips, charging fees of up to 6,000 euros ($6,500) per person, the statement said.
The trip, on a crowded and less seaworthy vessel, would normally cost under 1,000 euros per migrant, an official with knowledge of the matter said.
Italy and other European governments have taken an increasingly hard line on immigration in recent years amid a surge of arrivals of asylum seekers and undocumented migrants. EU data shows fewer than 100,000 irregular migrants made to it Europe in 2020, but that rose to 250,000 last year.
Six Tunisians and six Italians were detained as part of an investigation coordinated by European police body Europol and the Italian anti-mafia police unit.
The investigators identified a Tunisian former police officer as the head of the trafficking organisation.
https://PiQSuite.com/reuters/italy-arrests-12-people-over-speed-boat-migrant-trips-from-tunisia
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed6577 No.20451178
Rumble embed. Click thumbnail to play. Ahoy! The Ship Show & Extra Gravy - 02/21/2024
https://rumble.com/v4etag0-ahoy-the-ship-show-and-extra-gravy-02212024.html
https://rumble.com/embed/v4c80mc/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451179
>>20451146
Was around 81
We got an cable TV box
And took it to the electronics lab at work
And found ..equipment that was sending signals back …shielded circuitry…seperate power supplies…and that was 40 yrs ago
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451180
The people deserve better.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06ed7 No.20451182
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451183
>>20451098
Also, what's the Demographic representation of Jews and Catholics in the US population?
And what is in on the SCOTUS?
Has the SCOTUS been Opus DEI weighted?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1954ed No.20451184
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451185
>>20451180
Yea
But still allow Bullshit to be thrown at them daily
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451186
New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels
Babylon Bee
Article Image
NEW YORK, NY — During a recent press conference, Mayor Eric Adams announced that he will no longer tolerate migrant attacks against NYPD officers, warning that further incidents would result in a downgrade in migrant living accommodations from luxurious 5-star hotels to humble 4-star establishments.
"We're sending a strong, clear message that we mean business," said Mayor Eric Adams sternly. "If you mess with New York's finest, you're going to have to have a slightly less luxurious stay."
"You can kiss those swan-shaped folded bath towels and mints on your pillow goodbye! That's how seriously we take protecting our boys in blue," added Mayor Adams. "No more Mr. Nice-Mayor! Gone are the days of hospitalizing local law enforcement by day and sleeping on 10,000 thread count Egyptian sheets by night!"
According to sources, many New Yorkers have heavily criticized the mayor's new proposal, calling it "a full-blown humanitarian crisis" and a "racist affront to migrant dignity".
"What's next? Taking away their brand new iPhones just because they torched a couple of cop cars?" said one disgruntled citizen. "These migrants just want to feed their families and assault cops without repercussion! What has happened to this once great city?"
At publishing time, Mayor Eric Adams was left with no choice but to threaten to take away the PS5s from any migrant who assaulted a cop.
https://babylonbee.com/news/new-york-mayor-warns-migrants-if-they-keep-attacking-nypd-officers-theyll-be-downgraded-to-living-in-4-star-hotels#google_vignette
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451187
>>20451154
>An Israeli citizen threw the Polish flag in the mud at the Hrebenne crossing with Ukraine during a farmers' demonstration. Those who witnessed the action held the Israeli accountable forcing to lift the flag and put it back.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451188
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451189
>>20451184
80s would be time warner
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
141bb2 No.20451190
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c95042 No.20451191
https://www.thegatewaypundit.com/2024/02/bipartisan-group-us-senators-flies-hungary-bully-orban/
Bipartisan Group of US Senators flies to Hungary to bully Orban into approving NATO expansion and guess what? Hungarian politicians refuse to meet with them
Quotes: "Why does NATO even bother pretending that their decisions are “unanimous” when what the U.S. says, goes? If any leader of a NATO-member country dared to even think about voting against U.S. war-making policy, they get slapped with economic sanctions, compliments of a weaponized U.S. dollar."
"And we wonder why the BRICS coalition is growing. Nations are fed up with being bullied by Washington. It really is that simple."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
253aca No.20451192
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1954ed No.20451193
what were those free digital boxes for after 911
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451194
>>20451179
User "ping" data. Ask Nielsen Ratings.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451195
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451196
>>20451191
>the BRICS coalition is growing
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d06ed7 No.20451197
>>20451189
Dont let me down sweet mama
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451198
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1954ed No.20451200
selectv was 78-89 in wisconsin
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451201
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451202
Bitchute embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a631c No.20451203
Nobody likes Nikki. She's a Linda
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451204
CLOWNWORLD
Google’s Gemini AI Blasted For Eliminating White People From Image Searches
Paul Joseph Watson
21st February 2024
One comment
Vikings were black, apparently.
https://modernity.news/2024/02/21/googles-gemini-ai-blasted-for-eliminating-white-people-from-image-searches/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c95042 No.20451205
>>20451179
Old VHS player would play movie on the t.v. without being connected. Found out by accident as one day some of us were watching a movie and it was noticed the cables/cords had not been connected.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451206
>>20451193
refresh my memory…?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451208
https://www.greeleytribune.com/2024/02/18/child-homicide-pueblo-concrete-trunk-suitcase-corena-minjarez/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451209
YouTube embed. Click thumbnail to play. >>20451168
the vast majority of consumers have cookie cutter homes with nothing but flat area anyway so that'd essentially be a non-issue
plus design changes and engineering could make it possible
people now think they need a $9,000 commercial mower to mow a 1/4 acre with a half foot ditch in the front
>>20451176
think they were the ones behind that computer prediction from 1973 of the end of civilization in 2040-2050 too
vid related
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9f2a83 No.20451210
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451211
>>20451187>>20451191
Senate Democrates with a RINO neocon named Thom Tillis.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1954ed No.20451212
>>20451206
the gov was handing out free boxes that turned analog tv's to digital…it was a push
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f62dd0 No.20451213
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451214
https://www.middleeasteye.net/news/icj-hearing-israel-occupation-palestine-advisory-opinion
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2c96fd No.20451215
>>20451202
POTUS'S greatest speech yet!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20451216
I think I might go for a shave.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4e74eb No.20451217
>>20451085
>Machu Picchu was built by giants using fallen angel technology in an attempt to survive the coming flood.
Anon suspects the Cahokia mounds in Illinois were made for a similar purpose. The Indians living there when De Soto got to North America probably had nothing to do with their construction.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451218
>>20451204
https://x.com/Steve_Sailer/status/1760273943020359945?s=20
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451219
>>20451204
>Eliminating White People
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451220
>>20451186
> The Babylon Bee
>New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451221
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451222
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451223
>>20451204
AI is retarded.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451224
>>20451212
sounds… familiar. thanks.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451225
Well
It has become apparent
That the peeps that thought
I fell and bonked muh head
Are now understanding
Why I rebuilt an 1982 truck
And dropped a 70s engine in a mid 90s ford
Damn they starting to catch up
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451226
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451228
Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
https://www.thegatewaypundit.com/2024/02/judge-engoron-accused-banging-secretary-opposing-counsel-previous/
A Judicial Affair
By Stewart Ain July 26, 2002 12:00 am
"Lewin said in court papers that the law secretary, Arthur Engoron, claims he only began dating the secretary of the opposing counsel, Christopher Sullivan, on May 10. But Lewin said Sullivan’s actions in the case may have been "influenced" by information he received from the woman, identified in the papers only as Sue. And Lewin noted that Engoron "was drafting [later] decisions and communicating" with the judge about this case during the time he was dating Sue."
https://www.jta.org/2002/07/26/ny/a-judicial-affair
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451229
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451230
YouTube embed. Click thumbnail to play. ABC World News Tonight with David Muir Full Broadcast - Feb. 20, 2024
Boeing Wing damaged, people had to notify the pilots. Does anyone inspect these planes before take off?
https://youtu.be/sPDWunAdBZY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ec13 No.20451231
>>20451165
>Panama Canal suffering major disruption
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451232
>>20451228
Ooops, dat may be a repeat. I are a retard.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451234
>>20451219
What is the definitions of white people
Gotta be 3 or 4
And what shade of white are these peeps
There are more than 50 shades of white
Dum de dum dum
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451235
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451236
Dats actually guid news….
James Mayger
@JDMayger
The PBOC released data today showing the amount of Chinese shares owned by overseas investors fell in 2023 for a second straight year
https://www.bloomberg.com/news/articles/2024-02-21/foreign-investors-flee-chinese-shares-long-delayed-data-shows
https://twitter.com/JDMayger/status/1760294597866242469
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9f2a83 No.20451237
>>20451221
no, I rock and I ran
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451238
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451239
Ba'al is pronounced "Bail"
They Worshipped "Bail"
Because it's Bail or Slavery.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
35886d No.20451240
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
089c73 No.20451241
>>20451184
Hacking TV ever since….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4e74eb No.20451242
>>20451230
>Does anyone inspect these planes before take off?
it's standard operating procedure for either the pilot or co-pilot to walk around the plane and look for obvious structural problems… but they absolutely do miss stuff.
especially tough task for night flights, where they have to inspect with flashlights.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451244
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451245
>>20451126
i like the part where people from 1957 aren't fat.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c95042 No.20451246
>>20451234
Elizabeth Warren got a job at some "elite" university based, I guess on being a POC. If Elizabeth Warren is a POC then anyone can be.
When the wicked speak of Black and White they are not talking of skin tone. They are disguising their evil by calling it "blackness". This is how Bill Clinton could be the first Black President.
Notice that the slogan "Black Lives Matter" doesn't really mention shade of skin. It refers to lives not skin color.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451247
April Color
@ColorApril
Busted 🎯💥 Disgraced Fmr. Mayor deBlasio no one
deserves it more ! 👏👏👏🥰
https://twitter.com/ColorApril/status/1760166968848486750
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
020b6a No.20451248
>>20451061
Before here, had noticed PDJT mis-spelling things. Posted that meme to him.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451249
>>20451245
Kinda want one just to hotbox the thing while mowing the lawn.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451250
>>20451218
Holeeeeeeeeee shit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451252
>>20451235
And then it gets so bad that New York elects a Rudy Guilliani and he cleans the place up and makes it safer and than the city, like the proverbial dog, returns to its vomit and goes back to Dem leadership and here we are again.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451253
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451254
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451255
>>20451247
want this burger? get jabbed!
… and please, mask up!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451256
>>20451218
Yeah, their AI is trained to be woke.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451257
>>20451126
A lil fresh air is ok tho..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c33627 No.20451258
What’s the point of sourcing citation sauce?
All of media seems devolved into sewage.
GWP headlines are become Foxesque hyperbolic vomit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a9f3d8 No.20451259
>>20451069
RNC Chair Candidate Michael Whatley Refused to Investigate Fraud in NC
President Trump says that he supports Michael Whatley to be the next RNC Chairman. His tenure atop the NC GOP has been disastrous.
https://nationalfile.com/rnc-chair-candidate-michael-whatley-refused-to-investigate-fraud-in-nc/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4dc25 No.20451261
>>20451230
I inspect the plane as much as I can from the terminal windows and through the windows inside plane.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451262
>>20451246
Elizabeth Warren ..huh
How in the absolute fuck did we get there
From the definition of white peeps?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451263
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451264
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451266
>>20451256
This is horrific. Children don’t know the diff. Omg.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8a109 No.20451269
NASA Astronomy Picture of the Day
Feb 21, 2024
Seagull Nebula over Pinnacles' Peak
The bird is bigger than the peak. Nicknamed for its avian shape, the Seagull Nebula is an emission nebula on the night sky that is vast, spanning an angle over five times the diameter of the full moon and over 200 light years. The head of the nebula is catalogued as IC 2177, and the star cluster under its right wing is catalogued as NGC 2343. Consisting of mostly red-glowing hydrogen gas, the Seagull Nebula incorporates some dust lanes and is forming stars. The peak over which this Seagull seems to soar occurs at Pinnacles National Park in California, USA. The featured image is a composite of long exposure images of the background sky and short exposure images of the foreground, all taken consecutively with the same camera and from the same location.
https://apod.nasa.gov/apod/astropix.html?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451270
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451272
YouTube embed. Click thumbnail to play. 10:00 AM EST
NPC Headliners: Secretary of Energy Jennifer M. Granholm
National Press Club (NPC)
https://www.press.org/events/npc-headliners-secretary-energy-jennifer-m-granholm
https://www.youtube.com/watch?v=CPduxPB4AsY
-
Energy Secretary Discusses Clean Energy Investment
Energy Secretary Jennifer Granholm discusses the Biden administration’s clean energy policy and infrastructure investment during an event hosted by the National Press Club in Washington, DC.
https://www.c-span.org/video/?533706-1/energy-secretary-discusses-clean-energy-investment
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451273
>>20451258
confirmation bias and who the messenger is has taken precedent over the message itself in the current year
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451274
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451275
>>20451249
My previous poast said there’s nothing wrong with a lil fresh air, but I like how you think.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
182f58 No.20451278
>>20451266
You can fully understand what 'they' do and why they do it, if you understand that everything they do is targeted against children.
They're trying to breed new 'socialized man'.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451279
>>20451266
And obviously
There are no parents to teach the huddled morans
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
089c73 No.20451280
>>20451241
SLE44 Emulation - Bootloader
to card EEPROM & unloopers & everything in between. The good old days
KEK
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451281
>>20450928
lolwut They're not even trying to hide it anymore.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a77130 No.20451282
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451283
>>20451278
5:5
That’s what I meant by horrific n omg.
Those super computers they have need to be melted.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451284
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41cc09 No.20451285
Start questioning Trump and the security stops. I see how it is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
35886d No.20451286
Michigan wanted homeschool registry for warrantless home entry
February 2024: Michigan State Board Of Education On Homeschool Registry Preparing To Conduct Warrantless Entry To People’s Homes Enrolled In Homeschool
Board Speaking On Michigan Attorney General Dana Nessel: “She basically said, we want this list so that we can have unwarranted home entry, without a warrant. Warrantless home entry into homeschool”
“But whole homeschooling thing is really quite disturbing. And one of the things that disturbs me about this is the disingenuousness of the discussion because we have people like the Senate Education Committee chair, Dayna Polehanki saying that when asked about increasing regulations beyond registration, she said not on my watch.
Well, we got Attorney General Dana Nessel that says that she wants to do it because the foster care system didn't do their job and apparently homeschool parents. Uh, there was some abuse going on at a homeschool home, um, or that actually sounds like the foster care system.
But, certainly, a mere registration, a list of people is not gonna have anything to do or will not help prevent, um, what attorney general Nestle is talking about. So she's already kinda said the quiet part out loud.
She basically said, we want this list so that we can have unwarranted home entry, uh, without a warrant. Warrantless home entry into homeschool into this particular targeted group.”
https://twitter.com/WallStreetApes/status/1760101385549631935
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451287
>>20451283
AND these people need the rope STAT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451288
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451289
>>20451278
As long as their God is made of paper
And they have to have just one more ….
Oooohhhh. Shiny….
New And improved…usually isn't ..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e251ca No.20451290
God bless you and keep you from harm, this day and forever.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d3260 No.20451291
>>20451269
>2343
>Meme's Ready?
>Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41cc09 No.20451292
>>20451290
You as well Swordy.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451293
10:00 AM EST
Supreme Court October Term 2023 Argument Day
Supreme Court
^
Ohio v. EPA (23A349)
Kinder Morgan, Inc. v. EPA (223A350)
American Forest & Paper Assn. v. EPA (23A351)
U.S. Steel Corp. v. EPA (23A384)
Consolidated
^
Warner Chappell Music, Inc.v. Nealy (22-1078)
^
https://www.supremecourt.gov/oral_arguments/2023TermCourtCalendar.pdf
https://www.supremecourt.gov/oral_arguments/argument_audio/2023
-
10:00 AM EST
Ohio v. EPA
The Supreme Court hears oral argument in Ohio v. EPA, a consolidated case concerning the EPA’s authority to establish national air quality standards.
https://www.c-span.org/video/?533613-1/ohio-v-epa
-
11:00 AM EST
Warner Chappell Music v. Nealy
The Supreme Court hears oral argument in Warner Chappell Music v. Nealy, a case on copyright law and statute of limitations for damages.
https://www.c-span.org/video/?533614-1/warner-chappell-music-v-nealy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c33627 No.20451294
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
182f58 No.20451295
>>20451289
Their God isn't paper.
They foist paper on the people in an attempt to make paper the people's God.
Their 'god' is Satan.
