2ef6f6 No.20448278 [Last50 Posts]
Welcome to Q Research General
We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.
"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."
VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH
Q's Latest Posts
>>18284019 Nov. - Dec. 2022
Q's Private Board
>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6
Find Q drops here
Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku
Q Posts Archives
* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u
* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app
* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news
* Q Raw Text Dumps: q-clock.com/q_raw.txt
* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/
* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188
* Q Research Notables: Archive Board >>>/qnotables/
* Q Adjacent infographs and moar: https://deepstatemappingproject.com/
Q Research Board
Key Resources below. Check Dough Resource thread for more: >>17225239
New to QR?
>>17240320 Welcome to Q Research | >>20424387 Board Info
Join Us
>>17322509 LEARN TO BAKE | >>17322518 E-BAKE Instructions
>>20440436 MEME WARRIOR UI 1.2 updated Feb 19, 2024 NEW
Threads
>>17253611 Dedicated Resource Threads
>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon
TOR Access
TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html
TOR Banner: https://www.youtube.com/watch?v=MLCupx1UExg
____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448281
International Q Research Threads
>>20092798 ——–——– Australia #34
>>20362754 ——–——– Canada #53
>>16694358 ——–——– France #7
>>19988670 ——–——– Germany #106
>>20187083 ——–——– Japan #21
>>16694250 ——–——– Nederland #10
>>17784579 ——–——– QAJF #1
>>20038152 ——–——– Scotland #9
>>19636057 ——–——– South Africa #12
>>19804572 ——–——– UK #51
GLOBALS
Bunker = https://endchan.org/qrbunker/catalog.html
>>20022853 Posting Guidelines
>>19832150, >>19957123, >>19737197 SPAM Removal; >>20184855 Jim W. on spam
>>19089056 Ban lifts, video downloads, Q clock, Joe M's videos, Qagg Download
>>18024378, >>18561054 Updated PROTO Instructions
>>20186509 How to filter namefags
Bakers:
>>19089065 Baking Tools & Guidelines - NEW BAKERS, PLEASE READ
>>17322509, >>17322518 How to bake/e-bake
>>17835052 Formatting Q posts
>>20186534 No "Muh Joos" in notes. Discrimination based on race or religion will be removed
Plz sign out clearly when e-baking or ghosting, use RED TEXT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448282
NOTABLES ARE NOT ENDORSEMENTS
#25084 >>20447499
>>20447605, >>20447833, >>20447891 Planefags
>>20447611, >>20447618, >>20447649, >>20447747, >>20447758, >>20447780, >>20447983, >>20448013 Mil tweets
>>20447615 NYC Trump ruling draws strong backlash
>>20447651 IRS Asks Americans to Report Income From 'Illegal Activities'
>>20447659 The ‘Wolf of Wall Street’: Trump ‘will win’ in NY somehow
>>20447663, >>20447664 Famous fossil is really just paint, rocks and a couple of bones, researchers say
>>20447676 The Great Red Dragon: The Foreign Money Power in The United States (1890) L.B. Woolfolk
>>20447684 DJT: Town Hall with Donald Trump and Laura Ingraham tonight @ 7PM EST
>>20447716 Accurate reporting from CNN
>>20447746, >>20447761, >>20447783, >>20447811 Everything You Need To Know About The Motions To Disqualify Fani Willis
>>20447772 A new study has concluded sex change surgeries 'do not have an impact on suicide risk'
>>20447815, >>20447778 New York Moves to Begin Vaccinating Children Without Parental Consent
>>20447860 Growing Trend sees local and state law enforcement facilities listing Black and Hispanic offenders race as White
>>20447909 17 goals were scored between the Minnesota Wild and the Vancouver Canucks - this has not happened in a game since 1982
>>20447926 NSA announces the retirement of Rob Joyce, the Director of Cybersecurity and the Deputy National Manager, National Security Systems
>>20447944 (2023) Elon Musk claims the US government had 'full access' to private Twitter DMs
>>20447949 Kyrsten Sinema has spent over $200k of your money on private jets
>>20447955 A plan by President Joe Biden, called an “extortion attempt,” would shield more criminal illegal aliens from deportation
>>20447978 VTA prepares abandoned fleet for auction to recover taxpayer dollars after NBC Bay Area investigation
>>20447992 Some notes from today's KJP press conference
>>20447998, >>20448091, >>20447956 2 adults are charged with murder in the deadly shooting at Kansas City’s Super Bowl celebration
>>20448000 Donald Trump is Right about NATO
>>20448012, >>20448235 The actual crazy shit: Meryl Nass @ EU Parliament
>>20448014, >>20448057 .@realDonaldTrump is wheels down at Greenville-Spartanburg International Airport, in the Great State of SC…
>>20448025, >>20448092 Red Cross Faces Scrutiny as it Requires COVID-19 Vaccinated to Call Hotline to See if They’re Eligible for Blood Donation
>>20448044 Global operation smashes ‘most harmful cyber crime group’
>>20448051 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
>>20448055 Tucker Carlson says Boris Johnson wants "a million dollars" from him to talk about Ukraine
>>20448056 3 KFC locations in Chicago join other businesses leaving due to rampant crime
>>20448065 Stella Assange on Julian Assange’s Hearing today - The Same Country Trying to Extradite him Tried to murder Him
>>20448070 Rep. Eric Swalwell spent millions of dollars in campaign funds on his own childcare costs, Four Seasons steakhouses + moar
>>20448071 Body of missing 11-year-old Audrii Cunningham found in river
>>20448076 Government-Backed Censors Who Rigged The 2020 Election Are Now Stealing 2024
>>20448081, >>20448120 What is a FISA?
>>20448082 Trump Truths the Eighth
>>20448089 Nevada’s Democrat Secretary of State Claims ‘Glitch’ Caused Unmailed Nevada Ballots to Show Up as Counted in Recent Primary
>>20448093 Former Obama CIA Chief Michael Morell Donates To Nikki Haley
>>20448098 "Pay your fair share, unless you're my children" -Joe Biden
>>20448100 ‘The Biggest Loser’ trainer and former boxer launches NY Senate bid to knock out Kirsten Gillibrand
>>20448108, >>20448114, >>20448119 ‘I’m Not Going Anywhere’: Haley Vows to Stay in Presidential Race Regardless of South Carolina Results
>>20448110, >>20448117, >>20448133, >>20448156, >>20448183 Opus Dei
>>20448128 CCP invaders using StarLink to use AliBaba in the jungle of Panama to organize their invasion of America and make financial transactions
>>20448132 E. Jean Carroll's Lawyer Says They're Looking to Sue Trump a 3rd Time
>>20448189 Did You Know Alexandria Ocasio-Cortez Was Elected Thanks To A Casting Call Put Out By Democrats?
>>20448196 The Mayor of City of North Las Vegas announces the city will discriminate against white business owners
>>20448200 French government prepared to arrest those who reject 'medical knowledge'
>>20448213 O'Keefe: The @UUCTucson has completely locked down their website
>>20448253 Video shows brazen broad-daylight NYC Gucci store heist — as bandits make daring getaway with $51K in luxury items
>>20448262 Japan has officially lost its spot as the world's third largest economy to Germany, per Bloomberg
>>20448270 #25084
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448284
#25083 >>20446656
>>20446697, >>20446796, >>20446803, >>20446768, >>20446864, >>20446991, >>20447117 Planefag
>>20446711 Russia making moves in Latin America as FM Sergey #Lavrov paid a visit to #Cuba
>>20446750 Everything You Need To Know About The Motions To Disqualify Fani Willis
>>20446770 Time to Recall Members of Congress
>>20446774, >>20446829, >>20447106, >>20447357 Swamp events
>>20446795, >>20446808, >>20446831, >>20446859, >>20446997, >>20447025, >>20447147, >>20447196, >>20447336 Mil tweets
>>20446819 Timelapse of US foreign aid since 1946
>>20446850 Anthony Sabatini Calls Out Establishment "Sneak Attack" To Implement Runoff Elections In Florida Against Gaetz
>>20446874 The Supreme Court's About To "Erase Half Of Jack Smith's Criminal Charges Against President Trump"
>>20446875, >>20446980 WHO Director-General Tedros pleads his case to the World Jury on the vaccine mandates
>>20446879 Mike Davis: "Democrats Hate Clarence Thomas Because Thomas Escaped The Democrat Plantation"
>>20446897 America's most wanted, Davie Albarran, arrested in Polk County for sexual battery charges on a 12 year old victim
>>20446937 Mexican Army Kills 12 Suspected Cartel Members In Shootout Near Texas Border
>>20446943 State Costs of Illegal Immigration
>>20446955 The Missing Crossfire Hurricane Binder - President Trump Demanded its Contents Be Released
>>20446967 Declassified J6 FBI Emails Reveal Private Emails of Top FBI Agents Discussing Julian Assange’s Trial
>>20446988, >>20447030 Haley mocking Christians?
>>20446971 Paoletta: Democrats Are Attempting To Destroy The Courts Following Conservative Judges' Ascension
>>20446976 'Glitch' on Nevada Secretary of State’s website caused unmailed ballots to show up as counted in the recent primary
>>20446977 Manure Dumped in Front of Pelosi’s San Francisco House as Leftists Torment Former Speaker at Home and in DC Over Support for Israel
>>20446984 Former First Lady of Haiti Indicted in Husband’s Assassination, Prosecutors Claim She Attempted to Take Over Presidency
>>20447004 DJT: Speaker Tim Moore is doing a fantastic job leading the North Carolina House of Representative
>>20447010 Musk Reveals Neuralink's First Human Patient Controls Computer Mouse With Mind
>>20447016 Assange Judge Worked For MI6 & Defense Ministry
>>20447031 Biden announces new "major" sanctions on Russia
>>20447035 Lady Gaga interviewed WikiLeaks founder Julian Assange in 2012
>>20447063 Here’s Bill Gates updated stock portfolio
>>20447078 Could Ronna's Replacement Already Be Involved In Election Fraud?
>>20447087 ‘Israeli apartheid worse than what South Africa endured’: ICJ hearings
>>20447095 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case
>>20447102, >>20447351 Twitter Suspends Then Unsuspends Navalny’s Widow’s Account
>>20447135, >>20446756 Truckers For Trump and Teamster members are starting the mass boycott of NYC deliveries today
>>20447141, >>20447176 The American Red Cross is now asking blood donors if they ever received the Covid vaccine
>>20447161, >>20447207 Russia takes sexy US hostage for allegedly providing support to Ukraine
>>20447230 Five passenger airplanes reached 800mph after strong winds pushed the planes to insane speeds
>>20447285 NYC shelters shipping migrants to Utah
>>20447286 Douglas Murray Announces New Doxing Database to Keep Critics of Israel From Getting a Job
>>20447307 (14 Feb) CIA helped trigger Trump-Russia probe: Matt Taibbi
>>20447309 Refresher: Biden unaware he's being recorded telling a small child that they're sexy and not to tell Mommy
>>20447344, >>20447454, >>20447349, >>20447044 Realtors are Consider Fleeing NY; a Precedent has been set
>>20447345 Law enforcement disrupt world’s biggest ransomware operation
>>20447350 Republicans ask why 9 boxes of Biden records were omitted in Special Counsel report
>>20447355 Yulia Navalny (Alexei's Widow): I will continue the work of Alexei Navalny to continue to fight for our country
>>20447356 Invasian @ Jacumba, CA
>>20447359 Fluorescent glow in the faces of the vaxxed under UV light
>>20447365 Ben Carson: Excited to be in South Carolina to campaign for our next President, @realdonaldtrump
>>20447378 Israeli army to launch probe into 7 Oct failure
>>20447390 Transcript of Tucker / Mike Benz Interview Regarding AI Tools used to Censor
>>20447400 About 1,600 Nike Employees To Be Laid Off
>>20447445 2 Adults Charged With Murder in Chiefs Super Bowl Parade Shooting
>>20447482 #25083
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448285
#25082 >>20445785
>>20445814 Michigan State is now asking residents to house illegals in their homes. How long until this becomes mandatory?
>>20445832 Capital One and Discover are merging - Will be 6th largest bank in US
>>20445871, >>20445920 turbo cancer and excess deaths - twat and youtube vid Dr campbell
>>20445872, >>20445878 "License To Play God": Physician Group Files Brief Against Biden In COVID
>>20445887 @NYCMayor is giving out debit cards to illegal immigrants up to $10,000 each in taxpayer money with no ID check, no restrictions and no fraud control.
>>20445906 Libs of TikTok w/CAP: Illegals ass*ult NYPD officers in the Randall’s Island migrant housing facility
>>20445941 Elon Musk is nominated for Nobel Peace Prize by Norwegian MP who praises him for being a 'stout proponent of free speech'
>>20445947 Ahoy! The Ship Show & Extra Gravy - 02/20/2024
baker change
>>20445847, >>20446002, >>20446008 DOD contracted injections as 'medical countermeasures', no trials, efficacy, safety
>>20445860, >>20446014, >>20445808, >>20445825, >>20445841, >>20445857, >>20445944, >>20446066, >>20446095, >>20446323, >>20446325 Assange trial LIVE
>>20445862 “NO LIVES WERE SAVED” by the COVID-19 injections, says researcher and scientist @denisrancourt.
>>20445867, >>20446094 ‘Crime of the Century’: Research Raises Horrifying Possibility Covid Patients Were ‘Euthanized’
>>20445876, >>20445881 Ukraine’s AI Drones Seek And Attack Russian Forces Without Human Oversight
>>20445889, >>20446103, >>20446295, >>20446390 Trucker Says Boycotting New York City Is Bigger Than Trump
>>20446020 State Dept. Official on Black Leadership in Foreign Affairs
>>20446028 Lockbit cybercrime gang faces global takedown with indictments and arrests
>>20446029, >>20446038, >>20446042, >>20446045, >>20446271, >>20446284, >>20446302 American ballerina Ksenia Karelina detained 'high treason' in Russia
>>20446034 The Future of Pakistan and U.S.-Pakistan Relations Center for Strategic and International Studies (CSIS)
>>20446068 GoFundMe re calls to shut down DJT fundraiser: This fundraiser is currently within our terms of service
>>20446081 Tucker Carlson Interviews Mike Benz about the surveillance state and censorship
>>20446087, >>20446199 How Chinese Censorship Is Going Global–With Help From US Companies
>>20446100, >>20446200, >>20446245 Sergey Poletaev: 2nd anniversary Russia Ukraine conflict approaches, who has upper hand
>>20446163, >>20446418 Nasa's private IM-1 mission is carrying Hindu guru Pramukh Swami Maharaj to Moon
>>20446185 Per CBP sources, another 208 Chinese nationals apprehended by Border Patrol in San Diego sector yesterday
>>20446196 Joe Biden’s Great-Great Grandfather Pardoned by Abraham Lincoln After Allegedly Committing a Violent Crime
>>20446228 Montana Gov. Greg Gianforte (R) discusses affordable housing challenges event hosted Bipartisan Policy Center
>>20446229 Australia seeks public help to design its 1st moon rover, Roo-ver
>>20446250 Zelensky Complains (Again) that Foreign Aid Delays Are Making Life ‘Very Difficult’
>>20446252 Reflections on Ukraine War W/General Wesley K. Clark, USA (Ret.), the 12th Supreme Allied Commander, Europe
>>20446253 BELARUS TO CRIMINALIZE "LGBTQ PROPAGANDA" AND NOT HAVING CHILDREN
>>20446260, >>20446270 "License To Play God": Physician Group Files Brief Against Biden In COVID
>>20446316 Massive underground laboratory in China joins the quest to find dark matter
>>20446339 Gaetz: ‘I love’ CNN article on cause of ‘brain drain’ in Congress
>>20446378 Pizza Hut worker is arrested for shooting dead manager, 55, over $7,000 inheritance check
>>20446393 The party has 0 infrastructure in place try to register these people..They're going to blow this aren't they?
>>20446508 Daily Press Briefing by Spokesperson Secretary-General, spokesperson President General Assembly UN
>>20446518 Republicans ask why 9 boxes of Biden records were omitted in Special Counsel report
>>20446576 JUST IN - Russia places US Senator Lindsey Graham on 'terrorist and extremist' list
>>20446601 Kim Jong-un receives luxury car as gift from Vladimir Putin?
>>20446644 #25082
Previously Collected
>>20445764 #25081
>>20443029 #25078, >>20443831 #25079, >>20444740 #25080
>>20441455 #25075, >>20441317 #25076, >>20442191 #25077
>>20437658 #25072, >>20438526 #25073, >>20439307 #25074
>>20436010 #25069, >>20436126 #25070, >>20436893 #25071
Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com
Q Research Notables Archive Board >>>/qnotables/
Q Research Notables #21: Purpose >>19961525
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448296
Dough
https://fullchan.net/?ee43a6bc50cd1c73#FTiJvBhMH1FHQUTU5tzkhphBscpxzpDRgCiByJFDn6b1
Can continue or defer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9fc25f No.20448313
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
83b330 No.20448315
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
903f03 No.20448316
>>20448296
Thank You, Baker.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3e5e3 No.20448317
>>20448308 (pb)
manipulator agency troll, you might bake the breads but your crap doesn't wash with anon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bc9cf No.20448318
Will wokeness ever end? Or is it here to stay 'cause of how the internet works?
I'm re-watching media from the early 2000s and i miss when women were women and it was okay for a woman to be sexy FOR men.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d9563 No.20448319
>>20448180 LB
>if humans were genetically modified into existence in the same way that humans genetically modified the Dog into existence…who created the humans and what purposes do humans serve
Don't you see? We did. God does through us.
Recognise the signs of the times.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3de21 No.20448320
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86b763 No.20448321
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59f738 No.20448322
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448323
>>20448304 lb
>https://twitter.com/DanScavino/status/1759933378282033308
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cdca73 No.20448324
>>20448189 lb
She's from Central Casting
/ourgirl/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448325
>>20448317
Why aren't you forgiving me?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3e5e3 No.20448326
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448327
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f088c4 No.20448328
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3e5e3 No.20448329
>>20448325
are you admitting to being a manipulative agency troll?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03e78a No.20448330
>>20448261 pb
wrong. it is a private board.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
091131 No.20448331
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448332
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448333
>>20448325
You won't do anything VPN.
/filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448334
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59f738 No.20448335
>>20448320
gonna have to steal that
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
903f03 No.20448336
>>20448330
Then make it Private.
If Anon can post on it, it's not private.