"The NWO worships Satan" - Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5da943 No.20451296
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451297
>>20451279
Yes, agree, because they lack God n so have a void inside that they fill with material objects, conditions, n using other people to try to fill it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fa3885 No.20451298
>>20451059
Someone's thinking! The medical industry foisted the jabs on you and happily shoved that poison into your arms, your family's arms, and many others. They have no guilt or shame, and are fully supported by the corrupted trash that wears a uniform.
Nothing new to see here. At least Trump is gonna give the uniform wearers complete immunity to do whatever they want.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2da63c No.20451299
https://x.com/ClownWorld_/status/1760144614324113906
Brittany the methed up chick you see outside a gas station asking for money
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
863f68 No.20451300
>>20450945
If only Youtube warnings advised kids about Fentanyl instead of COVID and climate change BS.
Was he transgender?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
863f68 No.20451302
>>20451299
Material girl living a material world… No god = no purpose = no class
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451303
>>20451286
i suspect Michigan's election are rigged.
Why would i suspect that?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b04bf No.20451304
>>20451299
Can you imagine? ..that's your mother.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a5b76 No.20451305
>>20451297
kek that is is hilarious anon. So because you do not buy into some lie that was given to you you are what less than?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451306
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451307
God promised Noah to never flood the earth again, and sealed it using the rainbow.
I wonder if that was the same time our vision was limited to, the now visible light spectrum?
Maybe these entities can only be seen in different frequencies.
Could this limitation be reversed?
Would be wild to wake up one day and view the world with new eyes.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ce037a No.20451308
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451309
>>20451299
Shitty replacement.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451310
>>20451284
>Catchy tune
Dan thinks so, too!
Feb 21, 2024, 12:39 AM
https://truthsocial.com/@DanScavino/posts/111967860037136862
"Another Level" - OH THE LARCENY
Standing in the street
The sun is in the east
Calling out the beast
The tiger underneath
Starting to believe
The world is at my feet
I'm ready for the feast
It's all within my reach (it's all within my reach)
I'm going all the way
I'm going, yeah, my blood is rebel
I'm going all the way
I'm going to another level
To another level
To another level
If I'm on the loose
Running after you
There's nothing you could do
I'll catch you and it's through
Hustle for the juice
Hundred twenty proof
I'm blowing up the roof
Blowing up the roof
Got nothing left to prove (come on)
I'm going all the way
I'm going, yeah, my blood is rebel
I'm going all the way
I'm going to another level
(Let's go) to another level
(Gotta get my hands dirty)
To another level
Chain breaker, earth shaker, rain maker
Yeah, another level
Chain breaker, earth shaker, rain maker
Yeah, another level
Chain breaker, earth shaker, rain maker
Yeah, another level
Chain breaker, earth shaker, rain maker
Oh, to another level
I'm going all the way
I'm going, yeah, my blood is rebel
I'm going all the way
I'm going to another level (yeah, come on)
To another level
(Let's go, let's go, let's go)
To another level
To another level
(Let's get it)
To another level
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
863f68 No.20451311
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a5b76 No.20451312
>>20451307
ghost glasses, they live. seeing dimensions that are out of phase all at once. It was a Doctor Who episode also where the Daleks were pretending to be ghosts.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451313
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8a109 No.20451314
NASA Sets Coverage of First US Uncrewed Commercial Moon Landing
FEB 20, 2024
As part of NASA’s CLPS (Commercial Lunar Payload Services) initiative and Artemis campaign, Intuitive Machines is targeting no earlier than 5:49 p.m. EST Thursday, Feb. 22, to land their Odysseus lunar lander near Malapert A in the South Pole region of the Moon.
Live landing coverage will air on NASA+, NASA Television, the NASA app, and the agency’s website. NASA TV can be streamed on a variety of platforms, including social media. Coverage will include live streaming and blog updates beginning 4:15 p.m., as the landing milestones occur. Upon successful landing, Intuitive Machines and NASA will host a news conference to discuss the mission and science opportunities that lie ahead as the company begins lunar surface operations.
In May 2019, the agency awarded a task order for scientific payload delivery to Intuitive Machines. Odysseus launched at 1:05 a.m., Feb. 15, on a SpaceX Falcon 9 rocket from Launch Complex 39A at NASA’s Kennedy Space Center in Florida.
NASA is working with several U.S. companies to deliver science and technology to the lunar surface through the agency’s CLPS initiative. This pool of companies may bid on task orders for end-to-end delivery services, which includes payload integration and operations, launching from Earth, and landing on the surface of the Moon. NASA’s CLPS contracts are indefinite-delivery/indefinite-quantity contracts with a cumulative maximum contract value of $2.6 billion through 2028.
Through the Artemis campaign, commercial robotic deliveries will perform science experiments, test technologies, and demonstrate capabilities to help NASA explore the Moon in advance of Artemis Generation astronaut missions to the lunar surface, and ultimately crewed missions to Mars.
https://www.nasa.gov/news-release/nasa-sets-coverage-of-first-us-uncrewed-commercial-moon-landing/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b3d321 No.20451315
>>20451309
Ahh, cahm annn! That's the real Brittney.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451316
>>20451310
We're gonna rumble.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
37bb9d No.20451318
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41cc09 No.20451319
>>20451295
Actually that was Q quoting Putin.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451320
>>20451309
mouth is different than original…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451321
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451322
>>20451300
What ever happened to good old heroin
The reason they still guard poppy fields in Afghanistan
No more opium like back years ago
It's all fentanyl….its all good
They did all of this before
30s or 40s…same shit different heads
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a285b0 No.20451323
ANQUIFA … more cowbell. kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
863f68 No.20451324
YouTube embed. Click thumbnail to play. >>20451311
Listen to the sounds of porn being downloaded
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861af2 No.20451325
>>20451320
from..? either/or?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451327
YouTube embed. Click thumbnail to play. Desperate agencies do stupid things.
Dead cat bounce.
You may have the site but we have the source.
https://mobile.twitter.com/wikileaks/status/1011441579565953025
Panic is good.
Panic is right.
July 2018 - the month the world discovered the TRUTH.
Conspiracy no more.
Time to FEED.
>Desperate agencies do stupid things.
>Desperate agencies do stupid things.
>Desperate agencies do stupid things.
>Desperate agencies do stupid things.
>Desperate agencies do stupid things.
>Desperate agencies do stupid things.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
089c73 No.20451328
>>20451311
1200 was fast BITD
https://www.chinet.com/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2da63c No.20451330
https://twitter.com/mattgaetz/status/1760302320363991260
Hey @fbi - our staff has been trying to get in contact with you. No response.
The scene outside your Valparaiso office in my district is……alarming.
Is everyone OK?
Please check in safe.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20451332
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2da63c No.20451333
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451334
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451335
>>20451320
The replacement can't dance and looks like shit. It only fools the morons who aren't paying attention. Suddenly Bald Britney was the replacement. Should have been obvious to everyone, but they are magicians, who are masters of illusion.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451336
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6b63c No.20451337
Let's hope his trashy tattoo 'artist' buys the toxic Chinese ink…
https://dailycaller.com/2024/02/20/machine-gun-kelly-tattoo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4ec20 No.20451338
The Deep Staters are going to be tortured beyond anyone's imagination medevac type stuff.
MAGA PATRIOTS EX MILITARY IS WAITING FOR YOU
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3b6694 No.20451339
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
388337 No.20451340
>>20451299
still got it, girl!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451341
SEC closes Rumble investigation in latest regulatory clearance of global free speech platforms
Published: February 21, 2024 9:22am
The SEC said: "Based on the information we have as of this date, we do not intend to recommend an enforcement action."
>https://justthenews.com/politics-policy/regulation/sec-closes-rumble-investigation-latest-regulatory-clearance-global-free
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1dd219 No.20451342
>>20451330
Maybe they're having the hazards of dui/dwi demo
And the little known don't know too much about HRC demo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451344
#Truckers4Trump
https://twitter.com/search?q=%23Truckers4Trump
https://twitter.com/Chicago1Ray/status/1760299933108678754
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451345
>>20451340
That she does. Almost seems like it's comms but I can never figure out if it is or not with her.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451346
https://twitter.com/PapiTrumpo/status/1760124753027711360
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451347
10:00 AM EST
WAR ROOM WITH STEVE BANNON 2-21-24
RealAmericasVoice
https://rumble.com/v4et2xt-war-room-with-steve-bannon-2-21-24.html
11:00 AM EST
Steve Bannon War Room Event - CPAC in DC 2024: Where Globalism Goes to Die - Wednesday
Conservative Political Action Conference (CPAC)
https://www.digital.cpac.org/us/events-dc2024
https://agenda.m.cpac.org/agenda/wednesday
https://agenda.m.cpac.org/live-stream-w-rumble
https://rumble.com/CPAC
don't know if the cpac thing will be streamed
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451348
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e251ca No.20451349
Alabama’s supreme court ruled embryos are ‘extrauterine children’. IVF patients are worried
“They’re worried about what to do with their frozen embryos. They want to be the ones who make the decisions on how best to utilize their embryos – not the supreme court,” said McLean, who provides IVF as part of her work as an OB-GYN at Alabama Fertility, which has three locations in the state. McLean said she has spoken to more than a dozen of her patients over the last 48 hours, but: “Frankly, because of the lack of guidance, we don’t we don’t know exactly how this translates to our care.”
Since each created embryo is now a person in the eyes of the law, the Alabama ruling casts multiple parts of the IVF process into legal jeopardy. Providers may no longer be able to freeze, thaw, transfer or test embryos using best medical practices. People also frequently make more embryos than they use, and it is unclear if Alabamians would be able to ever dispose of those embryos under the supreme court ruling.
The consequences could even pose an existential threat to IVF in Alabama, as providers and patients may flee the state rather than risk liability flowing from the ruling.
“It’s a nonsensical ruling with devastating consequences for the health of the people in Alabama,” said Sean Tipton, chief advocacy and policy officer for the American Society for Reproductive Medicine. “The court, of course, didn’t deign to deal with the real-world implications of their decision, but they are profound.”
During a typical IVF process, providers use medication to stimulate the ovaries to produce multiple eggs, which are then extracted. Experts in a laboratory fertilize the eggs with sperm to create embryos. Doctors may then transfer an embryo or two into the patient’s uterus, or freeze embryos for future use.
https://www.theguardian.com/us-news/2024/feb/21/alabama-ivf-embryo-extrauterine-children-ruling
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451350
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451351
>>20451339
It was a fake mustache.
PID
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1dd219 No.20451352
>>20451299
Or wanting to trade for a roll of tp
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451353
>>20451328
Push button phoney
Fax machine noises …..memory storage
Not a problem
We got miles of this shit
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451354
https://twitter.com/QueenMAGAUltra/status/1760280915606200561
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
37bb9d No.20451355
>>20451288
checked
https://qagg.news/?q=&q2=1626
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451356
Take a ride, 5 min
See how the plans going.
Any results at ALL?
Fentanyl, child/human trafficking.
Obvious.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3652d No.20451357
>>20451299
a desperate need for attention.
cannot imagine spending any time around a person with such narcissistic needs.
She needs a come to Jesus moment.
no long now..
join the anons and tell all Britney before you are silenced..
prayers sent and this is from an anon who has no time for entitled females and the destruction they have caused to the world with feminist idealogy.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
318a91 No.20451358
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
182f58 No.20451359
>>20451319
Yes, indeed.
Anon views it as a confirmation, as Q agreeing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6a2e18 No.20451360
Assange Trial Live
Day 2 cont.
I will save you the bulk of the legal dry-heave taking place.
The attorney for the U.S. government just said that Julian Assange's publications had nothing to do with journalism.
She said they are "grave and serious crimes".
(apparently forgetting that they were improperly classified documents and video to begin with, in order to hide monumental evidence of U.S. war crimes including the gunning down and murdering of women, children, and reporters as U.S. troops laughed.)
The U.S argument continues to be detached from reality and the facts of the case.
The judge has asked for Manning's sentencing remarks.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451361
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6b63c No.20451362
>>20451322
The CIA ran the heroin production, protected the fields for decades.
When Afghanistan was abandoned the Taliban burned the poppy fields and killed the Afghani heroin/opium producers.
Taliban is more conducive to honorable human behavior than American UniParty globalist cabal.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451363
https://twitter.com/NobodymrRobert/status/1759732348881711295
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1dd219 No.20451364
>>20451362
George HW "Poppy" Bush
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451366
https://twitter.com/NobodymrRobert/status/1759737748599255333
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451367
https://twitter.com/TheLovelySheri/status/1760310379815526581
Where can I sign up to be a migrant?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
42c115 No.20451368
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4ec20 No.20451369
MAGA PATRIOTS are God fearing Christian people and all that Jew we are God's chosen people crap is the biggest bunch shit.
MAGA only worships Jesus Christ.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451370
>>20451354
And now NY will start putting illegals behind the wheel of big rigs.
More slave labor.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451371
>>20451333
That's disturbing.
Is this an indication that Kelce has spent too much time scanning cocks in the boy's shower?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451372
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
989d90 No.20451373
>>20450977
NUCLEAR ERROR Trident fiasco as Brit sub ‘fired dummy missile at the United States’ in first nuke test for four years
Unarmed Trident II D5 rocket, which can kill millions when fitted with warhead, experienced a serious malfunction during the practice launch off Florida
Carri-Ann Taylor
Published: 1:50, 22 Jan 2017
NUCLEAR ERROR Trident fiasco as Brit sub ‘fired dummy missile at the United States’ in first nuke test for four years
Unarmed Trident II D5 rocket, which can kill millions when fitted with warhead, experienced a serious malfunction during the practice launch off Florida
Carri-Ann Taylor
Published: 1:50, 22 Jan 2017
https://www.thesun.co.uk/news/2675087/trident-fiasco-as-brit-sub-fired-dummy-missile-at-the-united-states-in-first-nuke-test-for-four-years/amp/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7881d No.20451374
18 of 22 hit on Influenza A with c19 ATATTGCAGCAGTACGCACACA primer.
Thinking about if not optimal PCR conditions, how much this nonspecificty would contribute to PCR+ c19 in the face of Influenza A infection?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451375
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451376
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451377
>>20451367
Elections have consequences, especially the rigged elections.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6b63c No.20451378
>>20451373
Why are we allowing the faggot, muzzie Brits to conduct war operations off our coast??
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
579696 No.20451380
https://twitter.com/Tragicrepublic_/status/1760314978253627859
"Elon Musk" #TrumpCult #Truckers4Trump NYPD New York City they keep blocking me from posting her shameful press conference. You won’t believe the reason why .
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451381
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8dd3ea No.20451382
YEP. The elite have decided that Creepy Joe will not be their presidential candidate come November. The New York Times is preparing the public. https://www.thegatewaypundit.com/2024/02/report-biden-white-house-furious-new-york-times/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
989d90 No.20451383
YouTube embed. Click thumbnail to play. >>20450977
2016
Theresa May is coming under increasing pressure to divulge more details about what happened during a Trident missile test last June.
So far, the British prime minister has refused to deny or confirm if the missile misfired after it was reported that it went of course.
May was told about the test upon taking office in July, shortly before MPs voted to renew the nuclear weapons system.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451384
>>20451378
Cause they need the money
That's American tax dollars at work
See they don't make anything either
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451385
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bb42ab No.20451386
>>20451373
Well, now we know the target of that particular missile tube in that particular sub off the coast of the US. Some ally the limey rats are.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451387
>>20451373
They will not get a second try.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
089c73 No.20451388
>>20451353
My first 8085
& my TNDY 6k HD bought at Tandy/Radio Shack Going out of biz sale. Used to access Chinet mid 80's
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451389
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ee25d0 No.20451390
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451391
>you believe He literally ascended?
me:
AND He walked on water, if you understand reality.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e28969 No.20451393
>>20450928
This is pretty pervy…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451394
>>20451376
NEW EYES
>#1584
Jan 20, 2017
June 20, 2018
Exactly 17 months.
Do you believe in coincidences?
God bless you all.
>#1585
We stand.
We fight.
TOGETHER.
Organized riots being planned.
Counter measures in place.
Resistance far smaller than portrayed by MSM.
Attacks will intensify.
You, collectively, are a massive threat.
Censorship applied to scale down impact/reach.
It’s failing.
Trust yourself.
Public awakening.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e28969 No.20451396
>>20450928
admin, remove this?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
430277 No.20451397
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
34fe79 No.20451398
>>20451388
That before the CD was invented….lol
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d449bc No.20451400
YouTube embed. Click thumbnail to play. How long will we submit to a world run by racketeers and gangsters? Neil Oliver: The Profits of War
‘Biden mourned Navalny’s death and said ‘even in prison he was a powerful voice for the truth'.
'An interesting statement while journalist, Julian Assange, who published truth inconvenient to the US and the west, presently rots in Belmarsh Prison.’
#gbnews #biden #ukraine #julianassange #assange #war #neiloliver
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eec9d6 No.20451401
>>20451391
Peter walked on water too. Peter the Human like Jesus in the Flesh.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
388337 No.20451403
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1509e8 No.20451405
Fentanyl/PIzza market, active.
DNA/cloning facility, active.
Satanic witches, active.
Innocent children being injured 24/7, lives being destroyed, still happening.
Indifference and inability to enforce the law is but feeble COMPLICITY.
RAGE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d84295 No.20451407
>>20451367
Openly stealing your money. Smoking gun evidence of them laundering your tax money and rigging elections could drop and the American people, especially you dumfucking QTARDS wouldn’t do shit
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451409
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ee87ad No.20451410
>>20449923 lb
Why specifically LED lights and TVs?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d80c58 No.20451413
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4a5b76 No.20451414
>>20451407
what have you done?, other than making your first post faggot. What are you going to do? Make a second post further proving what a nigger you are?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c33627 No.20451416
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
989cd9 No.20451417
>>20450977
I hope these posts, concerning the nuke mishap off Florida, will be included inNOTABLES
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8a109 No.20451418
NASA’s New Horizons Detects Dusty Hints of Extended Kuiper Belt
FEB 20, 2024
New observations from NASA’s New Horizons spacecraft hint that the Kuiper Belt – the vast, distant outer zone of our solar system populated by hundreds of thousands of icy, rocky planetary building blocks – might stretch much farther out than we thought.
Speeding through the outer edges of the Kuiper Belt, almost 60 times farther from the Sun than Earth, the New Horizons Venetia Burney Student Dust Counter (SDC) instrument is detecting higher than expected levels of dust – the tiny frozen remnants of collisions between larger Kuiper Belt objects (KBOs) and particles kicked up from KBOs being peppered by microscopic dust impactors from outside of the solar system.
The readings defy scientific models that the KBO population and density of dust should start to decline a billion miles inside that distance and contribute to a growing body of evidence that suggests the outer edge of the main Kuiper Belt could extend billions of miles farther than current estimates – or that there could even be a second belt beyond the one we already know.
The results appear in the Feb. 1 issue of the Astrophysical Journal Letters.
“New Horizons is making the first direct measurements of interplanetary dust far beyond Neptune and Pluto, so every observation could lead to a discovery,” said Alex Doner, lead author of the paper and a physics graduate student at the University of Colorado Boulder who serves as SDC lead. “The idea that we might have detected an extended Kuiper Belt — with a whole new population of objects colliding and producing more dust – offers another clue in solving the mysteries of the solar system’s most distant regions.”
Designed and built by students at the Laboratory for Atmospheric and Space Physics (LASP) at the University of Colorado Boulder under the guidance of professional engineers, SDC has detected microscopic dust grains produced by collisions among asteroids, comets and Kuiper Belt objects all along New Horizons’ 5-billion-mile, 18-year journey across our solar system – which after launch in 2006 included historic flybys of Pluto in 2015 and the KBO Arrokoth in 2019. The first science instrument on a NASA planetary mission to be designed, built and “flown” by students, the SDC counts and measures the sizes of dust particles, producing information on the collision rates of such bodies in the outer solar system.
The latest, surprising results were compiled over three years as New Horizons traveled from 45 to 55 astronomical units (AU) from the Sun – with one AU being the distance between Earth and Sun, about 93 million miles or 140 million kilometers.
These readings come as New Horizons scientists, using observatories like the Japanese Subaru Telescope in Hawaii, have also discovered a number KBOs far beyond the traditional outer edge of the Kuiper Belt. This outer edge (where the density of objects starts to decline) was thought to be at about 50 AU, but new evidence suggests the belt may extend to 80 AU, or farther.
As telescope observations continue, Doner said, scientists are looking at other possible reasons for the high SDC dust readings. One possibility, perhaps less likely, is radiation pressure and other factors pushing dust created in the inner Kuiper Belt out past 50 AU. New Horizons could also have encountered shorter-lived ice particles that cannot reach the inner parts of the solar system and were not yet accounted for in the current models of the Kuiper Belt.
“These new scientific results from New Horizons may be the first time that any spacecraft has discovered a new population of bodies in our solar system,” said Alan Stern, New Horizons principal investigator from the Southwest Research Institute in Boulder. “I can’t wait to see how much farther out these elevated Kuiper Belt dust levels go.”
Now into its second extended mission, New Horizons is expected to have sufficient propellant and power to operate through the 2040s, at distances beyond 100 AU from the Sun. That far out, mission scientists say, the SDC could potentially even record the spacecraft’s transition into a region where interstellar particles dominate the dust environment. With complementary telescopic observations of the Kuiper Belt from Earth, New Horizons, as the only spacecraft operating in and collecting new information about the Kuiper Belt, has a unique opportunity to learn more about KBOs, dust sources and expanse of the belt, and interstellar dust and the dust disks around other stars.
https://www.nasa.gov/missions/new-horizons/nasas-new-horizons-detects-dusty-hints-of-extended-kuiper-belt/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
37bb9d No.20451421
>>20451360
https://twitter.com/richimedhurst/status/1760251267664818663
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
932f46 No.20451425
YouTube embed. Click thumbnail to play. 2:23 / 7:45
What is the TRUE purpose of the UN? with Mel K
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451429
(Hilarious but true I’m told…Kek)
A Tribute to Saint Alexei, Patron Saint of Liberal Democracy
I didn't even know he was sick.1/3=
NICCOLO SOLDO
FEB 20, 2024
VLADIMIR PUTLER HAS GONE AND DONE IT NOW!
Most of you haven’t heard the news yet, but Russia’s most popular political figure, Alexei Navalny, was murdered this past weekend by the brutal dictator temporarily residing in the Kremlin. Well-placed sources say that this hit was ordered by the weak (and little) man known as “Vladimir Putin” because Navalny’s crack team of anti-corruption activists had found child porn on his laptop, and were about to publish this bombshell in media across the globe.
My better placed sources inform me that Putler had given the order to kill him in a fit of rage when he learned from Tucker Carlson that Navalny was a “superfan” of the animated TV series “Rick and Morty”. The show’s subversive and highly intelligent humour (most of you are too dumb to get it) is viewed by Putler as a personal affront because of thesecretly encoded anti-regime messages strategically planted throughout each episode. Russia’s state security service (FSB) tried to decipher them, but their analysts are simply too dumb to be able to do so (remember: the show is for the highly intelligent, which means that most of you can’t get it….so stop pretending that you do).
During the interview prep session, Tucker Carlson shared this now famous photo of Alexei Navalny and his wife Lyudmila watching Rick and Morty on their flight back to Russia from Germany, shortly after Alexei’s recovery from Putlerian poisoning:
The fact that Putler personally went to the Siberian gulag where Alexei was being held prisoner in order to kill him in person speaks volumes about how weak, pathetic, and cowardly the Russian dictator really is. He knew that in any andopen free election Russia (monitored by the OSCE, UN, the CIA, and other trusted international bodies)he would get trounced by Russia’s most popular politician in history. Research shows that in a head-to-head election for the Russian Presidency in a free and fair vote, Navalny would get between 85-91% of the overall popular vote. To put it simply, he had to go.
My very well-placed sources in Russiatell me that there is now a fight over custody of Navalny’s beautiful, swimmer-like corpse. Most assume that this is because Putler fears that an autopsy will reveal how he wasbludgeoned to death with vodka bottles. There is no doubt that this IS the case, but there is also another reason: Putler wants to ensure that no one gets access to Alexei’s perfect remains because it is rumoured that it has already performed three miracles, thus making Russia’s most popular person in history a candidate for sainthood in the Catholic Church.
Some are already calling him “The Messiah of the Russian future”:
I believe this. I also believe thatevery Russian townin 50 years from now will have itsown Navalny Square. Russian writer Lyudmila Ulitskaya agrees with me.
Mikhail Shishkin is fighting for democracy in Russia on the frontline in Switzerland, and I agree with his assessment here: Russian exiles in Switzerland have a great historical track record of returning home and making their country a liberal democratic paradise, so Shishkin is one to watch.
Carole Codswallop also paid tribute to the greatest Russian of all-time:
If you don’t know who Carole is, she is the UK’s leading crusader against misinformation AND disinformation. She is leading two battles simultaneously, and has done incredible work uncoveringhow Putler financed and organized #Brexit. The brutal murder of Alexei makes her work all the more important.
St. Alexei, Patron Saint of Russia and Liberal Democracy
St. Alexei was not always a good person i.e. liberal democrat. In fact, his earlier life resembled that of St. Augustine of Hippo, one of Christianity’s titans. In his youth, Augustine turned away from God to pursue a life of hedonism, eventually realizing that a life without God was not a worthy life at all.
St. Alexei also rejected liberal democracy in his youth, as we can see from this 2007 entry in his LiveJournal:
Much like the typical non-liberal democrat Slav, our St.Alexei was crude, mean, vicious, savage, and sadistic…..just like his murderer, Putler.
It was around this time that God/Liberal Democracy intervened from up on high, andgranted him a scholarship to Yale University via the Yale World Fellows Program. God/Liberal Democracy picked him out of a crowd to set him on the right path, the path of godly liberal democracy. At Yale, St. Alexei attended weekly seminars based around the concept of the “Good Society”:..
https://niccolo.substack.com/p/a-tribute-to-saint-alexei-patron?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451430
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451433
YouTube embed. Click thumbnail to play. ANONS, READY?
Recent Q-Day COMMS?
>>20430933 - PB
Feb 17 2024 (4:20pm)
If it is in fact go-time, which seems logical with all available Comms considered over the past 24 hours, then either the POTUS or Dan will confirm. "GO TIME" "LFG". There will be something if it's accurate, perhaps tonight's rally.
>https://8kun.top/qresearch/res/20430491.html#q20430933
Be the autists we know you are.
You were chosen for a specific reason.
Anons - "Built for This Time" (Z. Wolfe)
GET READY!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451435
>>20451429
2/3
Good Society. World Fellows present to each other their vision for making the world a better place, what they do professionally, and how they contribute to building the ‘good society.’..
He also attended salons:
Salon. World Fellows host distinguished guestsfor discussions on key topics, expanding their knowledge and challenging their views….
St. Alexei also experienced his own personal development:
World Fellows receive individual and group coaching and skills development training. World Fellows can audit many of the 2,000+ courses offered at Yale, work on individual or collaborative projects, and conduct independent research.…
And most important of all, he was brought into a circle of good, liberal democratic people, all of whom know that thepurpose of life is to spread liberal democracy around the globe no matter how many millions of people need to be killedin the process of saving the world from non-liberal democrats:
Fellows expand their global network by connecting with World Fellowsin their cohort and with other Fellows spread throughout the world. Yale’s campus also provides countless opportunities to connect with faculty and students over shared professional and academic interests.
Navalny left the Yale World Fellows Program a new man. No longer would he ally himself with Russian Neo-Nazis. No longer would he spew hate against Jews, “faggots”, and “black-asses” (the evil Russian term for those from Russia’s southern periphery). He would now spew hate only against non-liberal democrat Russians, just like God demands of us all. Alexei was finally saved.
St. Alexei’s mission was now a simple one:deliver to Russia the liberal democracy that its people want and crave, but that Putler and his henchmen refuse to allow. With the financial support of liberal democratic Russian business oligarchs of the 1990s, St. Alexei began to uncover the worst cases of corruption in Russian history. Russia had never seen such massive and brazen corruption before. In fact, it was the central purpose of Putler’s Russia.St. Alexei urged Russia to return to the economic paradise of the 1990s,where market reforms worked to improve the lives of all Russians, hand-in-hand with efforts to institute liberal democrat rule. Like the vast majority of Russia’s citizens, St. Alexei wanted to turn the clock back to the incredibly successful and utopian Yeltsin Era.
St. Alexei’s efforts to bring liberal democracy to Russia were so close to succeeding that Putler had him poisoned with Novichok in 2020. Our saint had to flee to Germany to get proper treatment to save his life so that he could continue his crusade on behalf of the Russian people and western financial and state security interests.Displaying his bravery and his total lack of fear, he hilariously returned to Russia in early 2021, defying little-man Putler, daring the dictator to toss him in jail.
Putler accepted the challenge and threw him into prison…..and then had him killed three years later.
St. Alexei, Patron Saint of Russia and Liberal Democracy, Pray For Us
A hero, a saint, and also an oracle. St. Alexei urged Russia not to support evil Syrian dictator Bashar Assad in his brutal,genocidal war against the liberal democrats of al-Nusra and ISIS: Liberal democracy won in Syria, just like our saint had predicted.
Our saint also called out the brutal, genocidal Russian invasion of Ukraine as well. My humble request is thatMoscow be renamed ‘Navalnygrad’ (or Navalnyyhrad in Ukrainian spelling)once the Ukrainian Army liberates it from Moskal rule and a liberal democratic government isinstalled in power by the CIA and MI6. This would be the most fitting tribute to St. Alexei, Patron Saint of Russia and Liberal Democracy…
https://niccolo.substack.com/p/a-tribute-to-saint-alexei-patron?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b3681e No.20451437
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152d32 No.20451438
Used needles are being found in the snow on rural gravel back roads in Vermont. So many it's causing an issue. No sauce because no one has (or will) published this. Anon is reporting this here.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7633b0 No.20451440
What are the impacts of the Red Sea shipping crisis?
The Red Sea shipping crisis is disrupting global supply chains and increasing freight costs.
The Red Sea shipping crisis — a result of Houthi rebel attacks on cargo ships and tankers — is causing hundreds of vessels to avoid the Suez Canal, one of the world’s most important waterways. Instead, these vessels are being forced to reroute around southern Africa — a lengthy detour that adds 4,000 miles to each journey, vastly increasing transport times and freight costs. Will the crisis reignite supply chain issues and fuel inflation concerns?
With 30% of global container trade passing through the Suez Canal, the Red Sea shipping crisis is upending supply chains. This is compounded by the ongoing shipping disruptions caused by blockages in the Panama Canal, which is experiencing one of the region’s worst droughts since the 1950s.
https://www.jpmorgan.com/insights/global-research/supply-chain/red-sea-shipping
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451441
>>20451435
3/3
St. Alexei joins a long list of liberal democrats who have been murdered by Putler. Some of the better known victims include:
Ibn al-Khattab (1963-2002)
al-Khattab was a Saudi liberal democrat who went to Chechnya to lead the Arab Mujahideen there, in its quest to end Russian rule not just in that province, but in the whole of the Caucaus region. His objective was to set up the Islamic Liberal Democratic Emirate of the North Caucasus. In 2002,Putler donned a goat costume, and then sexually lured al-Khattab into a wooded area near the Georgian border. Once he had him alone, Putler stabbed al-Khattab 50,000 times, most likely leading to the liberal democrat’s death.
Yevgeny Prigozhin (1961-2023)
Prigozhin was a liberal democrat who headed the Wagner liberal democratic paramilitary force, composed of 80,000 Russian liberal democratic political prisoners, all imprisoned by Vladimir Putler. Wagner was to be the nucleus of the Free Russian Liberal Democratic Army that would march on Moscow/Future Navalnyyhrad, but his heroic effort to free Russia unfortunately failed. Putler murdered him in 2023 using a remote control device to bomb the plane he was aboard on at the time.
Boris Berezovsky (1946-2013)
The most powerful liberal democratic businessman of Russia’s Golden Liberal Democratic Age of the 1990s, he failed to detect just how malicious, evil, and especially, cunning, Putler actually was.After all, it was Boris who raised him up through the various verticals of power, convincing the Great Boris Yeltsin that Vladimir should be his successor, the one to finalize Russia’s transition to free-market liberal democracy. Upon gaining power, Putler turned the tables on liberal democrat and free market reformer Berezovsky,forcing him into exile in the UK. Boris would spend the next decade working as an NGO activiston behalf of liberal democracy and human rights in Russia. In 2013, Putler infiltrated his mansion in the Kentish countryside, andhanged him in his bathtub. It was ridiculously ruled a ‘suicide’.