Mark yer shit
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448337
>>20448329
Check my notes and you decide.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448338
>>20448296
morning katana.
tyb
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
667c26 No.20448339
Looking Ahead
America can be as free and prosperous as ever if we stand firm on our principles and hew to what has always made America the greatest nation in the history of the world. There is no holding back freedom and American prosperity if we lean on the principles and pillars outlined in this agenda – such as a strong national defense, free markets, traditional values, the right to life, school choice, patriotic education, border security, free, fair, and reciprocal trade, confronting the Chinese Communist party’s aggressive agenda, – and if we keep faith with our Constitution. Securing these pillars is essential to the survival of freedom. The solution to any problem can be found in strengthening American culture, American opportunity, and American leadership. WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage. For our country and our future, for our children and our grandchildren, we must move forward united and with faith in the One who has ever guided the destiny of our land – move forward to ensure that the best days for the greatest nation on earth are yet to come.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448340
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03e78a No.20448341
>>20448336
you are clueless. Private ownership does not mean the public cannot post.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
26e788 No.20448342
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bf048 No.20448343
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
176c9c No.20448345
Tater landsempty callsignmaybe he gets out without tripping.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0b733c No.20448346
YouTube embed. Click thumbnail to play. excellent look at migrant crisis in NYC
mind blowing - they live in full-service fancy hotels and are paid and provided for, but can't work 7 months after their arrival. they all thank Biden for their circumstance. meanwhile tax-paying Americans continue to struggle and suffer.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
334c2b No.20448347
Hydrogels in COVID Vaccine as Programmable Human Interface
watch video here https://t.me/gregreesevideoreports/457
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24035c No.20448348
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448349
>>20448341
If there's no demand for it, you can keep it closed, and if there's another space, you can post it there, so what's the problem?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9fc25f No.20448350
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
334c2b No.20448352
https://www.bitchute.com/video/kefnCXMJrNTg/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3e5e3 No.20448353
>>20448337
sorry, I have places to go people to see, and I am bowing out for this bread.
maybe I'll be back later in the evening.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448355
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448356
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448357
>>20448341
There are plenty of environments where you can speak freely at all times, so why stick to a particular place?
What is the reason?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448358
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9fc25f No.20448359
wut bout duh child seks slavurs french nazi xinu juw iphones invade
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448361
>>20448353
You don't sound very forgiving.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
99b597 No.20448362
"THE AUTHORITATIVE PERSONALITY" Adorno T. W. (1950)
Read here: https://archive.org/details/dli.ernet.469826/mode/2up
Only 'God's Chosen People' are permitted to have ethnic, religious, racial, social and geographical purity and exclusivity, led by a strong, responsible, loving, patriarchal based, family unit.
For everyone else Equity Diversity and Inclusivity are essential factors in all areas of life with White European Masculinity considered Toxic with a capital T. and must be neutralized.
No more portrayal of 'Masculine White Male Heroes' allowed in your (((their))) media, ask Henry Cavil or any other White Male actor who hasn't been castrated.
Where do all the so called 'Woke' social justice philosophies come from? Certainly not from a grass-roots, fundamental societal (Family) sources.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448363
>>20448341
If there was a reason to stick with it, did you articulate it?
It seems as if you're just complaining.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448364
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448365
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cf489c No.20448366
>>20448347
maybe the vaxxed have been programmed to reckless behavior that will result in death- like driving into buildings and trees, taking street and big Pharma drugs, more vaxx, suicide, murderous rampages, sacrificing of children, chaos, madness
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
334c2b No.20448367
What is Smart Dust?
Smart dust is in the chemtrails. This is why we are seeing a decline in birds and other wildlife. Smart dust has the potential to cause environmental damage. As these sensors are very small and light, they can easily be blown away by wind and end up in rivers or oceans where they are harming wildlife. These are single-use items, and there is no practical way to retrieve them once deployed. Similar to microplastics, smart dust could eventually accumulate in us and the environment and cause irreparable damage.
Smart dust is highly intrusive and poses a threat to privacy. Thousands of virtually invisible sensors collecting data on our movements, conversations, and activities without oversight is a significant cause for concern. Fallen into the wrong hands, the data collected by smart dust will be used for nefarious purposes. I assume it already is.
https://www.bitchute.com/video/PrxgloqkIduY/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e57533 No.20448369
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448370
>>20448196 PB
>The Mayor of @CNLV announces the city will discriminate against white business owners.
White people should boycott Black businesses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
65d375 No.20448371
YouTube embed. Click thumbnail to play. https://youtu.be/Rqacvc9UJfw
Fani Willis HEATED in Disqualification Hearing & Cries Victim At Church
CartierFamily
901K subscribers
2/20/2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448373
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448374
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03e78a No.20448375
>>20448349
you have the problem.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448376
>>20448367
>This is why we are seeing a decline in birds and other wildlife
Don’t they have seed vaults around the world?
Surely those planners have bird seeds stored.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448377
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
56ae9d No.20448378
OMFG looks like they are finally admitting COVID shots hurt people and are blaming Trump's Warp speed.
You can't make this shit up.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
334c2b No.20448379
https://www.thegatewaypundit.com/2024/02/judge-engoron-accused-banging-secretary-opposing-counsel-previous/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448381
>>20448341
If you are talking about anomalous deletions in QR
Don't.
That's been going on for ages.
It's a new thing now.
I've outgrown this anon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03e78a No.20448382
>>20448363
I am not the one complaining. You are about free speech on a private board. so just fuck off with your free speech nonsense.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448383
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448384
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
52b3cc No.20448385
>>20448055 Tucker Carlson says Boris Johnson wants "a million dollars" from him to talk about Ukraine (PN) Why would anyone want BJ back? Would Nigel actually work with BJ, he's a criminal.
10 Dec, 2023 17:21
UK Tories plotting Boris Johnson's comeback – Daily Mail
The ex-British PM is seen by some Tory rebels as being the most formidable opponent to Keir Starmer’s Labour, according to a report
Tory rebels are considering a plan to “crash” UK Prime Minister Rishi Sunak’s Conservative government and reinstall Boris Johnson as leader as concerns rise over flagging poll figures and surging support for the opposition Labour Party ahead of an expected general election next year, according to the Daily Mail.
Amid the high-profile cabinet departures of former Home Secretary Suella Braverman and Immigration Minister Robert Jenrick, Sunak’s authority over Tory ranks is set to be further tested this week when he faces a pivotal vote over his flagship Rwanda migrant-handling plan.
Citing anonymous Conservative MPs, the Daily Mail wrote on Saturday that Tory insiders are urgently attempting to address a growing revolt – with peerages being offered to possible rebels to convince them to toe party lines. The tabloid claims that disgruntled Tories will increasingly seek to “crash” the Sunak government with a series of Commons votes and outspoken interventions, which the newspaper’s sources said is crudely referred to as an ‘Advent calendar of sh*t.’
Furthermore, the outlet cites anonymous sources as saying there is a belief within the party that Johnson – who stood down as prime minister in September 2022 – is the only person who possesses the necessary skills to pose a challenge to Labour leader Keir Starmer.
The newspaper also notes that the Reform Party, thesuccessor to Nigel Farage’s Brexit Party, is siphoning votes that might otherwise have gone to the Conservatives– with a so-called Johnson/Farage “dream ticket” beingfloated. It also notes that Farage’s appearance on a popular UK reality television series has bolstered support for the Brexit architect.
Johnson, who is a columnist for the Daily Mail, did not elaborate on his possible political ambitions when contacted by the newspaper. A spokesperson for Farage, who, like Johnson, is not currently an MP, said that any political alliance between the two would “soon end in tears.”
“Reform are going to kill us,” the newspaper cites an anonymous Tory MP as saying. “We have to buy Farage off. The plan is we get him into the Lords, give him some brief like we did with [David] Cameron – maybe even home secretary– then go to the country with the ‘Dream Team.’”
Another possibility for a post-Sunak scenario, per the Mail, would be for Johnson ally and former Home Secretary Priti Patel to be appointed as temporary PM while Johnson seeks a ‘safe’ seat in the election – after which he would hypothetically return to Downing Street.
Recent polling has indicated that Labour holds a commanding lead over the Tories ahead of the next general election, which must take place before January 2025.
https://www.rt.com/news/588843-uk-boris-johnson-tory-rebels/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448386
STOP ALL FUNDING TO ISRAEL
STOP ALL FUNDING TO UKRAINE
CLOSE THE BORDER
SAVE MAUI FROM WEF GLOBALISTS!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448388
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03e78a No.20448389
>>20448381
you tagged wrong anon. Have been responding TO the haters.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448390
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448391
Yes Normies
you have AIDs
Not Full Blow AIDs
Just a Little Tiny bit of AIDs
Does Framing it like that make it Better?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
83b330 No.20448392
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
08dd54 No.20448393
>>20448296
Thank you baker…………!
My neighbor is on point.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448395
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9111ce No.20448396
The jab made people stupid. Moderate thinkers who could still manage critical thinking seem to have gone over to the dark side narrative repetitions after the jabs.
Could the nano particle graphene oxide really have made them antennas to pick up the narratives carried over the wireless airwaves?
seriously? I know that was a theory, but it seems to have borne fruit.
How do we pipe them free thinking again?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f41c45 No.20448397
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448398
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448399
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b70f08 No.20448401
>>20448378
mother jones already said that Trump can't take credit for Warp Speed. it was all put in place by Obama.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
caf1df No.20448402
https://jonathanturley.org/2024/02/20/pay-to-play-trump-faces-a-staggering-cost-for-appeal/
Trump supposedly has to come up with hundreds of millions of $ just to get an appeal.
How is that fair?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32eca6 No.20448403
>>20448382
when is the concept of free speech nonsense?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448404
>>20448389
Huh?
Hate?
I'm looking forward to it, okay?
You see the hate?
Maybe that's projection, huh?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
65d375 No.20448405
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448407
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448408
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448409
>>20448389
Good morning, asshole.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448410
>>20448396
only 3% of the population is Vaccinated
Vaccinated = 8 Shots
97% of the Population isn't Complying
Which is a good sign
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94c52b No.20448411
Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid
https://rumble.com/v4eofsi-tucker-carlson-mass-migration-is-destroying-america-and-no-one-is-doing-any.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
65d375 No.20448413
Dr Ardis says Vitamin C to help prevent cancer fyi
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448414
>>20448403
When the Jewish don’t like what you say?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448416
INVADERS AND ILLEGALS GOT NO JABS NO JOBS
WHY ARE THEY HERE AGAIN?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448417
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448418
>>20448389
So?
What's up?
Aura fag.
What color is my heart now?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448419
>>20448367
vintage meme
2020
vintage sauce
2018
https://www.forbes.com/sites/bernardmarr/2018/09/16/smart-dust-is-coming-are-you-ready/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cdca73 No.20448420
>>20448393
Changes yours to FBIareFaggots
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9111ce No.20448421
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448422
>>20448296
Keep the fur
TYB
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
215f76 No.20448423
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49200f No.20448424
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
caf1df No.20448426
The HO2 ticket
KaMOOla and Ikki Nikki!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448427
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fda496 No.20448428
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bb96a No.20448429
>>20448296
TYB
There's always time for forgiveness.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
385d14 No.20448431
rasberries make kenedy jealous >>20448379
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448432
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
08dd54 No.20448433
>>20448420
I was thinking CIA or NSA.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448434
>>20448416
Why are you here?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7db628 No.20448435
https://twitter.com/WallStreetApes/status/1759948784904126620
AOC Is A Political Actor
Did You Know Alexandria Ocasio-Cortez Was Elected Thanks To A Casting Call Put Out By Democrats?
AOC’s Brother Submitter Her Application & She Was Chosen By The Executive Director of Justice Democrats Out Of 10,000 Candidates
It’s All On Camera. Here’s The Story, Watch To The End To See Footage Of AOC & Alexandra Rojas Confirming This On Camera
“Alexandria Ocasio Cortez is not really the congresswoman of New York's 14th congressional district.She is essentially an actress. She's merely playing the part of a New York congresswoman.I know this sounds crazy, but bear with me. In 2017, a group called the Justice Democrats held auditions for potential congressional candidates that they would run on their platform for various congressional seats throughout the country.
Alexandria Ocasio Cortez's brother Gabriel submitted her for the role. Now I've auditioned for many acting roles in my day. I've also cast many of my own projects. I know how this works. If you find somebody with star power, even if they don't 100% fit the part, you go with it.
Obviously, AOC has star power. Just look at her. She's a superstar, the most famous person in Congress, maybe ever. Their casting was perfect. Now I didn't have to go digging for evidence for this because they freely admit it.
They brag about it.”
Alexandra Rojas Executive Director of Justice Democrats “Back in 2016, we put out a call for nominations. We got over 10,000 nominations. Out of those 10,000 nominations, we found Alexandria.”
Alexandria Ocasio-Cortez “My brother told me that he had sent my nomination in the summer, but I was, like, literally working out of restaurant. It's like, there's no way.”
“- A casting call. They had a casting call. They cast Alexandria Ocasio Cortez in the role of congresswoman.”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b70f08 No.20448436
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b7289 No.20448438
>>20448416
neither did your mail carrier and that fed comes to your house every day
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448439
YouTube embed. Click thumbnail to play. >>20448401
>>20448401
>Trump can't take credit for Warp Speed
surely such fake narratives were anticipated by PDJT well in advance!
he knew other people would try to take the credit, and he told everyone at CPAC to never let them!
because the Trump Administration is fully responsible for the vaccine, said POTUS at CPAC!
AFTER he left office!
vidrel
23:15 begins vaccine review and credits
https://youtu.be/9kL9KiUNoZQ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448440
>>20448437
I'm glad there are people like you on the Research board.
I feel like I'm still allowed to speak this way.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
83b330 No.20448441
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
15bc06 No.20448443
The Record From Recorded Future News
@TheRecord_Media
5h
.@TheJusticeDept has unsealed indictments against two alleged members of the #LockBit ransomware group, Artur Sungatov and Ivan Kondratiev, also known as Bassterlord. The Treasury Department also announced sanctions against them.
Feb 20, 2024 · 6:27 PM UTC
https://twitter.com/TheRecord_Media/status/1760008351906242654
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448444
>>20448434
to nail VPN's of the cyber engagement center
/filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448445
>>20448366
The social credit system was the driving force behind control over the vaxx and lock downs inside chyna. Now analyse those who complied with vaxx and lockdown measures outside of chyna where no "social credit" app exists (yet) and people still did as thy were told through social manipulation and taking sides with a misguided morals.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448446
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
891c2f No.20448447
>>20448304 LB
Her Snek no good
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448448
>>20448438
Cyber engagement center horse shit propaganda
/filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448449
>>20448416
I would wager
That Cargill
Stole all their land with the new shipping ports on the Amazon and Congo basins
Then they get counted and given an A number
So that they can borrow on their asses
Just like they did you
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448451
>>20448401
Once again, Trump uses himself as bait.
They will only let the truth leak out if they think they can somehow use it to try to dis Trump.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b47b6 No.20448452
>>20448364
targeting conservative voters, likely to actually vote
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448453
>>20448444
I don't filter. It's a hobby.
I feel like a guy who can't handle the truth.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448454
>>20448449
since you have ttwo posts I think you are paid by BEHAVIOUR MATRIX 120 k a year.
But still you are really just a VPN piece of shit for the cyber engagement center
/filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
790580 No.20448455
Get ready for the dancing nurses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b47b6 No.20448456
>>20448367
cell phones work better, and actually exist
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448457
>>20448341
It is playing the "muh censorship" card again
Generally a sign the DOAR faggots are around again
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448458
>>20448398
>>20448432
SHE MAN, 'ta ta tata ta ta taaa'
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
124dce No.20448459
>>20448402
>How is that fair?
Fairness is a plot device.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fda496 No.20448460
>>20448451
exactly…mother jones claimed Ivanka was trying to give her Father all the credit and poor Obama was the real hero
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448461
>>20448452
Also, a good way of getting rid of the useless eaters who are using up Medicare and Social Security dollars.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448462
>>20448454
And I think
You need
To spit that dick out
It ain't yours
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c3bc22 No.20448464
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448465
>>20448450
Why did so many unusual deletions start?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
385d14 No.20448466
wrong war reich rasberries
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448468
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448469
>>20448429
Get lost, guilt trip shill.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448470
>>20448455
notable
Recruitment underway for 'Disease X' Dance Choreographers for 2024 planned pandemic and lockdown
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a771bf No.20448471
Unfinished meme any takers….o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49200f No.20448473
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448474
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448476
What english accent is this?
(Video of a mercenary in Avdiivka)
Anon hears two accents, American (calling FUCK, let me get back there for a minute) and Australian (you're OK mate… can you get up, you gonna have to get up)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdd8e4 No.20448477
>>20447355 pb
Asked this question the other day, didn't get an answer. Cui Bono? Who benefits with the death of Navalny? Putin or Putin's enemies?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
597e91 No.20448478
>>20448455
Where da sauce?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448479
>>20448385
I'm just going to nix this in the bud. NO, Bojo is not making a comeback in the Conservative party. He is a remnant of the old tory gang. Cameron is also, but is a different fish (or pig) all together. Eyes need to be on him and Samantha.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
691de4 No.20448480
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
47b43c No.20448481
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7d9c76 No.20448482
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
99b597 No.20448483
YouTube embed. Click thumbnail to play. NUMBER 1 on Radio Jerusalem since 1969.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
47b43c No.20448485
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5467b No.20448486
>>20448296
Holy, has it finally been two weeks?
Or should I check back in a fort night?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c3bc22 No.20448487
Prayer Time Soon
Get ready, it's going to be Biblical
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bb96a No.20448488
>>20448469
No one is guilting anyone. I forgive you for your projections. You consider forgiveness as weakness when it couldn't be further from the truth. It makes you stronger. God bless you, and thank you for baking.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c81173 No.20448489
Wonder who took down Brendon O'connels channel after it was posted earlier?
Pathetic.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2aa2d0 No.20448490
We all photograph sawdust, dont we ?
Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine
https://www.thegatewaypundit.com/2024/02/hunter-bidens-lawyers-lash-special-counsel-claim-photos/
Hunter Biden’s lawyers lashed out at Special Counsel Dave Weiss and claimed photos on Hunter’s iPhone are sawdust, not crack cocaine.
The Justice Department last Tuesday released photos from Hunter Biden’s iPhone showing his use of cocaine, crack cocaine, and drug paraphernalia.
Last year, Hunter Biden was indicted on federal gun charges. He faced indictment in a Delaware court on three counts relating to his possession of a firearm while using drugs.
These charges include one count of making a false statement in the purchase of a firearm, one count of making a false statement related to information required to be kept by a federal firearms licensed dealer, and one count of possession of a firearm by a person who is an unlawful user of or addicted to a controlled substance.