Shamil Basayev (1965-2006)
The most powerful military leader of the Chechen resistance to Putler’s anti-liberal and anti-democratic rule, liberal democratic freedom fighterBasayev masterminded not only the Moscow Theater Hostage Liberation in 2002, but also the very successful liberal democratic attack on the elementary school in Beslan in 2004which resulted in the deaths of 300+ children,all of whom were future Putler loyalists. Basayev was an incredibly effective guerrilla leader, and a man whose dedication to liberal democracy, human rights, andfreedom won him admiration across the globe, including from liberal-democratic NGO al-Qaida. In 2006, Basayev fell victim to the same ploy that had ensnared and killed al-Khattab. Putin could not believe that he fell for it after knowing what had happened to his liberal-democratic colleague and fellow freedom fighter from Saudia Arabia.
St. Alexei Had a Dream
Imagine a Russia that would no longer be ruled by Putler and his clique. Imagine a Russia that would return to the halcyon days of the Yeltsin Era.Imagine a Russia, both free and democratic, one in which all of its natural resources could be stripped by foreign financial interestswho have only the best interests of Russia and Russian at heart. Imagine a Russia shrunk down to the size of Muscovy, with a free Tatarstan, Bashkortostan, Dagestan, etc. removed from its rule, allowed to pursue its own liberal democratic path.
This is the vision of St. Alexei, Patron Saint of Russia and Liberal Democracy. See you next year in Navalnyyhrad.
https://niccolo.substack.com/p/a-tribute-to-saint-alexei-patron?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451442
>>20451259
>RNC Chair Candidate Michael Whatley Refused to Investigate Fraud in NC
Is like sending Nimrada to ambassador at the UN to get a proper governor in SC?
Who's replacing him in North Carolina?
RNC is useless right now.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451443
>>20451433
>Be the autists we know you are.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b41d33 No.20451445
Can anyone direct me to the ….part of Russia that's like Florida..gotta be one
They said that it's cold and brutal and never can remember good…
So….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451447
>>20451318
>7,ClipboardImage.png)
>>20451442
>Is like sending Nimrada to ambassador at the UN to get a proper governor in SC?
>Who's replacing him in North Carolina?
>RNC is useless right now.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451448
>>20451387
>>20451387
>They will not get a second try.
"FINAL BATTLE"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1dd219 No.20451449
>>20451384
A place to launch
To a target elsewhere
And all the snoops to masint etc….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d65279 No.20451452
The world was just reminded - America is protected.
And our retaliation will be "success".
[You] lose, we win.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4dc25 No.20451454
It appears that there is great anxiety in the minds of humanity. More so than last week. Anon has pulse on this due to type of job. My prediction is that in two weeks we will know why all the anxiety is in the aether at the moment.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8dd3ea No.20451455
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451456
>>20451429
BTW the max votes was less then 2% for Nalvany, that is how effective propaganda by stupid journalists are
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
388337 No.20451458
>>20450977
>>20450977
the British are coming!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451461
>>20451443
>adapted
Q !!Hs1Jq13jV6 ID: dd7b12 No.10597304 📁
Sep 10 2020 20:21:55 (EST)
FB-TWIT using DARPA provided software to censor and restrict picture content using 'matching' [think reverse image] _upload one to find/locate all [cycling 5s].
>>
Adapt & overcome.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7881d No.20451462
trying to nucleotide and protein blast
confusing at first
still is
but this shit is interesting
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
258640 No.20451465
SETTING UP TRUMP -Ain't it funny how the evidence of democrat collusion is all over the place but the old diaper faggot blabber mouth Chuck Grassley never does a damn thing same for Jim Jordan he never gets shit done either.
There is no two party system in Washington DC it's only one criminal SYNDICATE lying to the American people everyday.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a61d53 No.20451466
2 hours and 27 minutes left…
https://gettrumpsneakers.com
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a190e2 No.20451467
Vaticunt shill and Nikki courting each other again. So cute.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451469
>>20451307
NEW EYES
Yes it would.
"Read the Bible. God wins."
Past tense > Future tense.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451470
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
027456 No.20451471
A Stunning 10 Million Illegals Have Entered The US Under Biden; Tucker Warns They Are "Destroying" The Country
https://www.zerohedge.com/economics/stunning-10-million-illegals-have-entered-us-under-biden-tucker-country-being-destroyed
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
388337 No.20451472
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451473
>>20451461
Three words that blew my little mind at 12 years old watching this movie for the first time, and literally molded my behavior moving forward from that point. 100% of the time it works every time.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
70b779 No.20451476
>>20450928
The MSM's degenerate hero, what a surprise.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3539d2 No.20451478
The pinned thread in which we thanked Q team and expressed our appreciation for them, has been archived.
So I would like to take some space and thank them for their sleepless nights, give prayers for operators in harm’s way, and share our optimism for the future.
Let us take take a moment too, to thank them for this front row seat. Even though it’s the front row of a death defying roller coaster, this here is the unprecedented ride of a lifetime.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451479
>>20451452
>>20451472
Flags Out, Anons?
FLAGS OUT!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3b5ca No.20451480
>>20449409 (pb) Apparently some ways to boost your reach on the socials algorithm
Just a reminder that this 'relics of 1.0' is bullshit apologetics for Muskhead
Dozens of complete social media platforms have been built from the ground up without censorship or algorithm manipulation - JUST SINCE MUSK TOOK OVER.
He could have rebuilt it, he chose not to. Or does not have the power to.
Use Nostr Instead
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a9098 No.20451481
>>20451280
This makes me feel old
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fd904 No.20451482
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451485
>Satan, or the Devil, is one of the best-known characters in the Western traditions of Judaism, Christianity, and Islam. Surprisingly, this entity was a late-comer in the ancient world. Satan, as a totally evil being, is nowhere to be found in the Jewish Bible. He evolved during the height of the Persian Achaemenid Empire (beginning c. 550 BCE) and was adopted by Jews living under Persian rule at the time. His formal name, Satan, derives from the Hebrew 'ha-Satan'. 'Ha' means 'the' and 'Satan' means 'opposer' or 'adversary'. The name described his eventual function as the opposer of God’s creation. Greek 'diabolos', English 'devil', meant 'accuser', 'slanderer', again describing his role. The concept of Satan emerged over time and in phases.
>Evil has always existed. Humans encountered natural disasters (earthquakes, floods), wars with pillage and rape, disease, plagues, and infant mortality, man-made evil such as murders and theft, and of course, death. As the ancients constructed their religious systems, the existence of evil had to be explained and rationalized. Creation myths often designated a high god or a king of the gods, who controlled everything including the other gods as well as nature. In this capacity, they were responsible for both good and evil. The term to describe this ability is omnipotence (all-powerful). In Deuteronomy 28, God declares that he controls both prosperity and suffering. Many creation myths addressed how and why evil arose.
they worship satan meaning they worship deceit, lies, and evil
https://www.worldhistory.org/article/1685/the-origin-of-satan/
thoughts in your own mind - good/evil
follow good - you are of truth
follow evil - you are of lies, deceit
they are not supernatural beings that will one day come from under the earth or down from the clouds
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451486
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451487
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
777b3e No.20451489
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451490
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451491
Anons, do you remember the call to battle?
BATTLE STATIONS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451492
>>20451280
Still have this one for EEPROMS. For Atari 8bit series (400/800/XL/XE) and connected via the two joystick ports. Those were the days.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6c086 No.20451493
>>20451461
>>20451473
We’ll just have to make one of a kind memes
As well as use well known memes.
Since Q told us This (and more effective censoring) was coming. We worked on ways to fool the computer eye.
Using captcha type fonts that’s computer can’t read for example. The human eye/brain can recognize through camouflage a great deal more than any computers can.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451495
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
777b3e No.20451496
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ee87ad No.20451497
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451499
Rumble embed. Click thumbnail to play. The Ingraham Angle Town Hall: President Donald Trump
HankKimball
https://rumble.com/v4etgjr-the-ingraham-angle-town-hall-president-donald-trump.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451500
that post will now heavily be shilled because they have an agenda to push in which they make some kind of profit from
truth is, each and every single person on this planet has a choice within themselves to be a good person or an evil one and those choices affect others and their choices which creates a cascading effect in perpetuity
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
777b3e No.20451502
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451503
>>20451494
>>20451496
Remember this day, anons. BIG DAY!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
431a72 No.20451506
Are you guys monitoring the latest Moon attempt?
Odyssey has safely inserted in Lunar orbit this morning.
Moon landing attempt tomorrow.
https://twitter.com/Int_Machines
https://www.intuitivemachines.com/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a45d18 No.20451507
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451509
>>20451290
Mornin' Swordanon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ff7395 No.20451512
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c33627 No.20451513
>>20451504
I fail to be interested without elaboration.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1389cb No.20451516
>>20451506
No. Perhaps anon still believes “astronauts” played golf on the moon in the 70’s?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
038bcb No.20451517
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451518
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451519
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451520
Patriots Fight > God Wins.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451523
Promises Made.
Promises Kept.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451525
>>20451522
Timing is EVERYTHING.
>>20451452
>>20451486
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3b5ca No.20451527
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
431a72 No.20451528
>>20451480
>r that this 'relics of 1.0' is bullshit apologetics for Muskhead
>He could have rebuilt it, he chose not to. Or does not have the power to
They are rebuilding it - the same Twitter Handle has the details.Saw it this morning. Will try and locate it again.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3b5ca No.20451531
>>20451528
Could have been done in 10 days
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3b5ca No.20451533
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
37bb9d No.20451534
>>20451454
>in two weeks we will know
Soon™
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451536
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451539
>>20451537
GOD NEVER LOSES!
HAVE FAITH!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451540
@400
#25088 >>20450903
>>20450934 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery
>>20450942, >>20450959 Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.
>>20450950 Under the fog of war, Ukraine cancels its 2024 presidential elections
>>20450954 Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students…
>>20451017, >>20451025, >>20451026 Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
>>20451047 Massive farmer protest paralyzes Madrid, Spain.
>>20451071, >>20451078 Trucker Says Boycotting New York City Is Bigger Than Trump - Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE
>>20451103 Argentina under Milei: The Economy Ministry said: “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”
>>20451120 Liz Joy w/CAP: Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!
>>20451126, >>20451164 Air conditioned lawnmower, 1957
>>20451127 Q's 20 posts on Feb 21
>>20451146, >>20451179 Passive Radar for Opportunistic Monitoring in e-Health Applications
>>20451165 Panama Canal suffering major disruption
>>20451167 Lavrov comments on Russian favorite in race for White House
>>20451170 Remington CEO Cites ‘Legislative Environment’in New York as Company Moves to Georgia
>>20451178 Ahoy! The Ship Show & Extra Gravy
>>20451186 The Bee: New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels
>>20451191 Bipartisan Group of US Senators flies to Hungary to bully Orban into approving NATO expansion and guess what? Hungarian politicians refuse to meet
>>20451204 Google’s Gemini AI Blasted For Eliminating White People From Image Searches
>>20451228 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
>>20451236 The PBOC released data today showing the amount of Chinese shares owned by overseas investors fell in 2023 for a second straight year
>>20451269 NASA Astronomy Picture of the Day Seagull Nebula over Pinnacles' Peak
>>20451272 10:00 AM EST NPC Headliners: Secretary of Energy Jennifer M. Granholm
>>20451286 Michigan wanted homeschool registry for warrantless home entry
>>20451293 10:00 AM EST Supreme Court October Term 2023 Argument Day
>>20451314 NASA Sets Coverage of First US Uncrewed Commercial Moon Landing
>>20451341 SEC closes Rumble investigation in latest regulatory clearance of global free speech platforms
>>20451344, >>20451346 #Truckers4Trump
>>20451347 10:00 AM EST WAR ROOM WITH STEVE BANNON
>>20451349 Alabama’s supreme court ruled embryos are ‘extrauterine children’. IVF patients are worried
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451542
21 Feb, 2024 15:27
Russia tears up Soviet-era fishing agreement with UK
The 1956 treaty had allowed British ships to fish in the Barents Sea
British fishermen will be banned from operating in the Barents Sea, one of the world’s largest fisheries for cod and haddock, under new legislation passed by the lower house of Russia’s parliament, the State Duma, on Wednesday.
The bill, which rescinds an agreement signed between the governments of the USSR, the UK, and Northern Ireland in 1956, was passed in its third reading.
The so-called Fisheries Agreement had allowed British ships to fish in the Barents Sea off the north coast of the Kola Peninsula. It was initially signed for a period of five years and automatically renewed every five years since neither party ever withdrew from the agreement.
“The agreement was unfortunately one-sided giving the authority and right to fish only to our partners at the time,” Deputy Agriculture Minister Maksim Uvaidov said, clarifying the details of the treaty.He added that the agreement didn’t provide Soviet fishermen with similar rights.
Taking into account the UK’s decision to strip Russia of ‘most favored nation’ status in 2022,which led to a 35% tariff hike on Russian goods, Moscow says that ending the Soviet-era agreement “will not cause serious foreign policy or economic consequences” for the country.
Commenting on the legislation, Duma Chairman Vyacheslav Volodin said that by tearing up the agreement Russia was returning to its own possession the fish that the UK had been consuming for decades.
“He [President Vladimir Putin] returned our fish to us, because the English, shameless, had been eating it for 68 years.They have imposed sanctions on us, while they themselves make up 40% of their diet, their fish menu, from our cod. Let them now lose some weight,” Volodin said.
A Sky News report from last year claimed that up to 40% of the cod and haddock consumed in the UK comes from Russia.
(This is gonna piss off the elitists in London that Russia will no longer take unjust punishment. The English people will revolt. Kek)
https://www.rt.com/business/592871-russia-uk-fishing-agreement-over/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ee87ad No.20451544
>>20451349
Who pays child support for the embryos?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fd904 No.20451546
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
431a72 No.20451547
>>20451528
Alex Finn
@AlexFinnX
Elon announced last night that the X algorithm is going to change dramatically this week
Several months ago he asked me what changes I'd make
I went through every single line of code
Here's every change I'd like to see that will make X 100x better:
https://twitter.com/AlexFinnX/status/1759980194549444981
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
37bb9d No.20451548
>>20451458
Was PFing yesteday and saw lots of mil activity off Jacksonville, FL
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451549
>>20451506
>Are you guys monitoring the latest Moon attempt?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0009a5 No.20451552
A.m. psychos early birds
No body, didn't happen. Fresh gourmet dog food is a new space. Animal pet products were projected at emerging market speculation
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451555
Anyone mis-price anything lately?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
274913 No.20451557
D5 London: about D5 member countries
The D5 London summit brings together some of the most digitally advanced governments in the world. Read about their digital achievements.
From:
Cabinet Office and Government Digital Service
Published
9 December 2014
The UK is hosting the first summit of a new global network called D5 on 9 to 10 December 2014. The founding members are United Kingdom, Estonia, Israel, New Zealand and South Korea.
https://www.gov.uk/government/news/d5-london-about-d5-member-countries
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451558
>>20451541
11-23-23 ON THIS BOARD
#19963727 at 2023-11-23 06:51:14 (UTC+1)
Q Research General #24509: The Powers That Were. Edition
Dear Father in Heaven we unite in this moment, under the banner of Jesus Christ our Savior who is above all. We pray Father in Heaven, forgive us our sins, set us upright on the foundation of Jesus Christ, strengthen us to put on the full set of armor you have provided to us for this war, and prepare us for the battles, physically and spiritually make us unstoppable as your witnesses and soldiers of Faith.
Lay low the enemy Darkness, cast out the enemy of every kind, bind and silence the enemy of every kind, and deliver your people into the victory bought for us all at Calvary. Father in Heaven, bless us to fight victoriously here in the waking and if it be your will, in the sleeping also. We know you are able to do all things, and that these are not difficult things, but that you have called us to pray, and ask of you (even though you already know what we need), but to ask of you and know that you will answer our prayers in faith.
Show us the truth about the forces coming against the truth, reveal to us the true nature of the unseen controllers here on this board, bring them low before our eyes, on this board, by way of their own shame and love of evil, make your people to trample the lies and upbraid the works of the enemy here. Father in Heaven, liberate this board, liberate the truth on this board, liberate your people on this board, all for your glory and a testimony that The Lord has done these things.
Bless us to be your soldiers, wake up the world Father in Heaven, pour out your Holy Spirit and shine your Light of Truth for all to see, that there is a God in Heaven, that you love us, and you have been fighting for us in this same war throughout the ages. Help the children and all those in need, in harm's way. And bring your vengeance, justice and retribution on the heads of all those who would claim God is not able. Show us your power, Father in Heaven, and fill us with it. For God and Country.
Thank you Father in Heaven, we agree in this moment for these things to be done, in Jesus' name. Amen.
>https://8kun.top/qresearch/res/19963459.html#19963727
GOD ANSWERS PRAYERS.
GOD WINS!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451559
Anchor Husband Confrimmed
Married in 2021, already her exhusband
Russian officials arrest Los Angeles woman on treason charges
Russia's Federal Security Service arrests woman on treason charges
LA woman not identified, is a dual citizen
White House official says U.S. government working to get more info
Kellie Meyer, Nancy Loo
Updated: Feb 20, 2024 / 05:22 PM CST
LOVES OR WE CAN'T WAIT TO SEE
US needs to help LA woman detained in Russia: Mother-in-law | NewsNation Now
(NewsNation) — Russia’s Federal Security Service said a 33-year-old woman with dual citizenship in the United States has been arrested for allegedly raising money to support Ukraine.
Officials did not identify the woman in the statement but said she is a Los Angeles resident. The Federal Security Service, also known as the FSB, is now investigating her for treason.
A statement by the security service said the woman was involved in “providing financial assistance to a foreign state in activities directed against the security of our country.”
“Since February 2022, she has proactively collected funds in the interests of one of the Ukrainian organizations, which were subsequently used to purchase tactical medicine, equipment, weapons and ammunition by the Ukrainian Armed Forces,” the statement said. “In addition, in the United States, this citizen repeatedly took part in public actions in support of the Kyiv regime.”
Saturday marks two years since Russian troops invaded Ukraine, starting a war that has devastated the latter country.
A Russian news outlet is identifying the woman as Ksenia Karelina.Others said her name was Ksenia (Karelina) Khavana. She attended University of Maryland in Baltimore, and graduated from a university in Russia in 2014, according to her Russian social media profile.
Karelina received U.S. citizenship in 2021. She was detained at the end of January in Yekaterinburg, Russia — the same city where Wall Street Journal reporter Evan Gershkovich was taken into custody last year on espionage charges.
A White House official told NewsNation the Biden administration and the State Department are aware of reports that a dual citizen was detained in Russia.
“We are working to obtain more information and secure consular access to the individual,” the official said.
A group of Russian lawyers who specialize in cases involving accusations of treason say the woman had been accused of treason for sending just over $50 to Ukraine through a New York-basednon-profit organization called Razom.
Eleonora Srebroski, Karelina’s former mother-in-law,in an interview with NewsNation’s Nancy Loo, called her a kind person. Karelina, Srebroski said, had gone to relatives to visit Russia at the time of her arrest. That had surprised Srebroski.
“We all know it’s not safe to go there anymore,” she told NewsNation.
Although Srebroski is also from Russia, she does not support the “regime” right now. Srebroski only feels comfortable saying that, though, because “I am safe here in the United States.”
The CEO of Ciel Spa, where Karelina works, told NewsNation’s local affiliate KTLA that they heard about her arrest when she failed to show up for work in mid-January.
“We’re a very close-knit team at work. Everybody is missing her. Everybody loves her,” CEO Isabella Koretz said. “We can’t wait to see her back.”
This story is developing. Refresh for updates.
> https://www.newsnationnow.com/world/russia-at-war/russia-arrests-los-angeles-woman-treason-charges/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451561
>>20451542
>21 Feb, 2024 15:27
>Russia tears up Soviet-era fishing agreement with UK
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451563
21 Feb, 2024 14:57
EU state’s leader sees older Russian speakers as potential threat
Some people who arrived in the Soviet era miss the feeling of being in charge of Estonia, Prime Minister Kaja Kallas (color revolution implant) claims
Younger Russian speakers in Estonia consider themselves Estonian, but their older counterparts who arrived during the Soviet era pose more of a problem, the prime minister of the EU and NATO nation has said.
In an interview with German broadcaster ARD on Tuesday, Kaja Kallas was asked whether she was concerned that Russia’s President Vladimir Putin might use the large proportion of ethnic Russians in Estonia as a pretext for an invasion.
The prime minister responded the share of native Russian speakers in Estonia has declined from 30% to 20% since the collapse of the USSR in 1991.
According to the latest government figures, Estonia’s population stands at just under 1.4 million, meaning there are around 280,000 native Russian speakers in the Baltic nation.
”The Russians in Estonia, of course, are not a homogeneous group. There’s a big difference between old and young people,” Kallas argued.
Younger Russian speakers “see that Russia is invading Ukraine, and that this is wrong, and that we have to fight against it”, and understand that if Russia arrives to “liberate” them or ethnic Russians living in other countries, then “they will lose their homes and their comfort zone,” the prime minister said.
However, Kallas claimed that older Russian speakers, who came to Estonia during the Soviet period, have a different attitude as “they ruled over our country and they want that feeling back.”
The danger that Putin might pose to Estonia and the whole of NATO “depends on the outcome of the war in Ukraine,” she stressed. “If we don’t do enough to stop him there, it’ll continue. With each further step, he’ll become even more emboldened.” (They don’t want their color revolution leaders to be deposed. No one there likes her, they stole the election to get her in.)
“No one is safe if we don't stop the aggressor”because events in one part of Europe spread “very quickly” to other parts of the continent, Kallas warned.
Earlier this month, Russian President Vladimir Putin rejected Western claims that Moscow is planning to attack NATO, describing them as “just threat mongering.”
In his interview with US journalist Tucker Carlson, Putin said Moscow would send its forces into Poland, for example, “only in one case: if Poland attacks Russia. Why? Because we have no interest in Poland, Latvia [one of the three Baltic States together with Lithuania and Estonia] or anywhere else. Why would we do that? We simply don't have any interest,”the Russian leader stressed.
https://www.rt.com/russia/592860-estonia-russian-speakers-ukraine/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451565
>>20451559
>Anchor Husband Confrimmed
Ukrainian Ballerina Spy Ksenia Karelina dig
all pb
>>20446029, >>20446047 "Los Angeles Woman" aka Ukrainian Ballerina Spy Ksenia Karelina
>>20446038 possible roomate is Ukrainian Composer Anna Leonova
>>20446045 There's an Anna Leonova on the Bolshoi Theater website
>>20446042 3 Questions with Anna Leonova,
>>20446271 13 things about: Married name Khavana? In 2021, she received U.S. citizenship after marrying an American man.
>>20446284 identified her as Ksenia (Karelina) Khavana, with Karelina likely being her maiden name.
>>20446302 Anchor Husband? github for Evgeny Khavana, Baltimore, MD
>>20446187 >She was arrested on the same day that Putin sat down for his widely panned interview with Tucker Carlson.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
772008 No.20451566
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
038bcb No.20451567
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c70d88 No.20451568
>>20451373
>>20450977
So many questions about this that hopefully Congress will ask. Do we get a turn firing "dummy" missiles at the UK off their coast?
The UK intelligence agencies and government are not American allies. They represent and care for their country and citizens as much as the American intelligence agencies and government represent and care for theirs - which is to say, not at all.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8a109 No.20451569
NASA brings back retro 'worm' logo for upcoming Artemis 2 moon mission
Feb 21, 2024
The worm is going to the moon.
Artemis 2, the first human moon mission in 50 years, will carry the iconic NASA "worm" logo upon the solid rocket boosters helping to heft the astronauts into space, agency officials stated on Thursday (Feb. 16).
"That's no earthworm you see on SLS! The NASA worm logo is inching into place on our boosters," NASA's official account for the Space Launch System stated on X, formerly Twitter, on Thursday. Each letter of the worm is nearly 7 feet (2 meters) high and the logo is roughly 25 feet (7.5 meters) from end to end.
The curvy NASA lettering was also recently painted in a smaller form on the Orion spacecraft that will bear the four astronauts on the round-the-moon mission no earlier than September 2025 during the first crewed excursion for the spacecraft.
The worm logo was first used in 1975 after being designed by Danne & Blackburn, a New York-based studio who recreated the NASA wording under the U.S. Federal Design Improvement Program, according to Design Week.
Worms started crawling their way into space during the joint U.S. and Russian Apollo-Soyuz Test Project in 1975, continuing to inch their way into orbit during the space shuttle and Hubble Space Telescope launching era.
In 1992, however, then NASA-administrator Dan Goldin retired the worm logo in favor of a "meatball" version to invoke the "glory days" of Apollo, according to agency materials. But the worm made a comeback for limited mission opportunities in 2020, starting with the first SpaceX mission with astronauts on board, under the approval of then-administrator Jim Bridenstine.
"I grew up with the worm as the logo of NASA. It is kind of personal to me," Bridenstine told Space.com partner collectSPACE in 2020. "This is NASA."
Work on the Artemis 2 hardware at NASA's Kennedy Space Center, as well as other locations, continues. The mission was recently delayed nine months to September 2025 due to several technical issues. Delayed too was Artemis 3, now slated for 2026 instead of 2025.
"It takes courage to make the right decision," Artemis 2 astronaut Jeremy Hansen, a mission specialist with the Canadian Space Agency, told Space.com in exclusive interview this month. "In this case," he added, "this one was very clearly the right decision. There are concrete things that we know we will use this time for."
The mission includes NASA commander Reid Wiseman, NASA pilot Victor Glover (who will become the first Black person to leave low Earth orbit, or LEO), NASA mission specialist Christina Koch (the first woman to go beyond LEO) and Hansen (the first non-American).
NASA, Canada and more than 30 other countries have signed up for a set of peaceful space exploration norms under the U.S.-led Artemis Accords. A subset of those countries, like Canada and certain members of the European Space Agency, have committed also to contributing hardware for the Artemis program's moon aims.
https://www.space.com/artemis-2-moon-mission-nasa-worm-logo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86e45b No.20451570
>>20451562
New Eyes?
"Handle w/Care"
>Feb 2019? > Feb 2024? 5:_?
Q !!Hs1Jq13jV6 ID: 0c5740 No.9732889 📁
Jun 24 2020 14:11:28 (EST)
Worth remember - Feb 2019
https://www.theguardian.com/commentisfree/2019/feb/18/online-conspiracy-theorists-democracy
"The scale this generates is disproportional enough to distort public perception: In 2018, ISD identified close to 30m uses of the word “QAnon” across Twitter, YouTube and forums such as Reddit and 4chan."
Numbers today dwarf past estimates.
Handle w/ care.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451571
>>20451486
Putting AIO into practice is another matter though. IRL I've been a miserable excuse for a human being, but here I at least get a chance for a small measure of redemption for what I've squandered over the years.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
919a8d No.20451572
>>20450977
>>20451458
Trident missiles made by Lockheed Martin Space Systems USA.
Yay 'murican excepshionism at its best. Little wonder so much is made elsewhere in the world.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2d1cf8 No.20451573
>>20451504
>MUH JOO narrative
>If Q hadn't talked about the Rothschild control of the world, I wouldn't be here.
To say that Roths are a major power grabber on the global stage is not the same thing as saying that Jews run the world. Muh joos is about an obsession with Jews as the progenitors of all things evil. Or a coordinated effort to make it look that the majority of anons are anti-Jew, so Q supporters are discredited in the minds of the public.
Anons know about the Roths, the history of Israel, Soros color revolutions, etc. They are not naive. But also know about other power players, cover the entire gamut.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1432d6 No.20451574
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
089c73 No.20451576
>>20451481
TEMPUS EDAX RERUM
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3abe2b No.20451577
Illegal aliens kick em in the balls and then jackboot their necks.
MAGA patriots are ready for the largest DEPORTATION PROGRAM on the planet.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59d145 No.20451578
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451579
>>20451566
kek
stollen
not sure why though
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
038bcb No.20451580
>>20451247
>Disgraced Fmr. Mayor deBlasio no one
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451581
>>20451572
or maybe fail-safes (kill switches) were installed purposely to prevent idiots from blowing up the planet
guess we'll never truly know
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451582
FEBRUARY 21, 2024
Judiciary Committee Chair Jim Jordan on Biden Investigation and Alexander Smirnov Indictment
House Judiciary Committee Chair Jim Jordan speaks about the ongoing Biden investigation, James Biden’s deposition, and the recent indictment of ex-FBI informant Alexander Smirnov.
https://www.c-span.org/video/?533716-101/judiciary-committee-chair-jim-jordan-biden-investigation-alexander-smirnov-indictment
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59d145 No.20451584
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2d1cf8 No.20451587
>>20451581
brings to mind the UFOs sighted over missile installations, with missiles reportedly disarmed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451589
>>20451559
>Russian officials arrest Los Angeles woman on treason charges
>>20451565
Eleonora Srebroski
2 Following
Medium Staff
Medium Staff
News and updates from the staff at Medium.
Vandring Igelkott
Vandring Igelkott
> https://medium.com/@eleonorasrebroski/following
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
919a8d No.20451590
>>20451581
Yeah, I believe that Boeing doors don't fall off too.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
274913 No.20451593
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451594
>>20451589
>Eleonora Srebroski
>2 Following
6 Followers
Sergio Mitini
Sergio Mitini
Olenka Geyyer
Olenka Geyyer
Artist. Traveler. Storyteller. Mother. I create, feel, notice, and appreciate the world of ideas, joy, and magic.
Eleonora Srebroski
Eleonora Srebroski
Andrew Pishchulin
Andrew Pishchulin
Di Shi
Di Shi
Irina Golovina
Irina Golovina
> https://medium.com/@vandringigelkott/followers
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59d145 No.20451595
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
ARCHIVE THIS BREAD, ANONS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d95adb No.20451596
BREAKING: City Council calls for an INVESTIGATION of Mayor Adams plan to give illegals $10,000 Debit Cards.
https://twitter.com/TaraBull808/status/1760275672164184154
Mobility Capital Finance Inc. receives capital investment from Mastercard, expanding its partnership to bring affordable financial services to underserved communities
https://www.mastercard.com/news/press/2021/february/mobility-capital-finance-inc-receives-capital-investment-from-mastercard/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451600
21 Feb, 2024 15:00
British nuclear submarine test fails
An unarmed Trident missile splashed down into the Atlantic Ocean moments after being fired from a sub
The UK Ministry of Defence (MoD) has said an “anomaly” occurred during the test-firing of a Trident missile from aBritish nuclear submarine off the coast of the US state of Florida last month, raising concerns about the effectiveness of London’s nuclear deterrent.
The UK government confirmed on Wednesday that the drill – which reports say was observed by Defence Secretary Grant Shapps – had failed but insisted that the error was “event specific,” suggesting it would have been successful had it been carrying an actual nuclear warhead. (WTF?) The statement said no further details would be provided for reasons of national security.
UK tabloid The Sun, which first reported the story, said on Tuesday that the missile, which was fitted with fake warheads, splashed back into the ocean after its launch from HMS Vanguard. Thestate-of-the-art nuclear submarinewas not damaged when the58-ton missilere-entered the Atlantic Ocean.
According to the report, the “anomaly”occurred when the missile’sfirst-stage boosters failedto ignite after launch. “It left the submarine but it just went plop, right next to them,” the outlet quoted an anonymous source as saying.
Shapps added on Wednesday that “there are no implications for the reliability of the wider Trident missile systems and stockpile,” which he said “remains the most reliable weapons system in the world.”
Thelast Trident test in 2016 also failedwhen the missile veered off course, the BBC said, adding that each weapon comes at an estimated cost of £17 million ($21.5 million).
Following reports of January’s failure, Labour’s Shadow Defence Secretary John Healey wrote on social media on Tuesday that the event was “concerning” and called on the UK military leadership to “reassure parliament that this test has no impact on the effectiveness of the UK’s deterrent options.”
In his statement on Wednesday, Shapps said “the UK’s resolve and capability to use its nuclear weapons, should we ever need to do so, remains beyond doubt.” (OMG does anyone believe that?)
HMS Vanguard is one of four UK nuclear submarines – with at least one continually at sea. The American-made Tridents can strike targets up to 4,000 miles away and can travel in excess of 13,000mph, the UK Navy said.
Each Vanguard-class submarine can hold as many as 16 intercontinental ballistic missiles (ICBMs), eight Trident missiles, and up to 40 nuclear warheads.
(What is going on with UK two carrier battleships were disabled and couldn’t join NATO exercises and now their subs can’t shoot a Trident missile. UK went woke, now its going broke)
https://www.rt.com/news/592868-uk-trident-test-failure/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2baa66 No.20451602
>>20451582
>>20451582
>>20451582
SETTING UP TRUMP -Ain't it funny how the evidence of democrat collusion is all over the place but the old diaper faggot blabber mouth Chuck Grassley never does a damn thing same for Jim Jordan he never gets shit done either.
There is no two party system in Washington DC it's only one criminal SYNDICATE lying to the American people everyday.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451605
Are We There Yet
#25088 >>20450903
>>20450934 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery
>>20450942, >>20450959 Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.
>>20450950 Under the fog of war, Ukraine cancels its 2024 presidential elections
>>20450954 Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students…
>>20451017, >>20451025, >>20451026 Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
>>20451047 Massive farmer protest paralyzes Madrid, Spain.