The Gateway Pundit reported back in October 2020 that his then-lover and deceased brother’s widow, Hallie Biden, tossed the gun in the trash. Hunter admitted this in an online conversation with his family when they accused him of inappropriate conduct in front of a child.
Five years after Hallie Biden discarded his firearm in a trash can behind a Delaware grocery store, the weapon underwent further examination by FBI officials, according to the New York Post.
According to a court filing by Special Counsel David Weiss, FBI agents retrieved the sealed Colt Cobra 38SPL revolver from a state police vault. They photographed the weapon and noticed white powder on the pouch that contained the firearm.
The DOJ released photos from Hunter Biden’s iPhone showing his illicit drug use to prove he was addicted to drugs while he lied about it on a federal firearm form.
Hunter’s lawyers attacked the special counsel in a court filing on Tuesday.
“Mistaking sawdust for cocaine sounds more like a storyline from one of the 1980s Police Academy comedies than what should be expected in a high-profile prosecution by the U.S. Department of Justice,” Hunter Biden’s lawyer said in a court filing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
385d14 No.20448491
bizzare parra adumma mortgage late
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448492
>>20448403
When it is mentioned by you fuckheads
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
15bc06 No.20448493
https://twitter.com/TheRecord_Media/status/1758634152570814736
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
691de4 No.20448494
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
47b43c No.20448495
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448496
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448497
commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist and identity fraud who hold government office are stealing money and putting the blame for war crimes on us when we can't control the US government anymore.
These fucking trans national war criminals have conspired to KILL EVERY AMERICAN.
The SHERIFF PROTECTS THESE MOTHERFUCKERS!!!
https://www.youtube.com/embed/8leaZ7GzjmM
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448498
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448499
>>20448463
kek
They thought he was one of them.
That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
691de4 No.20448500
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2029b0 No.20448501
‘Don’t touch the kids,’ Putin tells gays
Adults can live and let live, but children are off limits, the president warned
Russia is actually tolerant of people with non-traditional sexual orientations, so long as they don’t target children or flaunt their preferences, President Vladimir Putin said on Tuesday.
The president made the remarks while addressing visitors to the ‘Strong Ideas for a New Time’ forum, a yearly event organized by Russia’s state-backed Agency of Strategic Initiatives.
“We are quite tolerant towards people with non-traditional sexual orientations. We just don’t flaunt it, and we don’t believe it’s right to flaunt it. Let everyone live – the adults – as they want. Nobody limits them in anything,” Putin stated, explaining that, basically, there are only a handful of rules which limit the LGBTQ community in the country.
As for children, I have already said many times: ‘Don’t touch the children.’ That’s it. This is the first one. And the second one is, we are, first and foremost, a state that is guided by traditional values.
Over the past few years, Russia has gradually tightened its legislation aimed at countering the spread of what it calls “LGBT ideology.” The drive began in 2013, when the dissemination of said propaganda was outlawed among minors.
The ban was reinforced in December 2022, when new legislation introduced major fines for anyone found guilty of promoting “non-traditional sexual relations,” pedophilia, and transgenderism among minors and adults alike.
Late last year, the Supreme Court of Russia outlawed the “international LGBT public movement,” designating it as extremist. The ban stemmed from a lawsuit filed by the Russian Justice Ministry, which asked the top court to do so, arguing that the movement has been involved in “incitements of social and religious discord” as well as exhibiting unspecified “extremist traits.”
The extremist designation has been harshly criticized by multiple rights groups in the West, which have argued that it is “absurd” and vague, and that it has had a “catastrophic” effect on the LGBTQ community in Russia. The inclusion of any group in Russia’s “extremist organizations” list effectively bans all of their activities and outlaws all of their associated symbols.
https://www.rt.com/russia/592788-gays-welcome-putin-says/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448502
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a771bf No.20448503
>>20448496
Lmao good one anon…o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448504
YouTube embed. Click thumbnail to play. >>20448483
surely you're not tuned to the right frequency
THIS is the number one song, in Jerusalem and throughout the world
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
312af8 No.20448505
Wow, just tried to red-pill someone on Trump's goodness by using the whole Trump Sneaker thing. I thought if they actually knew someone who got in on buying the sneakers that they would say “Oh, if it worked for you then there must be something to it.” Nope, nothing. He just kept saying “no one is making money on these sneakers.” I say, “Sure they are look on eBay.” He says, “eBay has all kinds of scams, you won’t receive the sneakers or the money.” Told friend that I was one of a thousand people in America who bought them! I didn't get a congratulations or a raised eyebrow, ZERO curiosity. Not a single question. He just shook his head saying you're going to get ripped off. He's FOOLED you!" Why wouldn't he say “how did you do it? Was it all online, when do you get them, can I see them, what do you mean they are selling for $5,000?” Not a single question, he just said I gotta go. And I said “do you want me to tell you next time this happens?” The answer was “it won't happen again, Trump's trying to rip you off, I gotta go.” He wouldn't accept that the money is not going to Trump and looked upset. I said "Why are you upset, I'm telling you I just won the freakin' lottery?" and he said "You haven't won anything, you are being taken advantage of and I gotta go."
I pray in the name of Jesus that they wake up and see the Light. Strange thing is these are REALLY good, generous, considerate, Jesus loving people, but they are completely blind to the good in what Trump is doing. Keep on praying for these people, please. Don't write them off. They're not all bad, there are still A LOT of good people who are 100% blind to Trump. Do not give up on them, please. Prayer works. Thank you for your prayers, Patriots.
"The Lord is not slow in keeping his promise, as some understand slowness. Instead he is patient with you, not wanting anyone to parish, but everyone to come to repentance." 2 Peter 3:9
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448506
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
47b43c No.20448507
>>20448499
>That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.
Retard, half of his family are Yids, the other part are Kikes!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448508
Owned by 6 corps
and 272 execs
bla bla bla it's WRONG!
THIS IS FUKING Feb 20, 2024
FCC + BBG are tainted and controlled by the color of laws.
18 USC 1001b
smith mundt modernization act
ndaa
patriot act
aumf
cog
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cda72 No.20448509
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2029b0 No.20448510
Leader of drug trafficking organization imprisoned for international cocaine distribution scheme
https://www.justice.gov/usao-sdtx/pr/leader-drug-trafficking-organization-imprisoned-international-cocaine-distribution
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
903f03 No.20448511
>>20448341
It's not Private.
It's not marked Private
It's not Unlisted
It's Public.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49200f No.20448512
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448513
>>20448488
You forgive because you are too weak to get even.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448514
>>20448495
Once all of the non-Jewish White people are gone, the White Jews will stick out like a sore thumb and will be slaughtered in the streets.
They are eliminating their camouflage by getting rid of the non-Jewish Whites.
Did they think this thru all the way?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
447a0d No.20448515
YouTube embed. Click thumbnail to play. Watch this and you will understand why PCR testing can be a problem., INCLUDING IN DOGS AND PAPAYAS.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448516
>>20448498
Now then, now then…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448517
>>20448472
>>20448474
If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.
I'm pretty sure you could state in red text that you were banned or why, right?
Like this person was banned for this reason.
Is that what should do instead of deleting?
It might also eliminate mistakes.
But then would get spam and mold all over the place, wouldn't ?
What should do?
Balance of freedom?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448518
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
691de4 No.20448519
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448520
>>20448416
TO TAKE YOUR JOB, YOUR HOUSE, YOUR MONEY and YOUR WOMEN
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448521
>>20448510
it's DOJ trying to justify existance when they should be deactivate the DOJ and SENT INTO THE US MILITARY FOR THE NEXT WAR THEY START.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448522
So
Sanctions on the countries with a viable currency
Only thing that gets me
They can say this shit with a straight face
Bastards deserve Emmy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
65d375 No.20448523
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152579 No.20448525
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448526
TRUMP LIVE ON LAURA INGRAHAM
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448527
>>20448520
(whitelisted this anon)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cd3944 No.20448528
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17bbd5 No.20448529
I listened to her speech today and it sounded like a little girl Karen sing songing that she was not quitting…yah,yah,yah, yah, yah!
Wanted to slap the bitch!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2029b0 No.20448530
Israel has the same Western support as Hitler – Maduro
The president of Venezuela backed the assessment of the Gaza conflict made by his Brazilian counterpart Lula da Silva
Modern Israel enjoys “the same encouragement, the same funding, and the same support” of the collective West like Adolf Hitler’s Nazi Germany before the World War II, Venezuelan President Nicolas Maduro has said.
The president made the remarks on his own TV program With Maduro Plus, backing the assessment of the situation in the Middle East provided recently by his Brazilian counterpart Lula da Silva.
“Powerful family names in the US, Europe and London supported and celebrated Hitler’s arrival to power in 1933. They encouraged him and allowed him to persecute my Jewish ancestors,” Maduro stated. The president made public his Jewish ancestry back in early 2010s, revealing his grandparents were Sephardic Jews who converted to Catholicism.
The Western elites “kept quiet because they were preparing Hitler for him to launch his military power against the Soviet Union,” Maduro explained, stressing that, ultimately, Hitler was “a construct, a monster” created by the collective West.
Modern Israel has turned into the very same thing, the president asserted, urging Jewish people who are still true to their roots to end the ongoing “massacre” of the Palestinians.
“The criminal military apparatus of the State of Israel also has the same encouragement, the same funding, and the same support” of the West, Maduro stressed. “As President Lula da Silva said, the Israeli government is doing the same thing [to the Palestinians] that Hitler did to the Jewish people.”
Brazil’s da Silva delivered the explosive remarks over the weekend, describing Israel’s military action against Hamas militants in Gaza as “genocide” and “slaughter.”
https://www.rt.com/news/592798-israel-hitler-comparison-maduro/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448531
>>20448513
Why not both?
Just because you forgive someone doesn't mean that you alleviate them from justice.
Forgiving them just prevents them from living rent free in your head.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448532
>>20448526
True Story
https://streamfare.com/foxnews
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448533
US and EU are not the only ones suffering an invasion crisis. Australia is quietly right up there and with a population of only 25 mil, will be gobbled up by Muslims in short time.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448534
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448535
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448536
>>20448439
That's part of the fun
PDJT says take the vaxx, lefties hate everything PDJT likes, so no vaxx
Lefties steal election, sheeple already scared by MSM, so not only do lefties say "take the vax" but go to mandate the shit or you go to the camps
Now it's time to play the "no, we never wanted the vax, it was all Orange Man" when there's so much video and shit out there proving them liars
Old timey "damned if you do, damned if you don't"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
447a0d No.20448538
>>20448515
Baker, make this notable
This is knowledge that will demolish the deep state.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5be13f No.20448539
>>20448378
So you mean what everyone has known and been saying since he was pimping the Vaxx? Yeah you said they were fedboi shills retard
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448540
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448541
Transnational Coordinated Terrorism on America is what the fuck is happening and our LOCAL SHERIFF Protects it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448542
>>20448532
LISTEN UP……TRUMP LIVE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448543
>>20448512
Apparently a lot of folks are smoking sawdust.
They sell a shit-ton of that online. They don’t even try and hide it either.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c81173 No.20448544
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
544a35 No.20448546
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448547
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448548
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448549
>>20448542
https://usnewson.com/watch/fox-news-live
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b363d7 No.20448550
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ba2c6f No.20448551
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448552
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448553
3300 sheriffs just got GAZA GENOCIDE TRAINING…
WHAT DO THEY PLAN TO DO NEXT?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49200f No.20448554
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2029b0 No.20448555
US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death
Russia has already been subject of the most steadily applied US and EU sanctions regimen on earth over the last two years due to the Ukraine war. But in the wake of Alexei Navaly's reported death in a far northern Russian prison, which Western officials are blaming "dictator" President Putin for, Washington is about to roll out with… more sanctions – which it should be noted are "major".
US National Security Council spokesperson John Kirby on Tuesday previewed what he's calling a "major sanctions package" targeting Moscow in response to Navalny's death.
The new sanctions, to be formally unveiled Friday, will "hold Russia accountable for what happened to Mr. Navalny, and quite frankly, for all its actions over the course of this vicious and brutal war that has now raged on for two years."
An course the administration hasn't missed the opportunity to tell House Republicans they must pass Biden's massive $60 billion for Ukraine defense aid bill.
"One of the most powerful things that we can do right now to stand up to Vladimir Putin, of course, is to, again, pass the bipartisan national security supplemental bill and support Ukraine as they continue to fight bravely and assess their country," Kirby continued in his remarks to reporters on a conference call.
The White House is talking about various 'options' in terms of consequences for the Russian opposition activist's death in custody:
In 2021, Biden told reporters that if Navalny died, the consequences for Russia would be “devastating.” Asked directly about that on Friday, the president said his remark was three years ago, and they’ve faced “a hell of a lot of consequences” since then.
Biden directly blamed Russia for Navalny’s death and said: “We’re contemplating what else can be done,” adding, “We’re looking at a whole number of options.”
In Europe, various governments' embassies have been summoning the resident Russian ambassador to condemn Navalny's death and gain answers. Poland was the latest to summon the Russian ambassador Tuesday.
Meanwhile, Navalny's widow, Yulia Navalnaya, has quickly become spokesperson for her husband's cause, having addressed the Munich Security Council over the weekend. While she's relatively unknown, over the past days since her husband's death Western media has been highlighting her words of denunciation aimed at Putin and Moscow. Putin "killed the father of my children," she's told press briefings.
https://www.zerohedge.com/geopolitical/us-hit-moscow-new-major-sanctions-package-over-navalnys-death
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448556
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448557
>>20448538
Anon, self-nommed is automatically rejected
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bb96a No.20448558
>>20448513
>>20448513
I forgive you for your baseless projection without any context or proof. I get even, then I forgive. God bless you.
>>20448531
See what this anon said. Then forgive this Anon for being more spiritually and intellectually ascended than you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fda496 No.20448559
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448560
"Well I settled it about three months ago."
–Trump
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20448561
>>20448334
<000_Biblical_Smoke_On_The_Water.MP4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448562
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f18ab7 No.20448563
Hunter Biden attorneys say prosecutors mistook sawdust for cocaine in evidence dump
https://twitter.com/nypost/status/1760057741899333778
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448564
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448565
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448566
>>20448536
games without frontiers
war without fears
>That's part of the fun
except humanity dies
including (You)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
451bf7 No.20448567
>>20448296
> Donald Trump and Laura Ingraham
The energy here in Greenville, South Carolina is electric! You can feel the anticipation in the air for tonight’s Town Hall with Donald Trump. Tune in to
@FoxNews
at 7 PM sharp.
6:21 PM · Feb 20, 2024
·
42K
Views
https://twitter.com/IngrahamAngle/status/1760082364858827142
:17
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448568
>>20448543
Man
Bimbo Bakeries
Uses up the sawdust
Cellulose ……..
Who owns the smokable….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0ad31 No.20448569
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448570
>>20448532
>>20448549
TRUMP LIVE … Town Hall of Laura Ingraham
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
451bf7 No.20448571
>>20448567
>https://twitter.com/IngrahamAngle/status/1760082364858827142
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448572
>>20448557
thats not auto true
this anon has an 80% success rate self nomming
1) use sparingly if needed
2) ulmost always appreciated
spam is spam
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bf048 No.20448573
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448574
>>20448563
Hey Hunter!
I gots wots ya needz
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448575
>>20448555
clown pushing Navalny story
FILT HERD
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448576
>>20448553
I'm hoping they plan on finding you a nice heavy cotton jacket that lets you hug yourself
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448577
>>20448561
Correct, anon stolled it and frenamed it for anon convenience.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b47b6 No.20448578
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448579
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448580
It was the Israel Sheriff's that protected against the HAMAS Tunnels and Baby raping head cuttin (p[ropaganda/lies) by shooting thru their own people to get them.
Now 3300 American sheriffs just got GAZA GENOCIDE TRAINING…
WHAT DO THEY PLAN TO DO NEXT?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
451bf7 No.20448581
Trumps Daily Attacks Won’t Stop
6:11 PM · Feb 20, 2024
·
13.9K
Views
https://twitter.com/THEUNITEDSPOT_/status/1760079882669945202
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448582
>>20448531
Empty words; Justice is the opposite of forgiving.
>>20448558
Empty words; getting even means no forgiveness is required hence why it's called getting even.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
971bdd No.20448583
YouTube embed. Click thumbnail to play. Interesting the speech contents…they touch on what to do with the migrant issue…caused by the democratic opposition…the timing is so…with Our.. The Plan.
We are just continuing their plan..script…proofs here that we are so on target…COZY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448584
Has you seen picture of GAZA? why not
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d903a5 No.20448585
Bad doggie comms for the Shift
https://x.com/ktla/status/1760093253418840122
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
447a0d No.20448586
>>20448557
Well that sucks bro, just watch the video then and you will see why papaya are turing PCR c-19 tests positive
btw this is just 2 of the first non-spike primer sequence I looked into that they possibly use and there might already be a problem..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448587
Will America look like GAZA after the Sheriff protects Bidens Multinational Invasion?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b47b6 No.20448588
>>20448569
sawdust pipe
i have been wrong all along, huh
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448589
>>20448472
>>20448474
If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.
I'm pretty sure you could state in red text that you were banned or why, right?
Like this person was banned for this reason.
Is that what should do instead of deleting?
It might also eliminate mistakes.
But then would get spam and mold all over the place, wouldn't ?
What should do?
Balance of freedom?
If were to state the reason for each and every deletion, we would have to increase the BV.
Well, in other words, are these anons trying to say that there is a problem with the criteria for deleting BOs and BVs here?
That was the point?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d56f5 No.20448590
>>20448567
hint of a threat
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d9563 No.20448591
>>20448582
>Justice is the opposite of forgiving
Just ice
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448592
How many of the Sheriffs got the Bio Agent Jabs?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1935e3 No.20448593
YouTube embed. Click thumbnail to play. >>20448322
>the ride never ends
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
385d14 No.20448594
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448595
Trump LIVE Faux News TOWN HALL
get in here
FREE WATCHING
https://streamfare.com/foxnews
https://usnewson.com/watch/fox-news-live
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448596
>>20448568
Fuck-all. I never knew it did anything. Did you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152579 No.20448597
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
447a0d No.20448598
>>20448557
They have an entire crew on twitter fucking with antiv c-19 vax peeps and these people don't know much about this video I posted.
It would be fucking aweseome to get someoen to actually talk sense
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448599
America is already over.