>>20451071, >>20451078 Trucker Says Boycotting New York City Is Bigger Than Trump - Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE
>>20451103 Argentina under Milei: The Economy Ministry said: “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”
>>20451120 Liz Joy w/CAP: Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!
>>20451126, >>20451164 Air conditioned lawnmower, 1957
>>20451127 Q's 20 posts on Feb 21
>>20451146, >>20451179 Passive Radar for Opportunistic Monitoring in e-Health Applications
>>20451165 Panama Canal suffering major disruption
>>20451167 Lavrov comments on Russian favorite in race for White House
>>20451170 Remington CEO Cites ‘Legislative Environment’in New York as Company Moves to Georgia
>>20451178 Ahoy! The Ship Show & Extra Gravy
>>20451186, >>20451367 The Bee: New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels/moar
>>20451191 Bipartisan Group of US Senators flies to Hungary to bully Orban into approving NATO expansion and guess what? Hungarian politicians refuse to meet
>>20451204 Google’s Gemini AI Blasted For Eliminating White People From Image Searches
>>20451228 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
>>20451236 The PBOC released data today showing the amount of Chinese shares owned by overseas investors fell in 2023 for a second straight year
>>20451269 NASA Astronomy Picture of the Day Seagull Nebula over Pinnacles' Peak
>>20451272 10:00 AM EST NPC Headliners: Secretary of Energy Jennifer M. Granholm
>>20451286 Michigan wanted homeschool registry for warrantless home entry
>>20451293 10:00 AM EST Supreme Court October Term 2023 Argument Day
>>20451314 NASA Sets Coverage of First US Uncrewed Commercial Moon Landing
>>20451341 SEC closes Rumble investigation in latest regulatory clearance of global free speech platforms
>>20451344, >>20451346, >>20451354 #Truckers4Trump
>>20451347 10:00 AM EST WAR ROOM WITH STEVE BANNON
>>20451349 Alabama’s supreme court ruled embryos are ‘extrauterine children’. IVF patients are worried
>>20451360, >>20451421 Assange Trial Live
>>20451418 NASA’s New Horizons Detects Dusty Hints of Extended Kuiper Belt
>>20451429, >>20451435, >>20451441 A Tribute to Saint Alexei, Patron Saint of Liberal Democracy
>>20451471 A Stunning 10 Million Illegals Have Entered The US Under Biden; Tucker Warns They Are "Destroying" The Country
>>20451499 The Ingraham Angle Town Hall: President Donald Trump Hank Kimball
>>20451542 Russia tears up Soviet-era fishing agreement with UK
>>20451547 Elon announced last night that the X algorithm is going to change dramatically this week
>>20451557 D5 London: about D5 member countries
>>20451559, >>20451565, >>20451589 Eleonora Srebroski
>>20451569 NASA brings back retro 'worm' logo for upcoming Artemis 2 moon mission
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451606
Oh look, they're trying to normalize incest now. Article is 6 days old, not sure if it's been posted yet.
https:// www.economist.com/united-states/2024/02/15/cousin-marriage-is-probably-fine-in-most-cases
https:// www.economist.com/united-states/2024/02/15/cousin-marriage-is-probably-fine-in-most-cases
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a10c18 No.20451607
>>20451299
>Uses interpretive dance to convey a message
>Gets dragged all over an anonymous forum
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5fd294 No.20451609
>>20451396
why? evidence of US funded pedophilia is now frowned upon? GTFOH
Expose it ALL
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451610
>>20451589
>>20451594
> https://everloved.com/life-of/rosalie-neubeck/obituary/
In memory of
Rosalie Alice Neubeck
Pasadena, MD
June 13, 1944 - March 26, 2023
Heart (3) Red heart outline icon
Rosalie's obituary
Rosalie Neubeck, age 78, of Baltimore, Maryland, passed away due to renal cancer on March 26, 2023. She was born on June 13, 1944, in Baltimore, Maryland to the late Andrew Srebroski.
Rosalie attended Infant of Prague Catholic School in Baltimore, Maryland, where she graduated in 1962. She went on to become a successful Business Owner, and Real Estate Appraiser displaying her strong work ethic and passion for what she did.
Throughout her life, Rosalie was dedicated to her family and had a great love for Jazz music and traveling. She made it her life's goal to explore the beauty and cultures this world had to offer. Her kind and warm personality made her a joy to be around, always having something nice to say to those she encountered.
Rosalie is survived by her loving sister Mildred Arnold and brothers, Andrew andDonald Srebroski and sister in law Eleonora Srebroski.Nieces and nephews, and grand children. Her memory and spirit will live on in the hearts of those who love her, and she will always be remembered as a kind, generous, and loving sister and friend.
Details of a memorial service to celebrate Rosalie's life will be forthcoming. In lieu of flowers, the family requests that contributions in her memory be made to a charity of your choosing. Rest in peace, dear Rosalie, for your contributions will always be remembered, and your love will never be forgotten.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a10c18 No.20451611
>>20451606
3rd cousins is OK, actually.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20451612
>>20451609
Agree.
They made it illegal for people to look at evidence of their crimes.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2d1cf8 No.20451613
>>20451585
>They were calling Q antisemitic from Day 1. WTF are you talking about. The ADL has an entire page on how Q drops are antisemitic and "hate speech"
That's called a coordinated effort.
>Anons are people who like the Jews, people who hate the Jews, people who don't care, people who bury their heads in the sand, people who think Earth is flat, people who think Earth is round, people who believe in extraterrestrial life, people who don't.
The handful of posters who think Jews rule the world seek to gain converts for that POV. You outta know. KEK.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451618
>>20451587
what i recently found interesting was elon's brain chip controlling a computer mouse
thought to myself, wonder if that could be applied to a spacecraft
and if there does happen to be an advanced species that has a few million or even a billion years head start from our own then that could be a possibility given with how some react and seem to move with instantaneous thought
>>20451590
surely not on purpose
wouldn't be too difficult to sabotage seeing as how it's only to started happening recently, very recently
corporate espionage is a real thing too
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451620
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3652d No.20451621
>>20451598
you want to stop helping them.
first identify their system banking and how it works.
Do everything in your ow decision making and power to either eliminate or reduce the use and funding of their cage.
you time and your directed energy into this task while following the lessons of Jesus and the sermon on the mount is a good place to start.
One free soul at a time.
IN GOD WE TRUST
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451622
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451623
(Meme picture anons)
21 Feb, 2024 13:54
Ukrainians in EU ‘aren’t coming back’ – Kiev
PM Denis Shmigal says his country has lost a third of its economy and some 3.5 million jobs since the start of the conflict with Russia
Ukraine has lost a significant portion of its territory and has suffered major economic damage during the conflict with Russia, Prime Minister Denis Shmigal said on Tuesday. He claimed that most of the people who have left the country “are not coming back.”
In an interview with Japanese news channel NHK, Shmigal stated that Ukraine has lost “30% of its economy, some 20% of its territory, and 3.5 million jobs” in the past two years. In addition, 8,400 km of roads have been damaged and 2 million households affected by the fighting, according to the prime minister.
Shmigal further estimated thatmore than 10 millionpeople have been forced to leave their homes or flee the country altogether,predicting that many are unlikely to return.
“They are not coming back to Ukraine from the European Union, from all around the world, because of security issues,” the prime minister said, reiterating Kiev’s calls for more Western munitions. (Not security issues they don’t want to be dragged to the losing war, Kiev will never win.)
“We have support from all of our partners but unfortunately, production of ammunition all around the world, including the European Union, is not so high to bring needed amounts of ammunition to Ukraine,” Shmigal stated.
The comments come after Shmigal met on Monday with his Japanese counterpart, Fumio Kishida, who pledged Tokyo’s support to help rebuild the Ukrainian economy once the conflict with Moscow ends.
Shmigal said Japan had agreed to provide Kiev with $12.1 billion in aid, but did not elaborate on when or how the funding would be provided. Tokyo, meanwhile, stated it had pledged $105 million in new aid for Ukraine to fund demining work and emergency repairs in the energy and transport sectors.
Last year, Japan agreed to export its Patriot PAC-3 anti-aircraft missiles to the US, widely interpreted as a way for Tokyo to indirectly send military aid to Kiev. Moscow condemned the move, warning it would damage bilateral relations and have negative consequences for global security.
https://www.rt.com/russia/592859-ukrainians-not-coming-back/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
433042 No.20451624
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8a109 No.20451626
Dead, 5,000-pound satellite is falling to Earth today. Will any debris survive the fiery reentry?
Feb 21, 2024
A European Space Agency spacecraft is making an uncontrolled nosedive into Earth's atmosphere – with elements of the 2.3-ton spent satellite likely to survive the plunge into purgatory.
The exact time and place above Earth that the radar-scanning ESA European Remote Sensing (ERS-2) augers in is unknown, but a new prediction of the spacecraft's demise has been issued.
Using the most recent data, ESA's Space Debris Office predicted as of 6:30 a.m. EST (1130 GMT) on Wednesday (Feb. 21) that the reentry of ESA's ERS-2 satellite will take place at 10:41 a.m. EST (1541 GMT) on Wednesday (Feb. 21).
The uncertainty in this prediction is now just (+/- 1.44 hours), according to an ESA statement.
"This uncertainty is due primarily to the influence of unpredictable solar activity, which affects the density of Earth's atmosphere and therefore the drag experienced by the satellite," ESA adds.
Leftovers
As for the ERS-2 re-entry itself, there’s likely to be post-re-entry spacecraft leftovers.
"It is likely that some parts survive the re-entry, as on average between 10 and 20 percent of the mass for large objects does," says Simona-Elena Nichiteanu, a media relations officer in the communication department at the European Space Operations Centre (ESOC). ESOC serves as the main mission control center for ESA in Darmstadt, Germany.
Component survival
As for the ERS-2 component survival to Earth’s surface, Nichiteanu told Space.com that the biggest and heaviest fragments that might survive reentry into the atmosphere are the 4 tanks (heaviest), the 3 internal panels supporting instruments (largest cross section) and the Synthetic Aperture Radar (SAR) antenna structure (largest fragment assuming it does not fragment at all).
A vast majority of ERS-2 will "burn up" in the atmosphere, ESA experts explain. Furthermore, given that the Earth is largely ocean water-rich, chances are for splash down of any remaining spacecraft components.
Orbital debris regulation
The fall of ERS-2 can be viewed both as a calling card from space and a wake-up call.
"While the ESA should be lauded for its efforts to de-orbit the ERS-2, it should be unsurprising that a 2.3-ton satellite launched into Earth orbit without any enforceable orbital debris regulation will then return to Earth's atmosphere as orbital debris in an explosive uncontrolled reentry," said Michael Runnels, an assistant professor of business law at California State University, Los Angeles.
"Indeed, these events highlight the continuing need for enforceable orbital debris regulation to support the sustainable exploration and scientific investigation of outer space," Runnels said.
https://www.space.com/satellite-ers-2-esa-debris-prediction
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
274913 No.20451627
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451629
>>20451558
Father in Heaven, liberate this board, liberate the truth on this board, liberate your people on this board, all for your glory and a testimony that The Lord has done these things.
LIBERATE THE TRUTH ON THIS BOARD?
> YESTERDAY'S EVENTS? PROMISE KEPT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a285b0 No.20451630
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9bb10f No.20451633
>>20451610
>>20451610
What is the significance of posting an obituary?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451635
and there's the whole thing about the military having access to programs/technology that isn't released to the public until another 20, 30, 40 years after they've already perfected its use
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a10c18 No.20451637
>>20451345
It's comms.
>>20451607
>>20451624
Relax, it's pretty much how genetic disorders are prevented in… the entire animal kingdom. You anons are absolutely obsessed with reproduction rates in the US and the rest of the West. Well? Follow the leader. Iceland:
https://www.sciencedaily.com/releases/2008/02/080207140855.htm
https://abcnews.go.com/Health/ReproductiveHealth/story?id=4258128&page=1
https://www.foxnews.com/story/study-married-third-cousins-produce-more-children-grandchildren
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2d1cf8 No.20451638
>>20451286
You know the gov's going to have to go after home schooling and those who do it at some point. Can't have schooling outside the system. Those who do it are suspect.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451642
YouTube embed. Click thumbnail to play. >>20451628
(WE) WILL GET [THEM] ALL.
Promise.
God Wins.
Patriots FIGHT!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d95adb No.20451643
>>20451569
>The worm is going to the moon.
Sure it is.
Still trying to keep this lie going Jesuits/Masons?
The only light lucifer sees will be hell fire.
Followers beware.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20451645
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9bb10f No.20451646
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451647
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451648
>>20451559
>>20451610
Correction on Marriage
Apparently married in 2013
Still an anchor husband
> https://nypost.com/2024/02/20/world-news/treason-accused-us-russian-ksenia-karelinas-family-ask-for-help/
American family of Californian ballerina facing life in Russia for ‘treason’ plead for help freeing her
By Social Links for Isabel Vincent
Published Feb. 20, 2024
Updated Feb. 20, 2024, 7:50 p.m. ET
A dual US-Russian citizen being held in Russia on suspicion of treason for giving $50 to a Ukrainian charity had traveled there to spend New Year’s Eve with her family, The Post has learned.
Ksenia Karelina’s American mother-in-law and ex-husband are now pleading for help to have her freed and brought home to the US.
The 32-year-old amateur ballerina who manages a Beverly Hills spa, was first arrested in January by local police in her hometown of Yekaterinburg and accused of “petty hooliganism,” according to Russia’s ura.ru website.
But she was then charged with treason and held by the FSB, strongman president Vladimir Putin’s security service, before being paraded blindfolded and in handcuffs by masked security agents in a Russian courtroom Tuesday.
“The young woman was using coarse, obscene language in front of other citizens, was behaving rudely and defiantly,” court officials told the local news outlet.
When police were called, their arrival was said to have “riled” Karelina. She allegedly ignored the officers’ commands and violently resisted arrest.
On Jan. 29, Karelina was found guilty of hooliganism and sentenced to 14 days in jail.
Ksenia Karelina blindfolded by having a hat pulled down over her eyes with a man in uniform behind her.
She filed a complaint about her arrest the next day, but the court rejected it. She was then charged under Article 275 of Russia’s Criminal Code, which carries a prison term of 12 to 20 years.
Karelina now faces life in prison with the FSB alleging she donated $51.80 to Razom, a New York-based non-profit, and accusing her of being part of efforts to arm Ukrainian troops.
“Razom is appalled by reports that a U.S.-Russian dual national has been arrested by Russian authorities for purportedly making a charitable donation to Razom for Ukraine in the immediate aftermath of Russia’s full-scale invasion of Ukraine, said Dora Chomiak, Razom’s CEO in a statement to The Post. “Russian President Vladimir Putin has repeatedly shown that he holds no sovereign border, foreign nationality, or international treaty above his own narrow interest. His regime attacks civil society activists who stand up for freedom and democracy. Razom calls on the U.S. government to continue to do everything in its power to demand that President Putin release all those unjustly detained by Russia and to hold Russia’s political and military leadership accountable for their unprovoked invasion of Ukraine.”
It is unclear how they could know about any donations an American-based charity had received. A spokeswoman for the charity said they abide by privacy laws and do not share information about donors.
“Since February 2022, she has been proactively collecting funds in the interests of one of the Ukrainian organizations, which were subsequently used to purchase tactical medicine items, equipment, weapons and ammunition by the Armed Forces of Ukraine,” Russia’s Federal Security Service said in a statement.
Razom, which did not return a request for comment, raises money for programs including medical aid such as tourniquets, ambulances and hospital equipment for the war-torn country. There is no suggestion it pays for arms.
The State Department said officials will seek consular access to Karelina, who became a US citizen in 2021 and is the latest American to be held by Putin’s internal security services. State Dept. spokesman Matthew Miller said that Russia does not recognize dual citizenship.
“We are all in shock,” said Eleonora Srebroski, Karelina’s former mother-in-law in an interview with The Post Tuesday. “She is just a wonderful soul. She would never do anything evil to anyone.
“Knowing Ksenia, she would never do anything criminal. We are so worried because we are reading stories about [Alexei] Navalny’s supporters arrested for mourning him.
“Her mom and dad had recently divorced and she wanted to see the family,” said Srebroski, adding that Karelina has a younger sister in Russia.
She was supposed to be back by now. My son was calling her, and when we found out what had happened, we have all been in shock. He told me this morning ‘let’s think what we can do to help her.’ We don’t want to cause her any trouble.”