The SHERIFF did it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9bdbd9 No.20448600
>>20448585
compton
pitbulls code for blacks
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03e78a No.20448601
>>20448511
you are literally too stupid to continue this conversation.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448602
>>20448555
As long as your against Russia
Biden will forgive your sins
Even a Nazi Sympathizer
meanwhile an American Journalist dies in a Ukraine Jail
Not a Peep
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448603
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
971bdd No.20448604
YouTube embed. Click thumbnail to play. >>20448583
The New Rogan here humanizing a bit the huge mistake of not seeing History repeat itself or the Dangers of Living in the feels of Ignorance is Bliss
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448605
>>20448597
Okay, you can stay…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448606
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d903a5 No.20448607
Mosquito drones with micro explosives honing in on the ear buds?
Hot summer indeed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7db628 No.20448608
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2029b0 No.20448609
>>20448575
>>20448578
Seriously you shills are retards
How am I glowing for pushing what is happening?
Here is your usual sauces then
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0c1f5a No.20448610
>>20448599
the sheriff is just the last Illusion of just law enforcement to die
my sheriff knelt with BLM, did yours?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448611
>>20448543
"smoked" salmon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448612
if there's ever a new government, I say one line that could have stopped all this non-violently is a new law and oath….
Old oath wasn't bad but the founders missed the new threats commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist or identity fraud
+ so help you god
now make the LAW go with it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7b9427 No.20448613
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20448614
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448615
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5467b No.20448616
>>20448382
>so just fuck off with your free speech nonsense.
Evening, Arnold.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448617
>>20448589
But this deletion issue is something we've been talking about for a long time.
Maybe I have to change myself after all?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
451bf7 No.20448618
>>20448595
>https://usnewson.com/watch/fox-news-live
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448619
>>20448596
Many moons ago
Got some shit
Looked like sawdust
Tasted like fuel oil
And …..shooooooweee
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448620
>>20448611
No. Fucking. Way.!
People are smokin’ fish too?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
08dd54 No.20448621
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448622
>>20448610
(whitelisted)
I have no evidence MY sheriff knelt. But I agree with your opinion they knelt to transnational terrorists (and yes I paraphrase you)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861f29 No.20448623
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448624
>>20448623
https://streamfare.com/foxnews
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861f29 No.20448625
>>20448623
>>https://usnewson.com/watch/fox-news-live
nevermind
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a674ae No.20448626
>>20448538
your dumfukkery is notable
me me me me me my post my post my post
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448627
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b47b6 No.20448628
>>20448609
i was referring to the bereaved widow
who already had a speech written and ready to go two hours after…
but if you identify as a clown, don't let me interfere
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b7289 No.20448629
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b25592 No.20448630
>>20448563
was he building something?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448631
>>20448568
>>20448596
shaped like food
flavored like food
never grows mold
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bb96a No.20448632
>>20448582
>>20448582
Justice is irrelevant to forgiveness. You can get justice with totally getting even then afterwards you're faced with a choice to harbor resentment or otherwise forgive. You forgive to let go of the negativity. You choose not to forgive to maintain the negativity. I can easily get even with with sub par intellect when it comes to these discussions then very incredibly easily forgive you for all of it. You should try it sometime. God bless you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861f29 No.20448633
>>20448624
thanks. sometimes one has to have a backup
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c81173 No.20448634
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7b9427 No.20448635
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
385d14 No.20448636
not duh first parra adumma
butt wuz tribute
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448637
>>20448597
Morlock bikini line. Yup. Didn't expect that one today.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448638
You guys think Hunter smokes fish?
Joe said he’s pretty smart (I know, consider the source).
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49200f No.20448639
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a674ae No.20448640
>>20448609
nobody gives a shit about navalny
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448641
>>20448617
So you are trying to get me to make the choice to leave by telling me I have to change myself?
Is this Boot Camp for the soul?
Hmmm.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448642
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448643
>>20448638
He's been known to smoke parmesan cheese, so who knows? Anything could happen with a crackhead, especially rich ones.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448644
>>20448618
>GREENVILLE SOUTH CAROLINA
>GREENVILLE SOUTH CAROLINA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448645
>>20448592
called the local cops said at least of the force 17% of the force might be prudent control group.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448646
>>20448631
no that came from Micrographx simply 3d dawg…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448647
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448648
>>20448595
>https://usnewson.com/watch/fox-news-live
Thanks anon. Watching…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448649
Notes ~315
#25085 >>20448296
>>20448595, >>20448571 Trump live for Town Hall with Laura Ingraham
>>20448345 Planefag
>>20448362 The Authoritative Personality (1950), Adorno T. W.
>>20448367 What is Smart Dust?
>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid
>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group
>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine
>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme
>>20448515, >>20448586, >>20448608 Understanding PCR
>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death
>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton
#25085
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448650
>>20448643
it's meth that he smokes, anon
not crack
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7d9c76 No.20448651
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448652
>>20448555
Distraction needed, sanctions won't mean much soon
Remember the discussion last year about the death of the petrodollar once it was not a currency of international trade?
Cairo Officially Ditches American Greenback for Trade
February, 17, 2024
TEHRAN (Tasnim) – In a sign of an unfolding BRICS de-dollarization plan, Egypt has officially started ditching the US dollar in trade.
The country was one of five nations to accept an invitation to join the alliance at its 2023 summit.
The BRICS expansion was the first time the alliance grew since 2001 and had massive geopolitical implications. Alongside Egypt, Iran, Saudi Arabia, the United Arab Emirates (UAE), and Ethiopia have joined the bloc. Now, Egypt has already expressed its desire to move away from the greenback in trade.
Egypt has decisively severed its reliance on the US dollar, aligning itself with the BRICS bloc's strategic move towards de-dollarization.
For much of the last year, BRICS made countless headlines for its activities and initiatives. Those actions were defined by its desire to decrease the international prevalence of the US dollar and to grow its ranks. Subsequently, both of those goals coincide with a development that occurred this week.
Indeed, now part of the BRICS alliance, Egypt is set to ditch the US Dollar in its trade activity, watcher. guru reported.
Specifically, the country’s Ministry of Foreign Affairs stated its intention earlier this week. The country assured that it will work to urge countries it trade within national currencies to lessen the burden of the rising cost of utilizing foreign currencies for settlements.
Furthermore, Egypt said that the decision was a result of a global economic shift. As a matter of fact, they noted the “international crises over the past four years,” as a major development in its decision. Subsequently, it is likely the change in trade currency is rooted in similar factors that have pushed the same action in many of the BRICS nations.
https://www.tasnimnews.com/en/news/2024/02/17/3040570/cairo-officially-ditches-american-greenback-for-trade
More sauce:
Egypt Abandons US Dollar for International Trade
Joy Onuorah 4 days ago
https://businesselitesafrica.com/2024/02/16/egypt-abandons-us-dollar-for-international-trade/?v=7516fd43adaa
Egypt starts getting rid of the US Dollar
Osama Ali Published February 16th, 2024 - 07:49 GMT
https://www.albawaba.com/business/egypt-starts-getting-rid-us-dollar-1553378
Egypt Stops Use Of US Dollar For Trade
By Lucy Adautin February 16, 2024
https://www.theheritagetimes.com/egypt-stops-use-of-us-dollar-for-trade/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a674ae No.20448653
>>20448632
you are forgiving so many anons in your latest psyop slide you must be about to run out
how about you forgive yourself just before you neck yourself?
post livestream when you kys
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
447a0d No.20448654
TTACAAACATTGGCCGCAAA
GCGCGACATTCCGAAGAA
Screenshot attached has some of their other sequences.
I have to double-check them I might have mistyped into my computer one given night but they should be horrible.
These sequences are for regions other than spike.
https://blast.ncbi.nlm.nih.gov/Blast.cgi (site to search when you realize this is a problem to be focused on)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448655
>>20448640
naval a ny, under radar.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
451bf7 No.20448656
https://twitter.com/simonateba/status/1760030827935633577
BREAKING: President Biden just successfully boarded Air Force One after nearly tripping twice. In the end, the 81-year-old President made it safely to the finish line. CONGRATULATIONS Mr. President. WATCH
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448658
>>20448631
Don't Twinkies
Come with
A warranty……18 to life….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b47b6 No.20448659
>>20448609
>>20448628
you could wait for the autopsy
before you dispute the autopsy
Occam's Razor could be of help too:
why publicize an execution?
why do it less than a month before elections?
and
how many Americans even know who Navalny is?
this tempest is not organic, and is being pushed hard by the family that smokes sawdust
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448661
>>20448650
I don't care enough and the difference to even acknowledge the difference.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
447a0d No.20448662
>>20448654
*shouldn't be horrible, I don't expect too many fuck ups in eeeh eeeh fucking letters.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448663
>>20448646
copyright shit ya know
can not photograph offending foods
food disparagement laws
you can find 39% roadkill or euthanized pets in the meat
and
it may be 100% true
but if you SAY IT
you will be sued for "food disparagement"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bb96a No.20448664
>>20448653
>>20448653
Completely and utterly 100% forgiven for your obvious violence shilling as a fed. God bless you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
451bf7 No.20448665
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448666
https://usnewson.com/watch/fox-news-live
Trump!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448667
>>20448661 (edit)
>and the
between the
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a9b5 No.20448668
YouTube embed. Click thumbnail to play. >>20448322
>>20448593
this vid actually
it has most all
of the ride never ends gifs in it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448669
>>20448661
if you don't care about looking stupid, by all means carry on in your ignorance
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dca54c No.20448670
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f18626 No.20448671
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5467b No.20448672
>>20448492
>everyone I don't like is OSS
Everybody drink!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7b9427 No.20448674
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448675
>>20448632
>Justice is irrelevant to forgiveness
…
They are polar opposites. Forgiveness is only possible if you have a bad memory.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448676
>>20448658
Twinkies is what anon finds in his pants after riding motorbike at 200 mph.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
726079 No.20448677
https://thehighwire.com/news/ny-bill-would-allow-children-to-consent-to-medical-procedures/
NY BILL WOULD ALLOW CHILDREN TO CONSENT TO MEDICAL PROCEDURES
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32eca6 No.20448678
YouTube embed. Click thumbnail to play. The documentary delves into the complex and often controversial topic of the depiction of violence by Yahweh, the God of the Bible, and its implications for those seeking moral guidance from the sacred text. Featuring insights from Dr. Joshua Bowen and other preeminent scholars, it meticulously examines the instances where divine commands and actions in the Bible are fraught with violence, raising serious ethical and theological questions. The documentary highlights the lengths to which believers might go to reconcile these narratives with a moral framework, including employing hyperbole or finding justifications for divine decrees that appear morally questionable by contemporary standards. This exploration sheds light on the profound challenges and dilemmas faced by individuals trying to align their faith with modern ethical principles, illustrating the complexities of interpreting ancient religious texts in a modern context.
https://youtu.be/RO_EuhPDdBg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7ac3ba No.20448679
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448680
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
447a0d No.20448681
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
63ef56 No.20448682
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448683
>>20448669
Oh, I'm sorry. I wouldn't want to offend someone by calling them a crackhead when they're a methhead, or vice versa. Who's the idiot now, fuckface? In the filter. Like I said, I don't care enough between the difference to acknowledge the difference. It's a self-destructive hole with those two.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcb2f9 No.20448684
America is the most corrupted country on the planet worse that Israel.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7b9427 No.20448685
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448686
>>20448645
I hear the .mil is worse.
in 2024 when I say Military I have to wonder if they are Illegals, or Mavni or actual foreign attack on us soil, just what the fuck they are.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448687
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448688
>>20448672
This is a post with Punch/Spice.
Blabo.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d9563 No.20448689
>>20448675
No that's forgetting. One can forgive while remembering.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448690
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cd3944 No.20448691
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7b9427 No.20448692
>>20448684
Israel corrupted America numb nuts
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20448693
>>20448517
If the reasons for filtering or filtering were made into a well-written formula, it might reduce the number of filterings.
I'm pretty sure you could state in red text that you were filtered or why, right?
Like this person was filtered for this reason.
Is that what should do instead of filtering?
It might also eliminate mistakes.
But then would get spam and mold all over the place, wouldn't ?
What should do?
Balance of freedom?
Or simply scroll on by?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448694
>>20448684
All the merchants waxed rich from her.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448695
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448696
>>20448595
>https://streamfare.com/foxnews
Thank you Fren!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448697
>>20448650
crack
coc and crack
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6a0f00 No.20448698
>>20448330
you fuckhead….QR is public facing,anyone can post here
finish 3rd grade before posting here you ignoramus
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
385d14 No.20448699
calling a baldwin a faggot is a insult to french nazi xinu juw iphone invades
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448700
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448701
can't tell you a 1000 years ago.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448702
>>20448532
Laura keeps interrupting him.
Did she take lessons from Hannity?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bb96a No.20448703
>>20448689
Forgive the angry baker. He's only human. He doesn't get the point being conveyed. Maybe some day.
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448704
>>20448686
cops are muh neighbors moar good than bad
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
85d398 No.20448705
was just watching the Trump interview on ustvgo fox news and the blocked it. 403 forbidden.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448706
>>20448693
Sorry if that didn't come across well.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448707
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152579 No.20448708
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20448709
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448710
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448711
>>20448676
they are fermented? for a long time
not cooked or baked forget
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0c538d No.20448712
Can a super nice anon post POTUS in SC on FOX here so all we haf to do is push the arrow? Please and TY!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6e6468 No.20448713
Laura Ingraham needs a bitch slapping if she keeps interrupting Trump..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a7819 No.20448714
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861f29 No.20448715
>>20448362
Adorno is "Frankfurt" scholl
Tavistock
Study of Marxism.
Home of "Critical Theory"
https://en.wikipedia.org/wiki/Frankfurt_School
Adorno is said to have written all the songs of the Beatles
Social Engineering project by Marxist and neo-Marxists
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2604ae No.20448716
Can a super nice anon post POTUS in SC on FOX here so all we haf to do is push the arrow? Please and TY!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6a0f00 No.20448717
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448718
>>20448702
Very frustrating!!
Let him speak!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448719
>>20448704
You live next door to a stash house?
That’s messed up.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20448720
>>20448477
checked
>Who benefits with the death of Navalny?
The ©lowns
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448721
See Maui is all Fixed. RIGHT?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3a398 No.20448722
>>20448702
Laura interrupts everybody just like Hannity.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20448723
>>20448659
I thoroughly agree anon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
215f76 No.20448724
YouTube embed. Click thumbnail to play. Doug Sahm and Band Dealer's Blues
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
83894e No.20448725
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448726
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448727
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448728
>>20448716
See here, fren anon posted it…
>>20448595
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448729
>>20448711
Landing a plane on ice will make your ass pucker so tight you don't have that problem
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448730
>>20448693
I've tried to think of a good way to solve some kind of anomalous deletion problem.
Well, but it's been going on for so long that I'm tired of it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448732
>>20448704
well how ever good they are .
They still protect WAR CRIMINALS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20448733
>>20448720
>The ©lowns
Oops
*NOT the ©lowns
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448734
Reading from a Card
Get a vet up there
Vet's don't read cue cards
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d916aa No.20448735
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5467b No.20448736
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7b9427 No.20448737
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448738
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9111ce No.20448739
>>20448505
Its truly bad out there in this regard. We seem to be at 'awakened saturation' point. I'm hoping we get an 'I told you so' moment in the near future to break the bottleneck.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dca54c No.20448740
The United States is already done and finished. You dumfucking tards just don’t realize it yet and it’s ALL YOUR FAULT. USLESS CUNTS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
83894e No.20448741
>>20448595
>>20448595
local fox but at least the ingraham show should show up later tonight.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448742
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6e6468 No.20448743
>>20448702
I mean if she didn't have that nasally annoying voice it wouldn't be so bad but it's like a knife in anon's brain that takes the focus off anything Trump is saying.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
14c3ab No.20448744
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448745
>>20448740
In an Information War
Comms are Vital for Victory
Comms & the Truth
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448746
>>20448740
Then you have to tell them exactly what you want them to do.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448747
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
385d14 No.20448748
divorced butt stuff available
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448749
>>20448732
blunt force
>>20448719
the court ball. noice bums.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448750
>>20448702
from Bannon the Bloviator
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a9b5 No.20448751
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
af132c No.20448752
they get away with all of it because it's a world wide pyramid scheme and they at the top are too big to fail. follow the money. they don't care. to fight the system is suicide [for you] while they live on eternal
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448753
Dis and Mis, a little difference!
Kek!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448754
>>20448617
>>20448641
The "deletion issue" has been a favorite of the shills and schizos trying to throw shade on the BO and BVs
halfmind, VD, last-fag-standing whine about deletion frequently
Behold:
General Research #23139 >>18851346
Not going to work anymore. The cycles are becoming clearer. Gore and cp to test the defenses, then cycle through tons of muh joo, then racist/white supremacy, then some slide like "RRN is legit" and then when the garbage gets tossed, scream "muh censorship"
Bitch about BO and BVs and the truly retarded among you bitch about bakers deleting stuff all you want, not going to work, not going to change anything.
The Fuckitol has taken effect. The continuous bombardment of all the playbook shit has finally done the same thing as the pussyhats screaming nazi, or racist. Overused to the point of uselessness. Game Over shill bois. You have induced "Fuckwad Fatigue" and become nothing but noise to be easily tuned out. Like a dog with fireworks, every now and then, flash and bang and Fido cowers. But this was Fourth of July Finale shit basically 24/7 for six years. You turned Fido into a Cavalry Horse, the shit simply no longer matters. It's "oh, this shit again" and every angle is known.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b8a1b1 No.20448755
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d231d9 No.20448756
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5eff94 No.20448757
>>20448339
>WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage
Excellent discourse.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20448758
>>20448555
None of the sanctions worked before, Bidan is just making Putin and Russia stronger
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448760
>>20448731
God help us
These people are sick evil
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448761
My sheriff is a good sheriff. bla bla bla.
Ya sure about that? Have you TESTED the theory lately?
I thought the same thing.
Do yourself a favor, TEST.
Remember See something say something.
well they seem to want to fuck the people REPORTING THINGS UP.
Yes tell us the GPS coordinates of your house Sir or Mam so we can send the 2K LB bom I mean Help..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448762
>>20448745
If that COMMUNICATION is a honey trap…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
386368 No.20448763
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a06b32 No.20448764
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448765
appears the image server has shit the bed
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448766
>>20448740
True, the old corporation is done!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152579 No.20448767
why did all the images turn into Join or 404?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
408f5d No.20448768
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448769
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448770
>>20448765
Thank You Anon!
I thought that was just my end
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3f7cc No.20448771
>>20448340
turns out you actually CAN grow a pair
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
90d17f No.20448772
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448773
President Trump you look marvelous
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448774
>>20448731
Gen. 6:2 that the sons of God saw that the daughters of men were beautiful; and they took wives for themselves, whomever they chose.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448775
Voting is DANGEROUS because there are SECRET INDIVIDUAL CODE MARKINGS ON YOUR BALLOT THAT MATCH YOU. WHO EVER CONTROLS THIS METADATA COULD FEED IT TO MOLFAR AND HAVE YOU ELIMINATED OFF PLANET EARTH.
THIS IS WHY TRANSPARENCY IS IMPORTANT
THIS IS WHY THE SECRETARY OF STATE OF CALIFORNIA IS THE MOST DANGEROUS PERSON IN THE UNITED STATES
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1297bc No.20448776
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cefe2e No.20448777
https://rumble.com/v4el4p9-young-black-man-schools-old-black-man-on-how-to-do-for-self.html
https://rumble.com/embed/v4bzuv6/?pub=9ikqh
I can't get a rumble vid to embed to save my life….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b5725 No.20448778
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8a7819 No.20448779
who offended the image server
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
189b16 No.20448780
>>20448355
but not a name fag
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7f033a No.20448781
>>20448532
>https://streamfare.com/foxnews
I love Trump. He won't answer her stupid questions and give her the soundbites she wants
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a9b5 No.20448782
Rumble embed. Click thumbnail to play. >>20448765
and right after i went ahead and converted a bunch of fresh gifs
fuck man
heres an embed then👍
the ride truly never ends
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448783
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448784
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448785
>>20448738
You're on Fren!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448786
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448788
>>20448754
Respect for coming right out.(Respect for fast work)
Is this a problem that can be solved by changing the BO?
If so, who would you nominate?
You?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
189b16 No.20448789
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32eca6 No.20448790
>>20448779
I am thinking that Hunter Biden photo did
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
189b16 No.20448791
>>20448786
would those kicks fit inside a scooter?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448792
>>20448775
Somebody might have had a bit too much LDS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448793
>>20448783
>certificate.
this post and the subject matter reflect the incompetence of the 8kun administration.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c804bb No.20448794
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
597e91 No.20448795
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
501cc3 No.20448796
>>20448781
Her low IQ is showing, let her know.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448797
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
99b597 No.20448798
>>20448583
Notice his numerous recorded speeches, both audio and film, are never, never translated or subtitled to English, or other languages for that matter, on the History Channel or other Western Programming, to hear first-hand what is being said.
Only ever snippets of those sentences that serve to propagandize and indoctrinate the audience are permitted.
It was always going to be 'Six Million'. New York Times Friday October 18, 1918 Page 12.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a82bea No.20448799
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a9b5 No.20448800
YouTube embed. Click thumbnail to play. >>20448782
ok then,,,… youtube perhaps for one that always works
kekkitty
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dca54c No.20448801
>>20448754
Found the free speech hating communist censorship fag
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448802
>>20448792
so you are the first of the Cyber Engagement Center VPN to get filtered it is then.
/filtered with predjuce
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6b4c2 No.20448803
q research is a battle cry
do not go gently into that good night
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20448804
Rumble embed. Click thumbnail to play. biggest fundraiser in SC for Trump, $6.5 million. Bannon: "Trump's Representing The American People, He's Putting You First"
Birdbrain will hang on forever.
7:31
https://rumble.com/embed/v4c303r/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448805
>>20448771
That’s incredible on moar than one level!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f64695 No.20448806
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
189b16 No.20448807
>>20448797
shit's gettin' real out there folks
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448808
>>20448791
Can you see it?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448809
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448810
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c2ca2b No.20448811
Laura ingraham
adopted children
supports anti weed legislation
works for the man
overpaid shill
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448812
>>20448788
>Is this a problem that can be solved by changing the BO?
Didn't you try that same shit about three months ago?
Seems like a familiar stench
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
189b16 No.20448813
>>20448808
a special "mark" by Nguyen at the factory?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448814
>>20448808
is that your taint?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
215f76 No.20448815
.>>20448779
>who offended the image server
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152579 No.20448816
https://twitter.com/rawsalerts/status/1760086751484219554
🚨#BREAKING: Confirmed Explosion at a shopping center lockdowns and evacuation in place
📌#Tustin | #California
Currently, numerous law enforcement officers, including the Bomb Squad, are on the scene. As Officials have confirmed that there was an explosion in the Tustin Legacy shopping center or near the Bank of America in Tustin, California. Evacuations and lockdowns are in place, and the FBI is involved as the loud boom could be heard from miles away. It is not immediately known if anyone was hurt this is still developing
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448817
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448818
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6fe189 No.20448819
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32eca6 No.20448820
hunter biden photo that was dropped fucked shit up my guess. Do not see people talking about on pol as stated and appeard to be choke fucking natalie at least that was what I think was implied.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448821
Will show the face and Name of a man that is suspected of killing a child
Won't show the face of the men that fired into a crowd at a parade
So weird
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cdca73 No.20448822
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448823
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a9b5 No.20448824
Rumble embed. Click thumbnail to play. >>20448782
>>20448800
which is better rumble or youtube for embeds
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448825
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5467b No.20448826
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6e6468 No.20448827
Potusonkillimageserver.jpg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448828
>>20448813
>>20448814
You two are very special.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448829
>>20448801
it's the last phase of the QR larp
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68b06f No.20448830
Laura askin' some good Q's
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448831
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6578df No.20448832
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448833
POTUS quotes the 8th amendment
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448834
TRUMP JUST READ THE 8TH AMENDMENT!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6b4c2 No.20448835
was that you Hunter Biden? fucking and filming your niece? who films, daddy Biden?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448836
>>20448703
>He doesn't get the point being conveyed
Condescending guilt trip shill. I see beyond your comprehension.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448837
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448838
>>20448834
>>20448833
We're going all the way to SCOTUS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448839
>>20448835
>who films
this^^^
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448840
>>20448802
Being filtered by you would make me ever so happy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0c538d No.20448841
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5467b No.20448842
https://usnewson.com/watch/fox-news-live
https://usnewson.com/watch/fox-news-live
https://usnewson.com/watch/fox-news-live
https://usnewson.com/watch/fox-news-live
https://usnewson.com/watch/fox-news-live
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448843
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94d11b No.20448844
What the hell did somebody have to image server or what's going on
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20448845
>>20448804
The Allies are freaking out according to Coons because the US wants them to pay their fair share. We are sick if it. The US had very few allies in WWII. They are a protectorate, they are not our allies they sucking off US since WWII. EU caused Ukraine and want us to fund all if it. We will not budge on Ukraine, you broker it, you fix it!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448846
>>20448812
Huh?
What the hell?
I'm just talking about improving the problem.
I just talked to him when was screaming?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20448847
"I'm done" - Ingraham
Trump - I can't!!
Ingraham, you're so stupid!!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20448848
>>20448831
>zero accountability
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448849
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
31d6f5 No.20448850
>>20448702
Laura Interuptus.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448851
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdd8e4 No.20448852
>>20448490
It's a game they're playing. Dave Weiss arrests a long time FBI human source and the source confessed that the $10 million that Hunter and his dad ordered the Burisma owner story was given to him by Russian intel operators and then the Bidens do this make it look like Weiss is working against them.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448853
>>20448812
What the hell?
Go on.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448854
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cdca73 No.20448855
__████████_██████
_____█░░░░░░░░██_██░░░░░░█
____█░░░░░░░░░░░█░░░░░░░░░█
___█░░░░░░░███░░░█░░░░░░░░░█
___█░░░░███░░░███░█░░░████░█
__█░░░██░░░░░░░░███░██░░░░██
_█░░░░░░░░░░░░░░░░░█░░░░░░░░███
____█░░░░░░░░░░░░░██████░░░░░████░░█
____█░░░░░░░░░█████░░░████░░██░░██░░█
___██░░░░░░░███░░░░░░░░░░█░░░░░░░░███
__█░░░░░░░░░░░░░░█████████░░█████████
_█░░░░░░░░░░█████_████_████_█████_█
_█░░░░░░░░░░█__█_████_███_█_█
█░░░░░░░░░░░░█_████_████__██_██████
░░░░░░░░░░░░░█████████░░░████████░░░█
░░░░░░░░░░░░░░░░█░░░░░█░░░░░░░░░░░░█
░░░░░░░░░░░░░░░░░░░░██░░░░█░░░░░░██
░░░░░░░░░░░░░░░░░░██░░░░░░░███████
░░░░░░░░░░░░░░░░██░░░░░░░░░░█░░░░░█
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░█
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░█
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░█
░░░░░░░░░░░█████████░░░░░░░░░░░░░░██
░░░░░░░░░░█▒▒▒▒▒▒▒▒███████████████▒▒█
░░░░░░░░░█▒▒███████▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█
░░░░░░░░░█▒▒▒▒▒▒▒▒▒█████████████████
░░░░░░░░░░████████▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█
░░░░░░░░░░░░░░░░░░██████████████████
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░█
██░░░░░░░░░░░░░░░░░░░░░░░░░░░██
▓██░░░░░░░░░░░░░░░░░░░░░░░░██
▓▓▓███░░░░░░░░░░░░░░░░░░░░█
▓▓▓▓▓▓███░░░░░░░░░░░░░░░██
▓▓▓▓▓▓▓▓▓███████████████▓▓█
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓██
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0669ce No.20448856
>>20448844
double dubs fren…[they're] in a bigPANIC!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20448857
>>20448702
Is she wearing an earpiece?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448858
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448859
Seems 128ducks forgot to renew their certificate.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bf048 No.20448860
>>20448844
chkt
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╣╣╣╣╣╣╢╣╣╢▓▓▓████████████████████████▓▓▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╣╢╢╢▒▒▓██████████████████████████████████▓▓╣▒▒▒▒▒▒▒░░░░░░░░░░░░░
▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢▒▓██████████████████████████████████████████▓▒▒▒▒░░░░░░░░░░░░░░
▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢▓███████████████████████████████████████████████▓▓╢▒░░░░░░░░░░░░░
▒▒▒▒▒▒▒▒▒╢╢╫▓████████████████████████████████████████████████████▓╣▒░░░░░░░░░░░░
▒▒▒▒▒▒╢╣╢╣▓████████████████████████████████████████████████████████▓▒▒░░░░░░░░░░
▒▒╣▒▒╢╢╢╣████████████████████████████████████████████████████████████▒▒▒░░░░░░░░
▒╣╣╢╢╢╢▓█████████████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓████████████████████╣▒▒░░░░░░░
╢╢╢╢╢╢▓███████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█████████████╣▒▒░░░░░░
╢╢╢╢╫▓████████████████████▓▓▓▓▓▓▓▓▓▓▓╣╣╣╣╬╣╢╢╢╢╣╣╢╢╣╣▒╢╢╢╢▓▓▓▓██████████▒▒▒▒░░░░
╢╢╣╢▓▓█████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓╣╬╬╬╣╣╣╢╣╢╢╢╢╢╢╢╣╢▒▒╢╢╢╢╢╢╢▓▓████████▓▒▒░░░░
╣╢╢▓▓███████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╣╣╢╢╢╢╢╢╢╣╣╣╢▒▒▒╢╢╢╢╢╢╢╫╣╢▓▓███████@▒▒░░░
╢╢╣▓▓███████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╢╢╣▒▒▒▒╢╢╢╣╣╣╢▒▒▒▒▒▒╢╢▒▒▒╢╢╢╢▓▓▓███████╣░▒░░
╢╢╢▓▓██████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╬╣╢╣╢╢╢╢╢╢╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╫╬▓▓▓██████▌▒░░░
╢╢▓▓▓█████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢▒▒▒▒▒╢╢╢▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╫╣╣╬╣╢╢▓▓█████▌╣░░░
╫▓▓▓▓███████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓█████████▓▓╣╢╣▒╢╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢▓▓█████╢▒░░
▓▓▓▓▓██████████▓▓▓▓▓▓▓╫▓▓▓▓▓▒▒▒▒▀▀▓█▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▒╢╢▓█████╣▒▒▒
▓╣▓▓▓█████████▓▓▓▓▓▓▓▓▓▓╢╣╢▒▒▒▒▒▒▒▒╢╢╢▓▓▓▓▓▓╣▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▓▓███▓▓▓╣╢▓████▓▒▒▒
▓▓▓▓▓████████▓▓▓▓╣▓▓▓▓╣╢╢╣╣╢╢╢▒▒╢╢▒╢╢╢▓▓▓▓▓╣╢▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▒▒▒▒▒░╙▓▓▓▓████╢╢╢╢
▓▓▓▓▓▓███████▓▓╢╢╢╢╢╢╢╢▓▓▓▓▓▓██████▓▓▓▓▓▓▓▓▓╣╣▒▒▒▒▒▒▒▒▒╢╢╢╢╣▒▒▒▒▒▒▒░░╠▓▓███▓▓▓▓▓
▓▓▓▓▓▓▓█████▓▓╣╢╢╢╣╢╢╣▓▓▓████▀▓▓▄▒╙▀▓▓▓▓╣╢▓▓▓╣▒▒▒▒▒▒╢▓▓▓╢╢▓▓▓▓▓▓▓▓▓▒▒▒▓▓██▓▓▓▓▓▓
▓╢▓╣╫▓▓▓▓▓██▓╣╣╢╢╣╣╣▓▓▓▓▓█▓╣▒█████▓ ▀▓▓▓╣▓▓▓╣╣▒░░▒╢╣╣╢▓▓▓▓▓▓▀▀▀███▓▓╣╢▓█▓▓▓▓▓▓▓
▓╣╢╫▓▓▓▓▓▓██▓╣╢╢╢╢╢╢╢▓▓▓▓▓▓▓▓▓████▀,░▒▓▓▓╢╢╢╢╣╣▒▒▒▒╢╢╢▓▓▒▓████▌ '▓██▓▓╣▓▓▓▓▓▓▓▓▓
▓▓╣▓▓▓▓▓▓▓▓▓▓╣╢╢╢╢╢╢╢╢╢╢╢╢▓▓▓▓▓▓▓▓▓▓╣╢▒╢╢╢╢╢╣╣╣▒▒▒▒▒▒▒╫▓▓▓█████░╥▓▓▓▓╣▒▓▓▓▓▓▓▓▓▓
▓▓╣▓▓▓╣╣▓▓▓▓▓▓╣╣╢╢╢╢╢╢╢╢╢╣╢╢╢╢╣╣╢╣╣▒▒▒▒╢╢╢╢╢╢╢╣▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▓▓▓▓▓▒▒▒▐▓▓▓▓▓▓▓▓
▓▓╣╣╢▓▓▓╣▓▓▓▓▓▓╣╢╢╢╣╢╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╢╢╢▒▒▒▒▒▒▒▒░░▒▒╢╢▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓
▓▓▓╢▓╣╢▓▓╢▓▓▓▓▓╣╢╢╣╢╣╣╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╢╢╣▒▒▒▒▒▒▒░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓
▓▓▓▓╢╢╣▓▓▓▓▓▓▓▓╣╢╢╢╣╢╢╢╢╢╣╢▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╣╢╢╢╣▒▒▒▒▒▒▒░░░░░░░░░░░░░░▒▒▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓╣╢╢▓▓▓▓▓▓▓╣╢╢╢╢╢╢╢╣╢╣▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▓╣╢╣╣▒▒▒▒▒▒▒░░░░░░░ ░░░▒▒╫▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓██████▓╣╣╣╢╢╢╢╢╢╢╢╢╢╣▒▒▒▒▒╢╫▓▓▓▓▓▓╢╢╢╢╢▒▒▒▒▒▒▒▒▒▒▒░ ░░░░░▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓██████▓╣╣╢╢╢╢╢╢╢╢╢╢╢╢╣▒▒▒▒╢╢▓▓▓▓▓▓██▓▓▓▓╢╣╣╢▓▓▓▓╫╣▒░░░░ ░░▒▒▒╫▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓████████╣╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣▒▒▒▒╢╢╢╢▓▓▓▓▓▓╢▓▓▓▒▒▒╫▓╣▒╢▒▒░░░░░░░▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓██████████╣╢╢╢╢╣╢╢╢╢╢╣╣╣╢╣╣▒▒▒╢╣╢╣╣╣╣╣╣╣▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓
▓████▓▓▓▓▓▓▓█▓▓╢╢╢╢╢╢╢╢╢╣╣╣╣╣╢╢╢╢╢╢╣╢╢╣╢╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓██▓▓▓▓▓▓▓▓██▓╢╢╢╢╢╢╢╢╢╢╢╣▓▓▓▓╣╣╣╣╣╣╢╣╢╣╢╣╢╢▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓██▓▓▓▓▓▓▓▓▓▓██▓╣╢╢╢╢╢╢╣╣╣▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣▒▒▒▒▒▒▒▒▒▒▒▒▒╫▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓██▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╢╢╣╣▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒╢╣▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓██▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╬▓▓▓▓╢╢╢╢╣▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓█▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢╣▒▒▒╢╣▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢▓▓▓▓▓▓▓▓▓▓▓▓╣╣╢▒▒╢╣▒▒▒╢╢╢╢╫▓█████▓▓▓▓▓▓▓▓▓▓▓▓
▓▓▓▓▓▓▓▓▓▓▓▓▓████▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╣╣╢╢╢╢╢╢▓▓▓╣╣╣▒▒▒▒▒▒▒▒╢╢╢╫▓▓▓▓▓█████████████▓▓
▓▓▓▓▓▓▓▓▓██████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢╢╢╢╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╣▓▓▓▓▓▓██████████████
█████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢╢╢╣▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╣╢╢╫▓▓▓▓▓██████████████
████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╢╢╢╣╣▒▒▒▒╢╢╣╣▒▒╢╢╢╣▓▓▓▓▓██████████████
███████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╢╣╣▒▒▒╢╢╢╢▓▓▓▓██████████████
▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀╩╩╩╩╩╩╩╩╩╩╩╩╩╩▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448861
>>20448765
Prob cuz Hunter pics are dropping.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
215f76 No.20448862
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c7cf6c No.20448863
they worry about vengeance
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ebf9d8 No.20448864
>>20448367
>Similar to microplastics, smart dust
Looks like I was right about this dust being nano particulates of plastics and nylons but there is more to it than this. There are nano particles of soft metals, bio-agents like larva, nematoads, and germ warfare admixtures depending on the illness and disease that the DS is looking to cause; think of each of these as dials. Trump later called this dust "China dust" at a rally after I asked the Q team to come take samples from in front of my house as saboteurs were spraying liquids that dry into this dust. This is why I always said, Covid is/was local from chemical knitters. I asserted that this is the number one cause of illnesses, disease, and deaths worldwide; and one day I will be proven 100% correct on this. This didn't start with Covid, but as far back as specialized children hospitals and their specialized drives to raise funds for them by the rat pack.