Srebroski said her son Evgeny married Karelina in 2013, a year after she first arrived in the US on a work/study trip from her hometown near the Ural Mountains in central Russia.
The couple, who were based in Maryland, divorced a few years ago,said Srebroski, and Karelina moved to California.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3652d No.20451650
>>20451639
no, but anon posted for those lurking.
somethings are directed at anons and lurkers not namefags.
btw, do not care to know you
faggot
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451651
>>20451648
>Correction on Marriage
>Apparently married in 2013
>Still an anchor husband
"Citizenship in 2021"
"divorced a few years ago"
Karelina studied dance at the Sergei Diaghilev Lyceum before graduating from Ural Federal University in 203, according to her social media profile, and remains a keen amateur, displaying her skill in a photoshoot on the Brooklyn Bridge and in Brooklyn’s Dumbo.
Dancing was a childhood hobby for her,” Srebroski said.
Meanwhile Isabella Koretz, boss at Ciel Spa where Karelina worked as a skincare specialist, paid tribute to her “beloved esthetician and friend” and called for her release.
“To know Ksenia is to love her and this heartbreaking news is so difficult to share but it must be done to spread her story and seek justice,” she said in a statement to The Post.
Karelina was arrested in the same city as Evan Gershkovich, the 32-year-old Wall Street Journal reporter whose arrest on charges of spying have drawn international condemnation of Putin’s assault on journalism.
The Moscow City Court rejected an appeal filed by Gershkovich’s lawyers against his detention Tuesday, upholding an earlier ruling to keep him in custody until March 30.
Karelina’s detention casts more light on Putin’s crackdown on dissent days after Russian authorities announced Navalny’s death in prison.
Navalny, Putin’s fiercest domestic critic, fell unconscious and died suddenly on Friday after a walk at the “Polar Wolf” penal colony above the Arctic Circle where he was serving a three-decade sentence, the prison service said.
But all signs point to him being poisoned, with the White House preparing Tuesday to unveil new sanctions on Putin’s regime after his death.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20451654
>>20451606
It makes family gatherings confusing though when uncle is grandpa, etc.
Look at the confusion in the Biden family.
Joe is the father of his grand daughter's baby.
So he's the baby's father and great grand father at the same time.
So does she call him Daddy or Great Grand Daddy?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451655
21 Feb, 2024 12:19
US parenting ‘influencer’ sentenced for child abuse
Ruby Franke was arrested last year after her malnourished and injured son asked a neighbor for food and water
AnAmerican mother of six whose parenting advice onlinedrew in more than two million subscribers on YouTube, was sentenced on Tuesday to at least four years in prison on charges of aggravated child abuse.
Franke, 42, who operated the now-deleted ‘8 Passengers’ video network online, was arrested last August in the US state of Utah whenher malnourished 12-year-old son escaped from the home of another woman– Jodi Hildebrandt, 54 – to ask a neighbor for food and water.
Thechild had been bound with duct tape and had visible open woundsas a result of being tied with rope, police records said. Hildebrandt, with whom Franke collaborated on a separate business venture, was handed an identical prison sentence of four terms of between one and 15 years each. Both had pleaded guilty in December to charges of second-degree aggravated child abuse.
Apologizing to her children following her sentencing, Franke said that she had “believed dark was light and right was wrong. I would do anything in the world for you. I took from you all that was soft, and safe and good.”
In her own statement, Hildebrandt said that she hoped the children could “heal physically and emotionally.”
During the trial last year, prosecutor Eric Clarke told the court that two ofFranke’s children had been forced to live in a “concentration camp-like setting” and were “regularly denied food, water, beds to sleep in,and virtually all forms of entertainment.”
Franke set up her ‘8 Passengers’ YouTube channel in 2015 and by last summer it had amassed 2.3 million subscribers – many of whom were drawn in by videos of Franke’s suburban family life.
However, some viewers became concerned in 2020 when one ofher sons said in a video that he had been sleeping on a bean bag for seven months. Other videos detailed Franke withholding food from her children and “canceling” Christmas as a punishment.
The ‘8 Passengers’ YouTube channel was deleted in 2022 – the same year that Franke separated from her husband, Kevin.
As part of a plea agreement, Hildebrandt – who collaborated withFranke in a series ‘life coaching’ videos– admitted that she was aware of the child abuse, and that she hadforced one of Franke’s children to “jump into a cactus multiple times.”
She added that Franke had told her children that they were “evil and possessed” and had to “repent.”
In a statement issued by his lawyer in advance of the trial last year, Kevin Franke called for the maximum sentence to be imposed on his former partnerover the “horrific and inhumane” abuse of his children.
https://www.rt.com/news/592848-us-youtube-influencer-jailed/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451656
YouTube embed. Click thumbnail to play. 12:00 PM EST
Former House Speaker Paul Ryan on What’s at Stake in 2024 Presidential Election
Washington Post Live
https://www.washingtonpost.com/washington-post-live/2024/02/21/former-house-speaker-paul-ryan-whats-stake-2024-presidential-election/
https://www.youtube.com/watch?v=bpY-gHikmdY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3652d No.20451657
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4eefbd No.20451659
>>20451290
God bless you too
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f2def4 No.20451660
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451662
>>20451646
This post is also vaticunt. AI GAY MAGA PAYTRIOT EX MILITARY. Federal Bureau of Instigation.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
932f46 No.20451663
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ab5a5 No.20451664
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58922c No.20451665
https://twitter.com/elonmusk/status/1760336029054271689
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3759a No.20451667
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8a109 No.20451668
USSF successfully concludes VICTUS NOX Tactically Responsive Space mission
Feb. 20, 2024
From acquisition to on-orbit operations, the historic mission set a new standard for Tactically Responsive Space, or TacRS, by demonstrating an end-to-end capability to rapidly respond to adversary aggression. From the time the mission was conceived, the VICTUS NOX team seamlessly executed each phase of the effort: Build, Hot-Standby, Activation, Alert, Launch, Initialization and On-orbit Operations.
“From the warehouse to on-orbit capability in a week. That’s tactically responsive,” said U.S. Space Force Chief of Space Operations Gen. Chance Saltzman during a fireside chat last October. “That is something that you can respond to irresponsible behavior on-orbit and the response is directly connected to that irresponsible behavior.”
The Build Phase culminated with a Flight Readiness Review less than one year after contracts were awarded to Firefly Aerospace and Millennium Space Systems, a Boeing Company. In that time, the spacecraft was pulled from an active production line, modified with an additional space domain awareness payload and readied for launch.
In addition, all of the normal processes associated with the launch of a satellite - such as spectrum assignment, or the process of assigning a particular frequency or band to a communications device; authority to operate approvals; and launch and space vehicle certifications - were completed. After the Build Phase was complete, the team entered the Hot-Standby Phase waiting on the call to activate.
On Sept. 8, 2023, the team was ordered to execute the Activation Phase and completed it within 57 hours, beating the 60-hour goal. After the call came, the team transported the spacecraft from the factory to the launch site payload processing facility, fueled the vehicle and conducted final testing. The mission then entered the Alert Phase.
On Sept. 13, 2023, with no prior notice, the Space Force provided the final orbit parameters and ordered the team to launch. The Launch Phase met its goal of being ready for launch within 24 hours, with liftoff taking place at the first available launch window, 27 hours after receipt of the launch order. After reaching orbit, it took only 37 hours to complete the Initialization Phase, once again beating the 48-hour goal. Once on-orbit operations began, the VICTUS NOX team quickly completed multiple maneuvers to conduct rendezvous and proximity operations and SDA.
The VICTUS NOX on-orbit operations team was comprised of members from multiple organizations across the Space Force. Personnel from the Space Delta 12’s (DEL 12) 3rd Test and Evaluation Squadron at Schriever Space Force Base led the initial on-orbit operations with a team to include members from Space Safari, the USSF’s Tactically Response Space lead; 20th Space Surveillance Squadron, a unit within Space Delta 2 (DEL 2) - Space Domain Awareness and Space Battle Management; and partners Millenium Space Systems and the Aerospace Corporation.
Additionally, the team received on-orbit tracking and collision avoidance support from DEL 2’s 18th Space Defense Squadron and 19th Space Defense Squadron at Peterson Space Force Base throughout the effort. DEL 2, one of nine mission deltas under Space Operations Command, leads the operational Space Domain Awareness mission on behalf of the Space Force and uses the Space Battle Management warfighting discipline to identify, characterize, and exploit opportunities and mitigate vulnerabilities in the national security space terrain.
“I couldn’t be prouder of the test and operational support the entire Space Delta 2 team provided for this game-changing mission,” said Col. Raj Agrawal, commander of DEL 2. “We quickly rose to the challenge and demonstrated that Tactically Responsive Space missions like VICTUS NOX are capable of meeting urgent combatant commander needs on tactically relevant timelines during Great Power Competition.”
After the initial on-orbit objectives were complete, Space Safari concluded the mission with SDA operations in the spacecraft’s final orbit. USSF/SSC missions are purposely designed to include end-of-life disposal for satellites, in order to reduce orbital debris and keep space accessible for all.
“Achieving VICTUS NOX’s ambitious objectives was truly a team effort,” said Lt. Col. MacKenzie Birchenough, Space Safari materiel leader. “We were fortunate to have such skilled Space Force and industry partners who executed each phase with expertise and ultimately ensured mission success.”
VICTUS NOX has laid a significant foundation that the U.S. Space Force will continue to build upon in order to normalize TacRS operations. The next demonstration, VICTUS HAZE, is expected to be awarded in the coming weeks.
https://www.spaceforce.mil/News/Article-Display/Article/3680689/ussf-successfully-concludes-victus-nox-tactically-responsive-space-mission/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451670
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451671
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fc731b No.20451672
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451674
>>20451665
kek, better late then never
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451675
Last Call For We Have It All
#25088 >>20450903
>>20450934 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery
>>20450942, >>20450959 Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.
>>20450950 Under the fog of war, Ukraine cancels its 2024 presidential elections
>>20450954 Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students…
>>20451017, >>20451025, >>20451026 Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
>>20451047 Massive farmer protest paralyzes Madrid, Spain.
>>20451071, >>20451078 Trucker Says Boycotting New York City Is Bigger Than Trump - Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE
>>20451103 Argentina under Milei: The Economy Ministry said: “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”
>>20451120 Liz Joy w/CAP: Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!
>>20451126, >>20451164 Air conditioned lawnmower, 1957
>>20451127 Q's 20 posts on Feb 21
>>20451146, >>20451179 Passive Radar for Opportunistic Monitoring in e-Health Applications
>>20451165 Panama Canal suffering major disruption
>>20451167 Lavrov comments on Russian favorite in race for White House
>>20451170 Remington CEO Cites ‘Legislative Environment’in New York as Company Moves to Georgia
>>20451178 Ahoy! The Ship Show & Extra Gravy
>>20451186, >>20451367, >>20451596 The Bee: New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels/moar
>>20451191 Bipartisan Group of US Senators flies to Hungary to bully Orban into approving NATO expansion and guess what? Hungarian politicians refuse to meet
>>20451204 Google’s Gemini AI Blasted For Eliminating White People From Image Searches
>>20451228 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
>>20451236 The PBOC released data today showing the amount of Chinese shares owned by overseas investors fell in 2023 for a second straight year
>>20451269 NASA Astronomy Picture of the Day Seagull Nebula over Pinnacles' Peak
>>20451272 10:00 AM EST NPC Headliners: Secretary of Energy Jennifer M. Granholm
>>20451286 Michigan wanted homeschool registry for warrantless home entry
>>20451293 10:00 AM EST Supreme Court October Term 2023 Argument Day
>>20451314 NASA Sets Coverage of First US Uncrewed Commercial Moon Landing
>>20451341 SEC closes Rumble investigation in latest regulatory clearance of global free speech platforms
>>20451344, >>20451346, >>20451354 #Truckers4Trump
>>20451347 10:00 AM EST WAR ROOM WITH STEVE BANNON
>>20451349 Alabama’s supreme court ruled embryos are ‘extrauterine children’. IVF patients are worried
>>20451360, >>20451421 Assange Trial Live
>>20451418 NASA’s New Horizons Detects Dusty Hints of Extended Kuiper Belt
>>20451429, >>20451435, >>20451441 A Tribute to Saint Alexei, Patron Saint of Liberal Democracy
>>20451471 A Stunning 10 Million Illegals Have Entered The US Under Biden; Tucker Warns They Are "Destroying" The Country
>>20451499 The Ingraham Angle Town Hall: President Donald Trump Hank Kimball
>>20451542 Russia tears up Soviet-era fishing agreement with UK
>>20451547 Elon announced last night that the X algorithm is going to change dramatically this week
>>20451557 D5 London: about D5 member countries
>>20451559, >>20451565, >>20451589, >>20451648 Eleonora Srebroski
>>20451569 NASA brings back retro 'worm' logo for upcoming Artemis 2 moon mission
>>20451582 Judiciary Committee Chair Jim Jordan on Biden Investigation and Alexander Smirnov Indictment
>>20451600 An unarmed Trident missile splashed down into the Atlantic Ocean moments after being fired from a sub
>>20451655 US parenting ‘influencer’ sentenced for child abuse, Ruby Franke
>>20451656 12:00 PM EST Former House Speaker Paul Ryan on What’s at Stake in 2024 Presidential Election/uniparty panic n blather
>>20451668 USSF successfully concludes VICTUS NOX Tactically Responsive Space mission
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451677
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43f0f8 No.20451678
man, nothing says you're a legitimate anon more than ip hopping and spamming /s
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451679
>>20451496
o7
Do you remember? Date?
10/28/23 (Sat) 06:13:58 c77877 (47) No.19816555
https://8kun.top/qresearch/res/19815876.html#19816555
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
024508 No.20451682
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
024508 No.20451684
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbc18d No.20451686
>>20451610
>>20451610
>In memory of
>Rosalie Alice Neubeck
>Pasadena, MD
>June 13, 1944 - March 26, 2023
>Heart (3) Red heart outline icon
>>20451633
Andrew Srebroski Sr.
Birth
20 Jan 1913
Death
15 Aug 1999 (aged 86)
Burial
Holy Cross Cemetery
Brooklyn Park, Anne Arundel County, Maryland, USA Show Map GPS-Latitude: 39.2105972, Longitude: -76.6188444
Memorial ID
240709437 · View Source
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451687
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59821f No.20451688
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451689
>>20451675
this post @610
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451692
State Department defends Blinken memo urging staffers to avoid 'problematic' language like 'manpower'
Memo urges staffers to avoid phrases like 'brave men and women' in favor of more gender-neutral words
By Emma Colton Fox News
Published February 20, 2024
The State Department defended a memo from Secretary of State Antony Blinken this month that urged staffers to steer clear of gendered language suchas "mother" and "manpower."
"If you look at that memo, as I have done, it's a standard government practice to try to encourage people to just to be respectful of others, and use the terms with which others are comfortable, and talk to people the way that they would like to be addressed. And nothing more than that," State Department Spokesperson Matthew Miller said Tuesday during a press briefing.
Miller was reacting to reports of Blinken sending a memo titled "Modeling DEIA: Gender Identity Best Practices," that aimed to "increase understanding of gender identity and provide guidance on gender identity language and best practices that support an inclusive work environment."
"When speaking,avoid using phrases like ‘brave men and women on the front lines,’" Blinken's Feb. 5 cable, which was first obtained by the National Review, said. Instead, State staffers should "use more specific language such as ‘brave first responders,’ ‘brave soldiers,’ or ‘brave DS agents.’"
Miller said that though the memo had Blinken's name on it, it did not necessarily come directly from the Secretary of State.
"When it comes to these types of cables, they all come out with the Secretary's signature on it. That's the standard department practice, has been for years. It doesn't mean that it's necessarily a memo from the secretary himself," he said.
The guidance runs through a list of gendered phrases and words that should be avoided, including: "manpower," "you guys," "ladies and gentlemen," "mother/father," "son/daughter" and "husband/wife." Instead, the memo urged staff to use "labor force," "everyone," "folks," "you all," "parent," "child," "spouse" or partner,"according to the report.
Use "gender-neutral language whenever possible" to "show respect and avoid misunderstandings," the guidance continued, and encouraged employees to include their preferred pronouns in emails or during meetings.
The cable also cautioned employees against assuming someone’s gender based on how they look or their name, as that "can be problematic" and can send a "harmful, exclusionary message."
The State Department is charged with advising the president on foreign policy, as well as negotiating agreements with other nations. The memo was published as the U.S. grapples with ongoing wars raging between Ukraine and Russia, as well as the war in Israel, and just days after the U.S. launched strikes on Iranian-backed militants following the deaths of three American service members.