Logical Thinking…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8aec8 No.20448865
YouTube embed. Click thumbnail to play. >>20448841
probably that bitch
going with youtube for now since it shows an image
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a58f5c No.20448866
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448867
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448868
>>20448858
I Still Haven’t Found What I’m Looking For
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448869
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448870
>>20448798
I noticed your shit is old and boring like it's been for the last six years
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f18ab7 No.20448871
United Airlines flight #UA354, a Boeing 757-224, diverted to Denver International Airport, Colorado, USA, after pieces from the inner leading edge slat of the right-hand wing had broken off.
https://twitter.com/AviationSafety/status/1759994913800818896
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448872
>>20448861
anon's "Fire Fauci" was the last image seen on this end
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5314ab No.20448873
American people are so stupid they don't even know their country is usurped….lmao
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b47b6 No.20448874
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
674f04 No.20448875
>>20448864
I I I me me my shill is at it again.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0114c No.20448876
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448877
>>20448868
What do you want?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448878
Trump has big feet!
Great understanding!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20448879
Sounds like some people don't like winning.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0c7e1 No.20448880
another day into Black History month and nothin
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94d11b No.20448881
>>20448847
Hey I don't have a TV what's going on did Trump walk out
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448882
>>20448873
ching chang chong
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68b06f No.20448883
>>20448867
love it! thank you anon!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448884
>>20448876
Causation exists.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7d7ccb No.20448885
>>20448855
Old skool tactics! Top Kek!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448886
Stupid people who like Trump’s policies but not him
How ignorant
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448887
>>20448801
Kinda early for your projection, but screw it I need something to chuckle at until somebody gives the image server a kick
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ae33 No.20448888
>>20448788
>If so, who would you nominate?
on a board that decries any form of self identification, how to identify an anon to serve as BO?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49200f No.20448889
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448890
>>20448886
cap your post
for posterity keks
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20448891
>>20448705
https://usnewson.com/watch/fox-news-live
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5a9a9e No.20448892
>>20448881
>Hey I don't have a TV
You have internet ….
https://streamfare.com/foxnews
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448893
>>20448873
don't you have some blm to kneel to or some illegals to load on a flight or bus?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448894
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448895
>>20448844
wind the clock on device this is not rocket scientists appliances salesman
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448896
Laura, shut up after you ask him a question
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20448897
MY REVENGE WILL BE SUCCESS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68b06f No.20448898
>>20448883
sorry liked the original better. had muted listening to POTUS. I rescind my previous comment
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0c7e1 No.20448899
is this website broken again?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20448900
Rumble embed. Click thumbnail to play. Bannon: "The Invasion Is Full On". Re Ukraine: We are not doing $60 billion, because its just going to kill more Ukrainians and arm them more to destroy themUkrainians are fleeing from the country, because they know they are being sent to Charnel House of death. And the EU wants that with a war they started.
9:55
Bafomet and Moloch must be fed
https://rumble.com/embed/v4c3345/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448901
YouTube embed. Click thumbnail to play. After every number they would pass the hat
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0c7e1 No.20448902
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
676f0e No.20448903
Laura gonna have highest viewership this week and she’s trying to show how smart she is. Which she isn’t
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448904
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448905
>>20448899
no change clock time manually on device.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c27ebb No.20448907
>>20448896
Laughing Apu smoking cig png
Indeed!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448908
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448909
>>20448803
QR is where trillions in propaganda machine gets jacked up by memes and the morans can't figure out what to do about it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e45293 No.20448910
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
91ae33 No.20448911
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
189b16 No.20448912
>>20448828
oh
you mean Hunters line of coke?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0caa5 No.20448913
>>20448889
>>20448871
DIVERSITY SHITBALLS NEED TO BE REMOVED FROM ALL AREAS OF THE MANUFACTURING INDUSTRY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20448914
Lotta Tictok is good Commericals
ICYMI
Ticktok is A China Weapon to destroy our youth
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6578df No.20448915
>>20448910
POTUS will never tell her
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448916
>>20448894
the best is yet to come?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68b06f No.20448917
>>20448898
>sorry liked the original better. had muted listening to POTUS. I rescind my previous comment
>>20448867
got the original without the music?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e2f5c No.20448918
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448919
Q Research: the glowing epitome of government agency incompetence
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448920
Notes ~580
#25085 >>20448296
>>20448595, >>20448842, >>20448571 Trump live for Town Hall with Laura Ingraham
>>20448345 Planefag
>>20448362, >>20448715 The Authoritative Personality (1950), Adorno T. W.
>>20448367 What is Smart Dust?
>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid
>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group
>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine
>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme
>>20448515, >>20448586, >>20448608 Understanding PCR
>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death
>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton
>>20448652 Egypt Stops Use Of US Dollar For Trade - Joins BRICshitters
>>20448677 NY Bill would allow children to consent to medical procedures
>>20448804 Bannon: Trump's Representing The American People, He's Putting You First - Biggest fundraiser in SC for Trump, $6.5 million
>>20448816 Tustin, California: Confirmed Explosion at a shopping center lockdowns and evacuation in place
>>20448871 United Airlines flight #UA354, a Boeing 757-224, diverts after pieces from inner leading edge slat of right-hand wing broke off
#25085
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0c7e1 No.20448921
did the truckers blockade NYC?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b3ce0 No.20448922
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20448923
>>20448916
THE BEST IS YET TO COME!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
99b597 No.20448924
>>20448870
Wow, the best you got. You're right though, this shit is 2000 years old.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3f42e6 No.20448925
>>20448921
Did Tater trip up the stairs today?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8aec8 No.20448926
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
861f29 No.20448927
>>20448731
Frankfurt School and Tavistock use mind Control techniques for Cultural engineering.
https://archive.schillerinstitute.com/new_viol/cybmindcontrol_js0400..html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448928
Enjoy Chem Trail Rain
The SHERIFF Protects Chem trails. They protect the Airport from you snooping to find out about the Chemtrails.. THEY ARE WITH THEM
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdd8e4 No.20448929
>>20448903
Fox seeded the audience with scripted and rehearsed questions. Especially the women who asked: Can you convince the 'undecideds' without seeking revenge? DJT gave a tremendous answer which force Laura to give herself away.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448930
>>20448912
Haha that took a long time! But no, it was about seeing images here. I didn't see anything, but it's coming back.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d56f5 No.20448931
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448932
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448933
>>20448816
Is it too late or can I enter the Betting Pool with "Meth Lab goes boom?"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20448934
>>20448881
Laura Ingraham admits women are the problem.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68b06f No.20448935
>>20448932
much appreciated
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
544a35 No.20448936
>>20448933
dubs and trips chekt! kek!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7d9c76 No.20448937
trump doesn't have confidence in election process either after a stolen election was proven, so what game are we playing by voting
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448938
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448939
>>20448933
bookmaker is offering 1-9 odds on that
not worth it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0caa5 No.20448940
>>20448893
Old bitch shut your hole.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6dc10 No.20448941
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448942
Laura Ingraham doesn't know who Virginia Benassi is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448943
>>20448888
nora the bugz no
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20448944
lo WHO do they want for VP?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448945
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448946
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0caa5 No.20448947
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448948
>>20448940
how about some more of that goot ol pro-active policing
That way I can tell if you are doing your job.
Hey that fuckers looking at me!
GOOD hes doing his job
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448949
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
386368 No.20448950
Laura Ingraham looks desperate to be number one and she wants her old time slot back from Jessie Watters.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448951
qpost #4515
Feb 2019
[ing] error
ingraham / img
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0caa5 No.20448952
>>20448948
Old fat lesbian shut the hell up~
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448953
>>20448367
Started the dust programs in 92
By 2015 they admitted to this
Mission impossible thingies
https://www.news.xerox.com/news/PARC-extends-contract-with-DARPA-for-DUST-Technology
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20448954
>>20448950
Ingraham jumped the shark when she left AM Radio. She's lost her edge.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20448955
>>20448937
>what game are we playing
the only game in town anon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20448957
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448958
>>20448952
/filtered
cyber engagement center wasting my time
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4efaa2 No.20448959
>>20448954
Never could stand her. That voice and demeanor in general are annoying af
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20448960
Qpost #4515
Feb 2019
[ing] error
ingraham / img server
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448961
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448962
>>20448949
this place is irregular blend in
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3f0e8f No.20448963
>>20448900
> themUkrainians are fleeing from the country, because they know they are being sent to Charnel House of death. And the EU wants that with a war they started.
Who would want all white people eliminated?
EU?
America?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a8aec8 No.20448964
>>20448928
stolen elections suck
meanwhile our sheriff is raiding vape shops with massive militarized task force looking for delta anything
and small foreign childrenand fentanyl flows freely
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2e2f5c No.20448965
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448966
>>20448949
how did you end up on a fed board?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20448967
So is the continued posting, knowing the image server has shit the bead, part of that "pre-packaged five prong injection" thing or do I just need to take a pot to see the images again?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0c538d No.20448968
>>20448959
Some anon filter Ingraham!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448969
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448970
Laura Ingram is successful because she don't ask certain things. If you are listening to Laura Ingram you'll miss the schwang wu filters an Johnson controls
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0c318e No.20448971
>>20448490
Stardust showers or sawdust crack pipes. Glorious - classic. Drywall dust is not for cry babies
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f03823 No.20448972
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0caa5 No.20448973
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
980f11 No.20448974
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
659cbf No.20448975
>>20448963
>Who would want all white people eliminated?
lol….
you know the answer
next asking questions is going to get anons deleted
wait for it…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bf048 No.20448976
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4efaa2 No.20448977
>>20448970
Give it a rest already
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0669ce No.20448978
>>20448974
they borked it cause POTUS tonight
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21b84f No.20448979
YouTube embed. Click thumbnail to play. Putting a ton of dust in the air
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20448980
YouTube embed. Click thumbnail to play. ▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒
▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▄░░▒▒▒▒▒
▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░██▌░░▒▒▒▒
▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░▄▄███▀░░░░▒▒▒
▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░█████░▄█░░░░▒▒
▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄████████▀░░░░▒▒
▒▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░▒
▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄███████▌░░░░░░░▒
▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░░▒
▒░░░░░░░░░░░░░░░░░░░░░▄███████████▌░░░░░░░░▒
▒░░░░░░░░░░░░░░░▄▄▄▄██████████████▌░░░░░░░░▒
▒░░░░░░░░░░░▄▄███████████████████▌░░░░░░░░░▒
▒░░░░░░░░░▄██████████████████████▌░░░░░░░░░▒
▒░░░░░░░░████████████████████████░░░░░░░░░░▒
▒█░░░░░▐██████████▌░▀▀███████████░░░░░░░░░░▒
▐██░░░▄██████████▌░░░░░░░░░▀██▐█▌░░░░░░░░░▒▒
▒██████░█████████░░░░░░░░░░░▐█▐█▌░░░░░░░░░▒▒
▒▒▀▀▀▀░░░██████▀░░░░░░░░░░░░▐█▐█▌░░░░░░░░▒▒▒
▒▒▒▒▒░░░░▐█████▌░░░░░░░░░░░░▐█▐█▌░░░░░░░▒▒▒▒
▒▒▒▒▒▒░░░░███▀██░░░░░░░░░░░░░█░█▌░░░░░░▒▒▒▒▒
▒▒▒▒▒▒▒▒░▐██░░░██░░░░░░░░▄▄████████▄▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒██▌░░░░█▄░░░░░░▄███████████████████
▒▒▒▒▒▒▒▒▒▐██▒▒░░░██▄▄███████████████████████
▒▒▒▒▒▒▒▒▒▒▐██▒▒▄████████████████████████████
▒▒▒▒▒▒▒▒▒▒▄▄████████████████████████████████
████████████████████████████████████████████
████████████████▀████████████████████████████████████████
█▄─▀█▄─▄█▄─▄█─▄▄▄▄█─█─█─▄─▄─███─▄▄▄▄█─█─█▄─▄█▄─▄▄─█─▄─▄─█
██─█▄▀─███─██─██▄─█─▄─███─█████▄▄▄▄─█─▄─██─███─▄█████─███
▀▄▄▄▀▀▄▄▀▄▄▄▀▄▄▄▄▄▀▄▀▄▀▀▄▄▄▀▀▀▀▄▄▄▄▄▀▄▀▄▀▄▄▄▀▄▄▄▀▀▀▀▄▄▄▀▀
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
659cbf No.20448981
>>20448928
> THEY ARE WITH THEM
time for them to die with them?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f6a14 No.20448982
it was just a bit o' pixie dust
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0caa5 No.20448983
Baby sitter looking for work.
867-5309
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20448984
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20448985
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8b511e No.20448986
>>20448937
in theory there are more stings in effect this round.. its like when someone keeps eating your sandwich out of the fridge at work, so you keep making it and keep storing it in the fridge but start jizzing in it at home before taking it in
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e6d2e9 No.20448987
How do Anons feel about buying power tools from pawn shops as opposed to top dollar and new?
Homeowner renovations. Not commercial use.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c63fb7 No.20448988
Anon admits it. Anon loves Chuck Norris (no homo). He came up in conversation, so looked things up not really knowing anything about him, personally. Had only surmised he’s generally a “conservative” badass. Found a GREAT piece he wrote in 2020: Top 15 accomplishments of Trump's presidency Exclusive: Chuck Norris meets his match trying to narrow down scores of achievements By Chuck Norris Published November 2, 2020 at12:54pm
https://archive.is/jyOKl
However, he writes: You can knock Trump for his character flaws, but here are what we see as the top 15 accomplishments for which we all – Republican, Democrat and Independent – should be grateful and proud. America, the world and our lives are better for them.
Oh fuck, yet another one with the same tired SMEAR. WHY?
OK Chucky, since you just had to get that in, please elaborate on your findings? Certainly Melania, Eric, Barron, etc. would be happy to confirm your astute observations, since you’ve apparently lived with him, being close enough to know such things because (UNLIKE yourself, Joh. & Di., of course): Trump was married to Ivana from 1977 until 1990; Didn’t marry Marla until 1993, after which Tiffany was born… so it can’t be “OMG!divorced!”), can it?
Ahhh!!! You must mean the pussy tape!!! when he mocked gold-digging groupies in a PRIVATE man-on-man conversation! And/OR how about when he mocked treasonous (<— Understatement of the Ages) noname on TV? You served our Country. Look into noname and how many Navy soldiers’ (among countless others’) blood is on his hands, why don’t you. Is it really a “character flaw” to NOT speak like a scripted, limp-wristed PUSSY, as ALL entrenched “conservative” politicians happen to BE? Apparently so!
He continues: Whether or not we accept it, it's the truth: Trump has done more in 47 months then Joe Biden did in 47 years as a senator and vice president. With 47 years of attempts, hasn't Biden been given enough time to clean and change the D.C. swamp? 47 years? Time's up! https://www.wnd.com/2020/11/top-15-accomplishments-trumps-presidency/
If CN’s gonna bring up “character flaws” (avoiding MUCH WORSE), THIS would have been the time to do it. All the KNOWN TREASON w/china,ukraine, ETC. aside here, Ashely’s Diary with the SHOWERS was confirmed back in fucking OCTOBER of 2020, and the footage of bidan fondling very young and very obviously uncomfortable children and even pinching one little girl’s NIPPLE (VID1) were well-known for YEARS prior (via the Internet and on OAN)… So are you saying that biden’s “ineptitude” is the worst thing about him, Chucky?
fucking “conservatives” can’t do anything sans the usual unwarranted SMEAR. It’s much worse when somebody of the VERY few respected and admired does it. Infuriating. Stopped watching (the Divorced) Dan Ball for the same fucking reason - “Trump has sinned!” Fucking assholes. You don’t KNOW “sinned” until looking into the likes of noname, the bushes, and even (the Divorced) Red ronnie, the “great communicator” Gold Standard, LOL (SEE VID2 as you observe the COMMUNIST COUNTRY you presently reside in). STOP comparing President TRUMP to these emasculated bastards.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a06b32 No.20448989
funny the way people can't see the chemtrails for the anomaly they are.
only the old people can remember what the skies used to look like, should look like, and the old people are the number one group slated for extermination
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448990
They don't like what we named their ancestors.
Those FALLEN sure are a grumpy bunch. Sheesh, Lizards have bad tempers.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448991
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20448992
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448993
>>20448964
I can sympathize with the sheriff situation. Maybe they help one business over another or maybe they are just retarded ass.
I have never said the elections are stolen. I am gona be an echo and be clear about this again. I said there are BAD people on the Ballot as a choice. and this is because of the national security background checks and I guess broken oaths. 70 years of it in different forms.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448994
>>20448977
don't you have some blm to kneel to or some illegals to load on a flight or bus?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
56ae9d No.20448995
Haley is waiting for her chance?
What does she know?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20448996
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
45a5a6 No.20448997
>>20448979
Wonder if Hunter ever smoke this dust.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b7d46 No.20448998
>>20448990
call them pigs
Comparing animal rights and the Holocaust
Naomi Pfefferman
Naomi Pfefferman
October 10, 2012
On Oct. 2, Alex Hershaft, a Holocaust survivor and founder of the nonprofit Farm Animal Rights Movement (FARM), sat on the ground with some 100 other protesters in front of the Farmer John pig slaughterhouse in Vernon, Calif., blocking the entrance from two bi-level trucks carrying 200 pigs that had arrived to be slaughtered that day. In the next 24 hours, the pigs would be among 6,000 animals that would be stunned by electrical shock, hoisted up by their hind legs and their necks slit in the plant, which is the largest pig slaughterhouse on the West Coast.
The demonstration was just one of more than 100 such protests held across the United States and in other countries commemorating FARM’s annual World Farm Animals Day.
“You could hear the pigs on the trucks crying,” Hershaft, 78, said quietly in a phone interview from his Bethesda, Md., home several days later. “Despite my advanced age, I made the trip to Vernon and risked arrest, because, as a Holocaust survivor, I am honor-bound to call public attention to this ongoing tragedy.”
As a 5-year-old in the Warsaw Ghetto, Hershaft witnessed brutal beatings and shootings and saw Jews dying of typhus in the streets. After being smuggled out of the ghetto by a family maid, he survived the war by passing as an Aryan. Upon liberation, he learned that his father had died following internment in a German slave labor camp, and that most of his other relatives had also perished…https://jewishjournal.com/mobile_20111212/108867/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20448999
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20449000
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
17020f No.20449001
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4efaa2 No.20449002
>>20448994
Are you retarded? You sound retarded.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20449003
>>20448991
Usually it's because someone forgot to update the certificate or somesuch administrative nonsense.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20449004
>>20448993
>I have never said the elections are stolen.
well what the fuck is wrong with you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9c9844 No.20449005
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20449006
>>20449004
/filtered
no childish discussion. I ain't playing that shit,
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20449007
next bread title?
"My Revenge Will Be Success"
>>20448920
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f03823 No.20449008
>>20448991
Anon just roll with it easy..a lil choppy water while board's under attack.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0caa5 No.20449009
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
151104 No.20449010
>>20448740
if it is all over and done with, why are you still here?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
726079 No.20449011
https://health.mo.gov/living/wellness/immunizations/pdf/ClinicalUseandBenefitsofStateIIS.pdf
What are Immunization Information Systems (IIS)?
Quote: "All US states, territories and even some large cities (e.g. Chicago, NYC, LA, DC) have IIS"
This looks like a whole lot of information could get connected together about each person.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
843384 No.20449012
>>20448490
Yeah- my brother went to rehab for “sawdust” addiction
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94d11b No.20449013
Join or 404 this going to go for 1 1/2 days again
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
726079 No.20449014
>>20448991
Better question: How is it I can post again?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20449015
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41f0cb No.20449016
>>20448875.
Wrong, understand what dialed in means, I said these things to further the investigations as one ingredient was confirmed; not to hear you cry. I said the #1 killer in the world, go do some work instead of mouthing off.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20449017
>>20449013
fuck it
Giant Meteor incoming
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20449018
>>20448974
powers out
don't flush the turlet
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20449019
>>20448987
threat plan middle eastern pawn shop owner recycles American and Canadian nuildimg contractors 2wice. first on stollel vehicles then recycle the retards tools win both ends. truck dealership
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20449020
Rumble embed. Click thumbnail to play. Natalie Winters On Russia Being Called Our Main Enemy: "Community Service For The CCP". She spells it out why Ukraine, why congress got away with sending billions over seas for decades with no accountability. And exactly why they are freaking out, the American people are saying NO MORE money to Ukraine. This whole thing us being pushed and used by CCP warfare against the US
13:05
https://rumble.com/embed/v4c3a53/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20449021
YouTube embed. Click thumbnail to play. * you keep saying the election is stolen
A little thing about REALITY anons.
STOP SAYING IT WAS STOLEN
(say bad people were on the ballot as a choice!)
https://www.youtube.com/watch?v=Rbeq2-CCFmE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9c9844 No.20449022
>>20448991
It is exactly this.
Cert expired.
Anon discovered after posting imaginary meme last post.
>>20449003
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ed5760 No.20449023
Bernie bitching about the cost of living while we ship shekels overseas.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b7289 No.20449024
>>20449012
⠀⠀⢠⣿⣿⣶⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣶⣿⣿⡄⠀⠀
⠀⢠⣾⣿⣿⡿⠉⢿⣿⣿⣿⣿⣿⣿⡿⠉⢿⣿⣿⣷⡄⠀
⠀⠘⢿⣿⣿⣇⣠⣿⡿⠛⠉⠉⠛⢿⣿⣄⣸⣿⣿⡿⠃⠀
⠀⠀⣼⣿⣿⣿⣿⡋⠀⠀⠀⠀⠀⠀⢙⣿⣿⣿⣿⣧⠀⠀
⠀⣸⣿⣿⣿⣿⣿⣿⣾⣇⣀⣀⣸⣷⣿⣿⣿⣿⣿⣿⣇⠀
⣰⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣆
⣿⣿⣿⣿⣿⣿⠿⠟⠛⠉⢸⡇⠉⠛⠻⠿⣿⣿⣿⣿⣿⣿
⢻⣿⣿⣿⣿⣿⡇⠀⠀⠀⢸⡇⠀⠀⠀⢸⣿⣿⣿⣿⣿⡟
⠀⠻⣿⣿⣿⣿⣿⡀⠀⠀⢸⡇⠀⠀⢀⣿⣿⣿⣿⣿⠟⠀
⠀⠀⠈⠻⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⠟⠁⠀⠀
⠀⠀⠀⠀⠈⠙⠻⢿⣿⣿⣿⣿⣿⣿⡿⠟⠋⠁⠀⠀⠀⠀
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20449025
>>20448994
Would I sound mean if I said LaGuardia is kinda out because weather and trucks don't deliver to the Rotten Apple anymore?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59f738 No.20449026
>>20449017
deploy the fuck reeeeeeeee meme png.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20449027
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c63c9e No.20449028
>>20449017
it's our only chance
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94d11b No.20449029
>>20449017
That'll fix it for sure
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20449030
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cb303 No.20449031
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
726079 No.20449032
https://apnews.com/article/prison-to-plate-inmate-labor-investigation-c6f0eb4747963283316e494eadf08c4e
Prisoners in the US are part of a hidden workforce linked to hundreds of popular food brands
Quote: "Intricate, invisible webs, just like this one, link some of the world’s largest food companies and most popular brands to jobs performed by U.S. prisoners nationwide, according to a sweeping two-year AP investigation into prison labor that tied hundreds of millions of dollars’ worth of agricultural products to goods sold on the open market."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9c9844 No.20449033
>>20449013
Fuck off.
Who needs images on an image board anyway
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f18ab7 No.20449034
>>20448740
Whatever you say bub
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdd8e4 No.20449035
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20449036
>>20449007
I was thinking moar dramatic along Qpost delta lines for next one and image server stuff. White Squall.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20449037
(o)(o)
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒
▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▄░░▒▒▒▒▒
▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░██▌░░▒▒▒▒
▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░▄▄███▀░░░░▒▒▒
▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░█████░▄█░░░░▒▒
▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄████████▀░░░░▒▒
▒▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░▒
▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄███████▌░░░░░░░▒
▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░░▒
▒░░░░░░░░░░░░░░░░░░░░░▄███████████▌░░░░░░░░▒
▒░░░░░░░░░░░░░░░▄▄▄▄██████████████▌░░░░░░░░▒
▒░░░░░░░░░░░▄▄███████████████████▌░░░░░░░░░▒
▒░░░░░░░░░▄██████████████████████▌░░░░░░░░░▒
▒░░░░░░░░████████████████████████░░░░░░░░░░▒
▒█░░░░░▐██████████▌░▀▀███████████░░░░░░░░░░▒
▐██░░░▄██████████▌░░░░░░░░░▀██▐█▌░░░░░░░░░▒▒
▒██████░█████████░░░░░░░░░░░▐█▐█▌░░░░░░░░░▒▒
▒▒▀▀▀▀░░░██████▀░░░░░░░░░░░░▐█▐█▌░░░░░░░░▒▒▒
▒▒▒▒▒░░░░▐█████▌░░░░░░░░░░░░▐█▐█▌░░░░░░░▒▒▒▒
▒▒▒▒▒▒░░░░███▀██░░░░░░░░░░░░░█░█▌░░░░░░▒▒▒▒▒
▒▒▒▒▒▒▒▒░▐██░░░██░░░░░░░░▄▄████████▄▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒██▌░░░░█▄░░░░░░▄███████████████████
▒▒▒▒▒▒▒▒▒▐██▒▒░░░██▄▄███████████████████████
▒▒▒▒▒▒▒▒▒▒▐██▒▒▄████████████████████████████
▒▒▒▒▒▒▒▒▒▒▄▄████████████████████████████████
████████████████████████████████████████████
████████████████▀████████████████████████████████████████
█▄─▀█▄─▄█▄─▄█─▄▄▄▄█─█─█─▄─▄─███─▄▄▄▄█─█─█▄─▄█▄─▄▄─█─▄─▄─█
██─█▄▀─███─██─██▄─█─▄─███─█████▄▄▄▄─█─▄─██─███─▄█████─███
▀▄▄▄▀▀▄▄▀▄▄▄▀▄▄▄▄▄▀▄▀▄▀▀▄▄▄▀▀▀▀▄▄▄▄▄▀▄▀▄▀▄▄▄▀▄▄▄▀▀▀▀▄▄▄▀▀
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20449038
>>20449035
/filtered
one word wonder.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20449039
>>20448995
She knows that 15K wasn't worth it
Democrats: Nikki Haley “Sold Out Port” For $15K
September 16, 2013
Charleston, SC — This morning, Vice President Joe Biden, Charleston Mayor Joe Riley, Congressman Jim Clyburn and other leaders who have long-understood the importance of the Port of Charleston for South Carolina’s economy, held an event at the Port to talk about the need for deepening. Governor Nikki Haley, who sided against the Port in exchange for campaign contributions in 2011, also took the stage and said “This has to happen” in a stunning display of hypocrisy.
“Nikki Haley raised the bar on her own personal record on hypocrisy talking about the Port in Charleston today – and that’s saying a lot,” said Kaye Koonce, First Vice Chair of the South Carolina Democratic Party and a Charleston resident. “Now that the cameras are on, Nikki Haley suddenly cares about deepening the Port of Charleston but when push came to shove, she sold us out for 20 pieces of silver.”
“Nikki Haley could have supported dredging at the Port of Charleston in 2011 and brought jobs and an economic boost to our state,” Koonce continued. “Instead, Nikki Haley gave the competitive edge to Savannah in order to raise money for her reelection campaign. Well, fool us once, shame on you – and no matter how hard Nikki Haley tries the people of South Carolina won’t be fooled again.”
Haley Received $15K from a Georgia fundraiser prior to port deal that gave Savannah an edge over Charleston and hurt the state’s economic future. “Gov. Nikki Haley faces increasing questions over her role in a decision that helped Savannah gain a competitive advantage over the Port of Charleston, the state’s main economic engine. New concerns arose over two recent events: Haley’s refusal to attend a Senate hearing next week on the matter, and revelations that she raised $15,000 at a Georgia fundraiser 13 days before the S.C. Department of Health and Environmental Control approved dredging Savannah’s harbor. That Nov. 10 approval came about six weeks after the agency denied the request over water-quality issues the dredging would cause.” [Post & Courier, 11/24/11]
Haley Sold Charleston Port Down River. “Last week, Georgia Gov. Nathan Deal put out a statement to thank our own Nikki Haley ‘and others’ for helping out with the expansion of the Savannah port. That sure was nice of him. Of course it’s the least he could do, seeing as how our governor and “others” — her hand-picked Department of Health and Environmental Control board cronies — sold out South Carolina and the Charleston port for him. The DHEC board recently approved a controversial permit to dredge the Savannah River, a move that literally will put the river on life support and could cost this state billions.” [Post & Courier, 11/20/11]
Pay to Play Politics at its Worst. “An investigation has uncovered plane rides and large campaign contributions that some say show a cozy relationship between Gov. Haley and the DHEC board….Gov. Haley attended a fundraising event in Georgia just two weeks before DHEC approved the Georgia dredging permit. The event raised money from Georgia businesses to fund Gov. Haley’s 2014 re-election campaign. Before Gov. Haley appointed them to the DHEC board, campaign records show that Kenyon Wells and his family gave the governor $50,000, while DHEC Chair Allen Amsler gave $3,000. A third DHEC board member and Gov. Haley-appointee gave the governor $570 in 2010.” [WIS, 11/30/11]
Opposition from Democrats & Republicans. “Republican and “South Carolina House Republicans and Democrats alike blasted Gov. Nikki Haley on Tuesday for vetoing their resolution expressing displeasure with a state agency’s move to clear the way for the deepening of Georgia’s Port of Savannah. The House overrode Haley’s veto of that resolution by a 111-to-1 vote. ‘This is a political ploy,’ state Rep. Jim Merrill, R-Berkeley, said of Haley’s veto. ‘Once again, (Haley) is working more on behalf of Georgia, when it comes to this permit and this issue, than she is on South Carolina.’” [The State, 2/28/12]
https://www.fitsnews.com/2013/09/16/democrats-nikki-haley-sold-out-port-for-15k/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20449040
YouTube embed. Click thumbnail to play. >>20449026
>>20449028
>it's our only chance
>>20449029
>That'll fix it for sure
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3de21 No.20449041
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20449042
>>20449020
Navalny’s wife is a psyop, is he really dead? She doesn’t care. She is a terrorist and she wants to destroy Russia for a color revolution
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b25592 No.20449043
>>20449037
I see what you did there…nobody asked for them anon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f52415 No.20449044
>>20448937
Remember, I have a prototype of an election/recall system that is replayable. Hope PDJT will give some support, because we will need it one way or another.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
726079 No.20449045
>>20449011
Another quote: “At the population level, an IIS provides aggregate data on vaccinations for use in surveillance and program operations, and in guiding public health action with the goals of improving vaccination
rates and reducing vaccine-preventable disease.”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20449046
>⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
>⠄⠄⠄⢀⣀⣀⣀⣀⣀⣀⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
>⠄⢀⢴⢫⢪⢪⢪⢪⢪⢪⢳⢦⡀⣠⢖⢏⢏⢏⢏⢗⢦⢄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
>⡰⡏⡎⡎⡎⡎⡎⡎⡎⡎⡎⡖⡽⣕⢕⢕⢕⢕⢕⢕⢕⢭⢣⡀⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
>⡫⡪⡪⣪⡪⡞⡎⡎⡏⡏⡏⡏⡎⡳⡣⣧⢧⢗⢗⢗⢗⢧⢧⣳⡆⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡻⣜⢜⢜⢜⢜⢜⢌⢗⢦⡀⠄⠄⠄⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⣪⣪⣪⣪⣪⠮⡮⣮⡮⡮⡮⣎⣧⡣⡣⡣⡱⡱⣱⣱⣱⣹⣆⠄⠄⠄⠄⠄⠄⠄
>⡪⡪⡪⣚⣮⢗⢗⢕⢕⢜⢜⢜⢜⠾⣝⣜⢮⡹⣮⡪⡪⡪⡾⣳⢵⢵⠵⣕⣟⢶⠄⠄⠄⠄⠄
>⡪⡪⡪⡷⢧⣗⠓⠓⣳⡷⢷⣷⣷⣿⠚⠛⠓⡽⣖⣗⢍⣧⣿⣷⣷⣷⠫⣎⡳⣽⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⣫⢳⢿⣿⣹⣇⣠⣿⠄⠄⠄⢸⢼⢎⠞⣸⣷⢾⣏⣹⡇⠄⢨⣿⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡝⡾⣼⣪⣫⣻⣳⢲⡲⡺⣝⢞⢕⢝⣝⡝⡝⡟⣟⣝⣝⡵⠁⠄⠄⠄⠄⠄
>⡪⡪⣪⡎⡎⡎⡎⡎⡎⡆⡇⡇⡇⡝⡍⣏⡟⡕⡕⡕⡕⡝⡻⣝⢭⢪⠾⡪⡻⣆⠄⠄⠄⠄⠄
>⡪⣪⢮⢮⢎⢎⢎⢪⢪⠪⡪⣪⣪⢮⢞⢕⢕⢕⢕⢕⢕⢕⢝⢜⢗⢕⢍⢎⢎⢾⣦⠄⠄⠄⠄
>⡪⡻⣝⣮⣯⢟⣞⢾⢼⡼⣜⣜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⣜⣼⣳⠝⠄⠄⠄⠄
>⡪⡪⡪⡳⣯⣻⢽⣻⢷⣯⣗⣗⣯⣯⣯⣳⣳⡳⣞⣞⣞⡮⡮⣮⢼⢞⣞⣽⡮⡏⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡻⡺⡽⢮⣗⡯⣗⣗⡯⡯⣷⣻⢷⣳⢷⣻⢟⡾⣻⣻⢾⢽⡽⠏⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡣⡫⡝⡗⡗⡿⡽⢾⠾⡽⡾⡽⡾⡽⡽⢷⢽⢝⢏⡇⠄⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡣⡫⡪⡪⡪⡪⣪⢾⢳⢳⣧⠗⠁⠄⠄⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⣪⡪⣪⣪⡺⡱⡱⣱⣑⢎⢷⢤⢀⡀⠄⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⣞⢕⢽⣪⣲⣫⣮⢺⡙⣹⡵⡻⡸⡸⡹⡆⠄⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⣳⡱⡱⡹⣕⡮⣪⡜⡏⡇⡇⣇⢇⢇⢏⢦⠄⠄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡗⡕⡕⡟⡴⣇⢇⢇⣗⢏⢎⢎⡮⡪⡪⡣⡄
>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⢫⡪⡪⡪⡪⡪⡳⣻⡪⡪⣪⡞⡕⡵⡏⡎⡻
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20449047
>>20448987
the dealerships bank 3 times. 1 America canadian retards sign loan. dealerships wins 1. pass address to cartel. sell to middle east. suburban retards feed it.
.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
24eefd No.20449048
>>20449022
>>20448991
>It is exactly this.
>Cert expired.
>Anon discovered after posting imaginary meme last post.
>>20449003
clear cache reboot browser
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
674f04 No.20449049
>>20449016
You should rail some up.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2a248 No.20449050
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f25fa7 No.20449051
[MISSING CRYING BABY FOOTAGE]
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20449052
>>20449043
(0)(0)
this one means eyes
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0fed43 No.20449053
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
215975 No.20449054
Have IRL, just a quick post re image server. Have left message for site admin, hope we're up and running with images soon.
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20449055
FINAL
#25085 >>20448296
>>20448595, >>20448842, >>20448571 Trump Town Hall with Laura Ingraham
>>20448345 Planefag
>>20448362, >>20448715 The Authoritative Personality (1950), Adorno T. W.
>>20448367 What is Smart Dust?
>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid
>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group
>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine
>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme
>>20448515, >>20448586, >>20448608 Understanding PCR
>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death
>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton
>>20448652 Egypt Stops Use Of US Dollar For Trade - Joins BRICshitters
>>20448677 NY Bill would allow children to consent to medical procedures
>>20448804 Bannon: Trump's Representing The American People, He's Putting You First - Biggest fundraiser in SC for Trump, $6.5 million
>>20448816 Tustin, California: Confirmed Explosion at a shopping center lockdowns and evacuation in place
>>20448871 United Airlines flight #UA354, a Boeing 757-224, diverts after pieces from inner leading edge slat of right-hand wing broke off
>>20448960 [ing] error
>>20449011 What are Immunization Information Systems (IIS)?
>>20449039 (2013) Nikki Haley “Sold Out Port” For $15K
#25085
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0c318e No.20449056
>>20448987
In PA it’s worth fifty cents
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20449057
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58ddd7 No.20449059
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20449062
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20449063
YouTube embed. Click thumbnail to play. Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20449066
>>20449048
tried already
to no avail
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
726079 No.20449067
>>20449046
Nice.