The memo added that staffers should not "pressure someone to state their pronouns," as it is "a personal decision that should be respected." If a staffer uses the wrong pronoun, Blinken's memo asked that they handle the situation with "subtlety and grace," while noting identity "may be fluid, so remain attuned to and supportive of shifts in pronouns."
Other agencies under the Biden administration have rolled out guidance on inclusive and non-gendered language, including pronoun guidance for the Department of Health and Human Services that was slammed by an expert last year as violating employee rights and speculating it would lead to firings for "misgendering."
(No wonder foreign countries hate our leaders)
https://www.foxnews.com/politics/state-department-defends-blinken-memo-urging-staffers-avoid-problematic-language-manpower
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451693
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ff7395 No.20451695
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f58354 No.20451696
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451697
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20451698
>>20451671
Jews just want to eliminate all non-Jewish White people.
Then they will declare themselves Lords & Master of all POC.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3759a No.20451699
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451700
Fear is real.
Over the target.
ANONS UNITED!
PATRIOTS FIGHT!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
37bb9d No.20451702
>>20451546
my church IS the security team.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451703
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
253aca No.20451704
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ad1725 No.20451705
>>20451699
We gave them the keys to the Lambo. TAKE THEM BACK.
Lamp-post-it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2d95d No.20451706
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
70b779 No.20451707
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451708
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451709
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b68f8e No.20451711
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451712
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b68f8e No.20451714
>>20451290
Mornin', Swordy!
Blessings upon you & yours, anons, Q Team, and operators in the field.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451715
Memes prep.
Music prep.
Organize.
Unite.
Prepare.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
61d1b0 No.20451716
>>20450903
I am guessing she's ugly AF
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451717
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e5f99 No.20451719
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451720
YouTube embed. Click thumbnail to play. >>20451706
While Assange was using stolen cables to selectively leak against republicans, a wikileaks insider stole the Hillary cables and then released them. Here is the emergency call Assange gave to none other than Hillary Clinton lawyer famous for stealing elections and being a mobster, Marc Elias. I don't think Assange can count on republicans freeing him.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0bfff No.20451721
>>20451616
>Confirm.
>GREEN.
Godspeed.
https://www.theguardian.com/uk-news/2017/nov/18/helicopter-pilot-killed-in-mid-air-crash-named-as-mike-green
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451724
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2d95d No.20451725
>>20451712
Sorry just a screen grab and don't have acct.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451727
>>20451721
this post @644
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451728
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c70d88 No.20451731
>>20451706
I'm not disagreeing that the DoJ is completely broken and the last thing that department cares about is justice, but I will say that the role Mr. Assange has played is clearly understood. I think it's similar to misunderstanding Mr. Snowden.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451733
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451734
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c70d88 No.20451735
>>20451731
"isn't clearly understood" … my bad; need caffeine.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20451736
Surprise, surprise,
according to the Jews,
antisemitism is on the rise.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
182f58 No.20451737
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451738
Play stupid games.
Win stupid prizes.
These people are stupid. REALLY DUMB.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac201b No.20451739
Tennessee firm illegally employed minors to clean meat saws, head splitters at slaughterhouses, Labor Dept. says
Fayette Janitorial LLC employed 15 children to clean dangerous equipment at a Perdue Farms plant in Virginia and nine to clean a Seaboard Triumph Foods pork plant in Iowa.
Feb. 21, 2024, 11:29 AM
Another industrial slaughterhouse cleaner has been accused by the U.S. Labor Department of illegallyemploying children as young as 13 to clean dangerous equipment on overnight shifts, according to a temporary restraining order filed in federal court Wednesday.
The Labor Department said that Tennessee-basedFayette Janitorial LLC illegally employed 15 children to clean a Perdue Farms poultry plantin Virginia and nine to clean a Seaboard Triumph Foods pork processing plant in Iowa. They cleaned such equipment as head splitters and meat bandsaws. Fayette has 600 employees in 30 states, according to the company’s website.
Children under the age of 18 are not allowed to work in slaughterhouses because the work is considered by the federal government to be too dangerous.
Last summer, a 16-year-old migrant was killed at a Mississippi slaughterhouse when he was sucked into a machine that he was cleaning.
“Federal laws were established decades ago to prevent employers from profiting from the employment of children in dangerous jobs, yet we continue to find employers exploiting children.” said Jessica Looman, administrator of the Labor Department’s Wage and Hour Division. “As we’ve unfortunately seen in this case, employers’ violations of federal child labor laws have real consequences on children’s lives. Our actions to stop these violations will help ensure that more children are not hurt in the future.”
NBC News was thefirst to report that in October, FBI agents discovered dozens of children workingat a Kidron, Ohio, chicken plant called Gerber’s Poultry that had contracted with Fayette for sanitation.Most of the children are from Guatemala.
At the time, Gerber’s Poultry said in a statement, “We were surprised to learn that our Kidron, Ohio, plant is the subject of inquiry from federal law enforcement regarding the composition of our employees and some third-party contract employees. We are fully cooperating with that investigation. While we have confidence in our process to ensure we comply with all federal regulations to verify eligibility for employment, we are actively reviewing our policies to ensure compliance at every level and will continue to review our relationships with third party vendors and their policies in similar fashion.”
Fayette has also been scrutinized for serious safety violations by the Labor Department’s Occupational Safety and Health Administration, including an incident atGerber’s Poultry in July 2022when a worker became trapped in a conveyor belt.
OSHA cited Fayette Janitorial for failing to ensure its employees followed proper procedures by making sure machines were turned off. Fayette paid a $13,052 penalty, according to the OSHA enforcement page. The agency lists the accident as an amputation incident on its website. Fayette is the second large slaughterhouse cleaner found by the Labor Department to have employed children.
In 2023, the Labor Department found the national company Packers Sanitation Services Inc. had hiredmore than 100 children in 13 locations. The company paid a $1.5 million civil penalty.
In response to the Labor Department investigation, PSSI said in a statement, “PSSI has an absolute zero-tolerance policy against employing anyone under the age of 18 and is fully committed to ensuring it is enforced at all local plants.”
Overall, the Labor Department reports a 152% increase in children illegally employed by companies since 2018 (lie started in 2021). Many of them are Central Americans who came to the U.S. as unaccompanied minors. More than300,000 children, most from Guatemala and Honduras, have entered the U.S. by themselves in the past three years, according to the Department of Health and Human Services.
https://www.nbcnews.com/politics/immigration/fayette-janitorial-hired-minors-clean-meat-saws-slaughterhouses-labor-rcna139655
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451740
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451741
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451742
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d05eda No.20451743
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451744
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451745
Anons are Ready.
CLEAR DAYS.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451746
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451747
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451748
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c8015c No.20451749
>>20451278
>>20451295
Their God isn't paper.
They foist paper on the people in an attempt to make paper the people's God.
Their 'god' is Satan.
"The NWO worships Satan" - Q
READ THE DROPS PUNK BITCH
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3652d No.20451750
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c8015c No.20451751
AND DON'T MAKE NIGHT SHIFT PULL YOUR STUPID FUCKING CARD!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451752
Blackrock Castle, Cork 🇮🇪 1582-1604 AD
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451753
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451754
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451755
>>20451747
AND HE STILL IS!
#FinalBattle
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
70b779 No.20451756
>>20451712
https://twitter.com/RandyRRQuaid/status/1760279746774966689
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7c3517 No.20451757
Anon is seeing moar and moar Chinese operatives out and about with masks on. This must mean the next CCP biological attack is underway. Stands to reason since this is an election year.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451758
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2fd904 No.20451760
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451761
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d05eda No.20451763
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451764
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451765
>>20451761
dig those sox yo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451766
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451767
>>20451706
>>20451756
TY ANON.
notable!
Randy Quaid
@RandyRRQuaid
Because of its treatment against Assange and the many innocent Americans who went to DC simply to support Trump the American DOJ is now akin to any other terrorist organization in the world.
7:26 AM · Feb 21, 2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94b5ca No.20451769
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
61d1b0 No.20451770
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451771
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451772
Let's see what happens next.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d678c No.20451773
Sa·tan ˈsā-tᵊn
Synonyms of Satan
1
: the angel who in Jewish belief is commanded by God to tempt humans to sin, to accuse the sinners, and to carry out God's punishment
2
: the rebellious angel who in Christian belief is the adversary of God and lord of evil
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
610005 No.20451774
https://8kun.top/qresearch/res/20449058.html#20449121
Might as well rename Columbia, Missouri as Sodom or Gomorrah and yell at God and ask Him what's He going to do about it?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451775
Gonna play it smart, BO? Gonna Remain CLAM? Or are you going to take the bait? Nobody escapes. Criminals > PRISON.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2067f No.20451776
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451777
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d05eda No.20451778
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
effe68 No.20451779
>>20451768
How about the
Chabad Intelligence Agency
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451780
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
26605b No.20451781
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e13dc1 No.20451782
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
024508 No.20451783
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94b5ca No.20451784
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e251ca No.20451785
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451786
>>20451781
FOR GOD & COUNTRY!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451787
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e78884 No.20451788
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d05eda No.20451789
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3652d No.20451792
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d678c No.20451793
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
20e0d0 No.20451794
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e251ca No.20451795
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451796
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
490942 No.20451797
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c92a80 No.20451798
>>20451172
Anon no longer carries a concept of plausible ‘success’ to save America from the ‘precipice’. Even if by some miracle all the criminals in government (90+%) were somehow removed, such addicted to lies and manipulation will just be spilling onto the streets and zombie-up with millions and millions of other incurable citizen-zombies likewise chronically addicted to lies and deception. I can’t see such people readily assimilating back into honest ‘civilization’. That’s seems a lot more than 4-6%
Maybe I’m missing something and completely wrong. Ijdfk
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451799
Haz It All Final
#25088 >>20450903
>>20450934 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery
>>20450942, >>20450959 Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.
>>20450950 Under the fog of war, Ukraine cancels its 2024 presidential elections
>>20450954 Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students…
>>20451017, >>20451025, >>20451026 Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)
>>20451047 Massive farmer protest paralyzes Madrid, Spain.
>>20451071, >>20451078 Trucker Says Boycotting New York City Is Bigger Than Trump - Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE
>>20451103 Argentina under Milei: The Economy Ministry said: “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”
>>20451120 Liz Joy w/CAP: Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!
>>20451126, >>20451164 Air conditioned lawnmower, 1957
>>20451127 Q's 20 posts on Feb 21
>>20451146, >>20451179 Passive Radar for Opportunistic Monitoring in e-Health Applications
>>20451165 Panama Canal suffering major disruption
>>20451167 Lavrov comments on Russian favorite in race for White House
>>20451170 Remington CEO Cites ‘Legislative Environment’in New York as Company Moves to Georgia
>>20451178 Ahoy! The Ship Show & Extra Gravy
>>20451186, >>20451367, >>20451596 The Bee: New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels/moar
>>20451191 Bipartisan Group of US Senators flies to Hungary to bully Orban into approving NATO expansion and guess what? Hungarian politicians refuse to meet
>>20451204 Google’s Gemini AI Blasted For Eliminating White People From Image Searches
>>20451228 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
>>20451236 The PBOC released data today showing the amount of Chinese shares owned by overseas investors fell in 2023 for a second straight year
>>20451269 NASA Astronomy Picture of the Day Seagull Nebula over Pinnacles' Peak
>>20451272 10:00 AM EST NPC Headliners: Secretary of Energy Jennifer M. Granholm
>>20451286 Michigan wanted homeschool registry for warrantless home entry
>>20451293 10:00 AM EST Supreme Court October Term 2023 Argument Day
>>20451314 NASA Sets Coverage of First US Uncrewed Commercial Moon Landing
>>20451341 SEC closes Rumble investigation in latest regulatory clearance of global free speech platforms
>>20451344, >>20451346, >>20451354 #Truckers4Trump
>>20451347 10:00 AM EST WAR ROOM WITH STEVE BANNON
>>20451349 Alabama’s supreme court ruled embryos are ‘extrauterine children’. IVF patients are worried
>>20451360, >>20451421 Assange Trial Live
>>20451418 NASA’s New Horizons Detects Dusty Hints of Extended Kuiper Belt
>>20451429, >>20451435, >>20451441 A Tribute to Saint Alexei, Patron Saint of Liberal Democracy
>>20451471 A Stunning 10 Million Illegals Have Entered The US Under Biden; Tucker Warns They Are "Destroying" The Country
>>20451499 The Ingraham Angle Town Hall: President Donald Trump Hank Kimball
>>20451542 Russia tears up Soviet-era fishing agreement with UK
>>20451547 Elon announced last night that the X algorithm is going to change dramatically this week
>>20451557 D5 London: about D5 member countries
>>20451559, >>20451565, >>20451589, >>20451648, >>20451686 Eleonora Srebroski
>>20451569 NASA brings back retro 'worm' logo for upcoming Artemis 2 moon mission
>>20451582 Judiciary Committee Chair Jim Jordan on Biden Investigation and Alexander Smirnov Indictment
>>20451655 US parenting ‘influencer’ sentenced for child abuse, Ruby Franke
>>20451656 12:00 PM EST Former House Speaker Paul Ryan on What’s at Stake in 2024 Presidential Election/uniparty panic n blather
>>20451668 USSF successfully concludes VICTUS NOX Tactically Responsive Space mission
>>20451692 State Department defends Blinken memo urging staffers to avoid 'problematic' language like 'manpower'
>>20451739 Tennessee firm illegally employed minors to clean meat saws, head splitters at slaughterhouses
#25088
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
20e0d0 No.20451801
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451803
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e251ca No.20451804
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
acd6f9 No.20451806
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2a2671 No.20451807
>>20451798
think mirror 4-6% remain
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b18021 No.20451808
>>20451386
We know?
now?
7 years after the fact?
the story was dated 2017, before Q was in the picture.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f2def4 No.20451809
>>20451804
Yet many Christians consider the flesh evil.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451810
>>20451792
[W]E
[A]RE
[R]EADY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
610005 No.20451813
>>20451778
Not exactly, Jesus spoke to the religious leaders of the time, that they had forgotten that Abraham had believed God, and it was reconed to him as righteousness. Satan would have 1 of 2 things first and foremost in peoples minds: 1 evolution provs that God does not exist, and 2 self-actualization is the key to success. Jesus, on the other hand would 2 opposite things on the minds of His followers: 1 Love God the Father with all your heart, soul, and all your strength and 2 Love you neighbor as you love yourself. The war between good and evil is the testing ground where each individual chooses where they want to spend eternity. Now is the time to accept the grace offered by faith in Jesus, as none of us know when we will meet Jesus face to face to answer for our deeds on this earth.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d05eda No.20451815
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed7101 No.20451818
Fresh
>>20451800
>>20451800
>>20451800
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451821
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e251ca No.20451823
>20451796
Slaves succumb to despair - usually the ones who can't bring themselves to enslave others.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f2def4 No.20451824
>>20451813
>evolution provs that God does not exist
No it doesn't, not at all. He creates evil and forms the good. Evolution does not disprove God, it just calls into question the "creation story" which is not what people think it is but parable.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451827
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451828
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451829
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451831
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451833
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
894fea No.20451834
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451835
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451836
>>20451818
Anons will be the judge of that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451838
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451839
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451841
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451842
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451845
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
610005 No.20451846
>>20451373
are you talking about the time a sub tried to take out POTUS? if so, this is the CYA cover story to save someones hide when Trump is back in the white house. Not gonna work. NCSWIC
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aced38 No.20451849
>>20451093
Specific's in the information leads me to believe this was not accidental at all
12 fired, 4 shot down?
Very Suspect
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451850
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ba216 No.20451851
>>20450963
>Biden heads to $250,000-a-head fundraiser to tap Hollywood elites…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4bf96c No.20451853
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2d95d No.20451854
>>20451809
Yet w/o the Holy Spirit understanding these things is not possible.
The invitation and gift is free.
One of satan's titles is the accuser.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aa310d No.20451855
>>20450977
>Trident plop
I wonder if it had the upgrades that were installed during Trump's first four years
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e46c96 No.20451858
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451860
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10bdc9 No.20451861
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f62dd0 No.20451863
>>20451290
Back at ya, Swordy.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0483ad No.20451864
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b18021 No.20451915
>>20451809
you don't know Christians it seems.
it's not flesh, anon, but the lust for it.
People have flesh, so you're saying flesh is evil? Thus you conclude that people are evil.
sad for you to think that Christians think that other people are evil.
very sad you don't understand.
maybe if you knew the real truth you'd figure out some things.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.