I guess I can poast when the cert is expired.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b6018e No.20449069
>>20449048
>clear cache reboot browser
Just for fun? Because that will do nothing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1227dd No.20449070
YouTube embed. Click thumbnail to play. >>20448282
>>>20447909 17 goals were scored between the Minnesota Wild and the Vancouver Canucks - this has not happened in a game since 1982
Dean Radin at IONS showed how there was a measurable effect of collective consciousness that showed awareness of 9/11 before it happened.
The more we push "17", the more we manifest it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20449072
>>20449067
best to zip it, tho, right?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20449073
>>20449051
[If you're going to lament to the wall, I feel like constructive lamenting would be better, don't you?]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20449074
>>20448914
General Research #23075 >>18802004
TIKTOK: CHINESE “TROJAN HORSE” IS RUN BY STATE DEPARTMENT OFFICIALS
https://www.mintpressnews.com/tiktok-chinese-trojan-horse-run-by-state-department-officials/284353/
Amid a national hysteria claiming the popular video-sharing app is a Chinese Trojan Horse, a MintPress News investigation has found dozens of ex-U.S. State Department officials working in key positions at TikTok. Many more individuals with backgrounds in the FBI, CIA and other departments of the national security state also hold influential posts at the social media giant, affecting the content that over one billion users see.
While American politicians demand the app be banned on national security grounds, try to force through an internet surveillance act that would turn the country into an Orwellian state, make clueless statements about how TikTok is dangerous because it connects to your Wi-Fi, it is possible that TikTok is already much closer to Washington than it is to Beijing.
STATE DEPARTMENT-AFFILIATED MEDIA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59dc47 No.20449075
>>20449067
Always be prepared
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⠘⠁⠀⠀⠈⠉⡦⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡾⠛⠋⠙⠻⠛⠾⡯⠀⠀⠀⡤⡴⠒⠂⠉⠙⠿⡿⡾⡤⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡴⠋⠀⠀⠀⡤⠾⠚⠚⠚⠛⡛⠪⡀⠀⠠⡮⠀⠨⠈⠀⡄⡖⠚⠉⠻⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡸⠁⠀⠀⠚⠁⠀⠀⠀⡀⠀⠐⠠⡀⠀⡩⠶⣬⠦⠁⠰⡯⡿⡋⠀⡦⠾⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠟⡆⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡏⠀⠀⠀⠀⠀⠀⡤⠈⠀⠀⡤⡾⡭⡤⡀⠀⡀⡀⡤⡼⠀⠛⠋⡩⠿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡸⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠠⠀⠀⠀⠀⡈⠉⡠⡴⠛⠁⡿⡿⠀⡾⠀⡿⠛⠀⠀⡀⡠⡤⠚⠑⠦⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠸⠰⠁⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡰⠏⠇⠀⠀⠀⠀⠀⠀⠙⡻⡿⡿⠿⠿⠛⡩⠾⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠐⡿⡄⠀⠀⠀⠀⠀⠀⠠⡾⡄⠀⠀⡀⡤⡴⡶⡦⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡇⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠙⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⡴⡿⡿⡿⠀⠀⠸⡿⠶⡤⡈⡿⡿⠿⡩⡴⡿⠿⠋⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⡀⡠⡴⡾⡿⡿⡿⡿⡿⡿⡇⠀⠀⠀⠉⡿⡶⡙⡿⡿⡶⡾⡏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠸⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡶⡾⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⠟⠁⠀⠀⠀⡿⡶⡿⠀⠻⡴⡶⡥⡛⡉⡻⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡇⠀⠀⠀⠀⠀⠀⠀⠀⠠⡿⡿⡿⡿⡿⡿⡿⡿⠿⠿⠻⠛⠛⠉⠀⠈⡴⠉⠀⠀⠀⠀⠀⠀⠀⠀⡤⡿⡇⠀⡀⡍⡅⡉⠸⡄⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠀⡀⡀⡤⡤⡴⡶⡶⡾⡾⡾⡾⡿⡿⡿⡾⡾⡾⡶⡿⡀⠀⠀⠀⠀⠀⠀⠀⡀⠙⠛⠛⠉⠀⠀⠀⠀⠀⠀⠀⠀⡤⡶⠚⠀⠀⠀⠀⠀⠀⠀⠀⠀⠸⠀⠿⠀⡏⡿⠋⠀⡒⠀⠉⡤⡦⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⡴⡾⠀⠀⠿⠻⠫⠩⡉⠑⠉⠉⠉⠛⡿⠀⡿⡿⡿⡿⡿⡿⠀⠀⠀⡄⠀⠀⠀⠀⠀⠀⠀⠉⠉⠀⠀⠀⡀⡰⡤⠤⠚⠈⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡏⠘⠀⡿⡅⠴⠀⡿⡯⡽⡿⠁⠀⠀⠀⠀⠀⠀⠀
>⡠⡾⠿⠻⡿⡿⡿⡿⡦⠀⠀⠀⠀⠙⡤⠀⠀⠀⠀⠀⡻⠀⡟⠉⡄⠀⡀⠿⡤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⠀⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡸⡼⡿⠀⡾⠉⡀⡀⡷⠋⠀⠀⠀⠀⠀⠀⠀⠀
>⡿⡃⠀⠀⠀⠙⡿⡿⡿⡷⠀⠀⠀⠀⠀⠉⠀⡠⠐⠻⡠⡤⡿⡿⠀⠈⡧⡀⠉⠻⡶⡤⡀⠀⠀⠀⠀⠀⠀⡸⠀⠛⡇⠙⡿⡶⡤⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠘⡿⡿⠀⠀⠰⡍⡾⠿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⡿⡁⠀⠀⠀⠠⠈⠿⡿⡿⡦⠀⡀⠔⡠⠶⡧⡾⠀⡿⡿⡿⡿⡿⡿⡿⡄⠻⡶⡀⠀⠀⠉⠻⡿⡾⡶⡶⡿⠀⠀⠀⠻⠄⠀⠀⠀⠉⠻⡶⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡸⠀⠁⠀⠠⠿⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⡿⡧⠀⠀⠀⠀⠀⠀⠹⡿⡿⠺⡀⡾⠉⠉⠀⠀⠀⡤⡶⠀⠀⡿⡿⡿⡧⡤⡈⠻⡿⡤⡘⠀⠀⠀⠀⡠⡿⡿⡶⡄⠀⡿⠀⠀⠀⠀⠀⠀⠈⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡇⠻⡦⡀⠋⠦⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠿⡿⠀⠀⠀⠀⠀⠀⠀⠈⠻⡮⡿⠀⡀⠀⠀⠀⠀⠀⠀⠉⠉⠉⠉⠉⠙⠻⡿⡿⡤⡀⠙⠿⡦⡤⡾⡋⡿⡿⡿⠀⠿⠉⠀⠀⠀⠀⠀⠀⠀⠀⠻⡦⠀⠀⠀⠀⠀⠀⠠⡾⡧⡾⠀⠛⠿⠀⡿⡶⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠘⡿⡷⠀⠀⠀⠀⠀⠀⠀⠀⡿⡿⡿⡿⡶⡀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠉⠻⠀⡿⡶⡤⡤⡤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠀⠀⠙⡷⠀⠀⠀⠀⠀⠸⡿⠈⠻⠶⡤⡀⠂⠀⡼⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⡿⡿⠀⠀⠀⠀⠀⠀⠀⠸⡿⡏⠀⠈⡻⡿⡦⡈⠈⠛⠿⡦⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠿⡦⡀⠹⠀⠀⠀⠀⠀⡸⡿⡆⠈⠸⠀⠀⠀⠀⠀⠸⡆⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠸⡿⡇⠀⠀⠀⠀⠀⠀⠸⡿⡇⠀⠀⠈⠻⡿⡿⡦⠀⠀⠈⠀⡿⡶⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠹⠀⡀⠀⠠⠀⡿⠁⠀⠉⠻⠀⡿⠀⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⡿⡄⠀⠀⠀⠀⠀⠀⠀⡇⠀⠀⠀⠀⠈⠻⡿⡿⡄⠀⠀⠙⡿⡿⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠹⡇⠀⠀⠹⡿⡦⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠸⡿⠀⠀⠀⠀⠀⠀⠀⠹⡿⡄⠀⠀⠀⠀⠀⠠⠀⠁⠀⠀⠀⠀⠻⡿⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡿⡿⠀⠀⠀⠉⡿⠟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡼⡿⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⡿⡿⡇⠀⠀⠀⠀⠀⠀⠻⡿⡀⠀⠀⠀⠀⠀⠀⡶⡶⡤⡀⠀⠀⠙⡿⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠈⠿⡿⠀⠀⠀⡿⠏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⡾⡿⡿⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠘⡿⠀⠀⠀⠀⠀⠀⠀⠀⠻⡿⡦⠀⠀⠀⠀⠀⠀⠙⡿⡿⡿⡿⡦⡬⡿⠀⡦⡀⠀⠀⠀⠤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠙⠀⡷⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡿⠁⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠿⡿⡿⠀⠀⠀⠀⠀⠀⠀⠻⡿⡶⠀⠈⠀⠀⠀⠀⠀⠀⠉⠙⠛⠻⠛⠛⠻⡿⠀⡿⡶⡤⡤⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠹⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠘⡿⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⡿⡿⡆⠀⠀⠀⠀⠀⠀⠀⠿⡿⠀⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠉⠛⠀⡿⠀⡿⡶⡦⡤⡤⡤⡤⡤⡤⡶⡶⡦⠀⠀⠀⠀⡆⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠹⡿⡿⡀⠀⠀⠀⠀⠀⠀⠀⠿⡿⡿⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠉⠛⠛⡻⠀⠀⠛⠛⠻⠀⠀⡦⡤⡀⠠⡿⡿⠀⠀⠀⠀⠀⠀⠀⡠⡀⡠⠀⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠿⡿⠀⡀⠀⠀⠀⠀⠀⠀⠀⡿⡿⠀⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡶⡿⡿⠿⠟⠿⡶⡤⡶⡿⡿⡟⠻⠿⠿⡿⠀⠀⡶⡄⠀⠀⠀⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠈⡿⡿⡧⠀⠀⠀⠀⠀⠀⠀⠻⡿⡿⡧⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠼⠛⠉⠀⡤⡿⡿⠀⠀⠋⠀⡀⠀⠀⠀⠀⠉⡿⠀⠀⠀⠀⡿⡶⡄⠀⠀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠀⠹⡿⡿⡤⠀⠀⠀⠀⠀⠀⠘⡿⡿⡿⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠀⠀⠈⠈⡶⡰⡾⡿⡿⡷⡁⣬⡶⡦⡤⠀⠀⠁⠀⡟⠀⠀⠀⡿⠀⡿⠀⡷⡤⡀⠀⠀⠀
>⠀⠀⠀⠀⠀⠀⠚⠻⠿⠿⠀⡿⠀⠀⠀⡿⠀⠀⡿⡿⡿⡧⡄⡀⡠⡀⡀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠰⠲⡒⡠⡤⡤⡤⡴⡶⡶⡶⡾⡾⡿⠷⠋⠉⠉⠉⠉⠉⠛⠛⠿⡛⠛⠛⠛⠻⠻⠻⠻⠿⠿⠿⠛⠛⠛⠛⠛⠛⠻⠺⠚
>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠉⠉⠛⠛⠀⠀⠿⠿⡿⡿⡿⠀⠀⠀⠿⠿⠿⠻⠛⠛⠉⠉⠉⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c3cb1f No.20449076
>>20449049
Stupid, smart dust having plastic was my find. and I extrapolated on more ingredients that need to be investigated. You need to do work instead of being a smart alec.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ef6f6 No.20449077
WHITE SQUALL
>>20449071
>>20449071
>>20449071
>>20449071
>>20449071
>>20449071
>>20449071
FRESH
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20449078
>>20449075
because board larps and personas don't need no fucking certificate
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20449079
Rumble embed. Click thumbnail to play. Kirk Cameron Warns Of Marxist Infiltration: If You Break Up The Family, "You Control The Future"
Religion is a sickness now and its related to J6. They link every wild conspiracy theory.Much worse than our theories that we prove
10:15
https://rumble.com/embed/v4c0jyh/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
674f04 No.20449080
>>20449076
I I I me me my shill continues.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94d11b No.20449081
>>20449054
Otay way to get on it! Tanks
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20449083
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9c9844 No.20449086
>>20449048
>clear cache reboot browser
What a fucking retard I am.
Now, all my filters are gone and I am actually worse off.
Thanks bro
sarchasm.png
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20449087
https://ascii-generator.site/
https://fsymbols.com/text-art/
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▒▓▓▓▓▓▓▓▓▒▒▓▓▓░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░▒▒▒▒▒▓▓█████▓█▓█▓█████▓▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░▒▒▒▓▓▓████▓▓▓▓▓████▓▓▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒░░░░░░░░░░▒░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒░▒▒▒▒▒▒▒▒▒▒░░░░░░░░░▒▒▒▒░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░▒▒▒▒░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░▒▒▒▒▒░░░░░░░░░░░░░░░░░
░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▒▒▒▒▒░░░░░░░▒▒▓▒░░░░░░░░░░░░░░░░
░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░▒░░░░░░▒▒▒▒░░░░░░░░░░░░░░░░
░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░░
░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▒▒▒▒░▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▓▓▒▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░
░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓████▓▓▓▓░░░░░░░░░░░░░░░
░░░░░░░░▒▒▒▒▒▒▒▒▓▓▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓█▓████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▓▓▓▓░░░░░░░░░░░░░░░
░░░░░░░▒▒▒▒▒▒▒▒▒▒▓▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▒▓▓▓▓███████▓▓▓▓▓████▓▓▒▓▒▒▓▓▓▒░░░░░░░░░░░░░░
░░░░░░▒▒▒▓▓▒▒▒▒▒▒▓▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▓▓██████▓▓▓▓▓▒▒▓▓████▓▓████▓▓▒░░░░░░░░░░░░░░
░░▒▓▓▒▒▒▒▓▓▓▓▒▒▒▒▓▒▒▒▓▓▓▓▓▓▓▓▓▓███▓▓███████▓▒▒▒▓▓▒▒▒▒▓█▓▓▓▓▓▓▓▓▒▒▒░░░░░░░░░░░░░░
░░████▓▒▒▒▒▓▓▓▒▒▓▓▒▒▒▒▓▓▓▓▓▓▓▒▒▒▓▓▓▓▓▓▓▓▓█▓▒▒▒▒▒▒▒░░░░▒▓██▓▓▓▓▓▒▒░░░░░░░░░░░░░░░
░░██▓▓▓▓▓▓▓▓▒▓▓▒▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒░░░░░░░▒▒▓▓▓▓▒▒░░▒░░░░░░░░░░░░░
░░▓▓▒▒▓███▓▒▒▓▓▓▓▓▓▓▒▒▒▒▒▒░░░░▒▒▒▒▒▒▓▓▒▒▒▒▒▒▒▓▓▒▒░░░░░░░░▒▒░░░░░▒▒▒░░░░░░░░░░░░░
░░▒▓▓▓▓▓██▓░▒▒▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒░░░░▒▒▒▒▒▒▒▒▒▓▓▓▒▒░░░░░░░░░░▒░░▒░░░░▒▒░░░░░░░░░░░░░
░░░▒▓▒▓▓▓▓▒▒▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▒▒░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░
░░░░▒▓▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓███▓▓▓▓▒▒▓▓▓▓▒▒▒▓▓▒▒▒░░░░░░░░░░░░░
░░░░░▒▓▓░░░░▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▓▓▒▒▒▓▓▓▓▓▓███████▓▓▒▒▒▒▒▓▓▓▓▒░░░░░░░░░░░░
░░░░░░▒▒▒▓▓▓▓▓▓▓█▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░▒▒▒▒▓▓▓██████▓▓▒▒▒▒▓▓▓▓░░░░░░░░░░░░
░░░░░░░░▒▒▒▒▒▓█▓▓██▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▓▓▓░░░░░░░░░░░░
░░░░░░░░░▒▓▓▓▓██▓████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▓▓▓▓▓███▓▓▒▒▒▒▒▒▒▒░░▒▒██▓▓▓▓░░░░░░░░░░░░
░░░░░░░░░░░▒▒▓██▓▓█████▓▓▓▓▓▓▓▓▓▓██▓▓▓▓▓████▓▓▒▒░▒▒▓▓▓▓▓▓▓▓▓▒▒▒███▓█░░░░░░░░░░░░
░░░░░░░░░░░░▒▓▓█▓▓▓████████████████▓▓█████▓▓▓▒▒▒▒▓▓▓▓▓▓█▓▓▓▓▒▒▒▓██▓▓░░░░░░░░░░░░
░░░░░░░░░░░▒▒▒▓█▓▓███████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓█▓▓▓▓▓▓▓████▓░░░░░░░░░░░░
░░░░░░░░░░░▒▒▒▓▓▓▓▓█████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓███▓▓▓▓▓▓████░░░░░░░░░░░░░
░░░░░░░░░░▒▒▒▒▒▒▓▓▓██████████████████████████▓▓▓██▓▓▓█████▓▓██████░░░░░░░░░░░░░░
░░░░░░░░░░▒░▒▒▒▒▓▓▓█████████████████████████▓▓▓█████████████████▓░░░░░░░░░░░░░░░
░░░░░░░░░░░░░▒▒▒▓▓▓▓███████████████████████████████████████████▓░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░▒▒▒▓▓▓▓█████████████████████████████████████████▒░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░▒▓▓▓▓▓█████████████████████████████████████▓▓▒░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░▒▒▓▓▓▓▓███████████████████████████████▓▓▒░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓████████████████████████████▓░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓███████████████████████▓▓▓█▓░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓██████████████████▓▓▒▓█░░░░░░░░░░░░░░░░░░░░░░░░░░░
░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓███████████████▓▓▓▓▒░░░░▒░░░░░░░░░░░░░░░░░░░░░░░
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d5a50b No.20449088
>>20449054
╣╢╢╢╣╣╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣▒▒╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢
╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣╣╢╢╢╢╢╢▓▓▓▓▓╢╢╢╢╢╢╢╣╢╣╣╢╢╣╣╣╣╣╣╣╣╣╢╣╣╣╣╣
╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣╢╢╢╣╣╢╢╢╣╢╢╣╣╣╣╢╣╢╣╣╢╢╣▒▓▓▓▓▓▒╣╣╣╣╢╣╣╣▒╣▒╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╢╢╢╢╢╢╢╢╢╢╢╢╢╣╢╣╣╢╣╣╢╢╢╢╢╢╣╣╣╣╣╣╣╣╣╣╢╢╢╣▒▒▒▒▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╢╢╣╢╢╣╣╣╣╣╣╣╣╢╣╣╣╢╣▒▒▒▒▒▒▒▒▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╣╣╣▒╣╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▀███▒▒▒▒▓▓▒▒▒▒▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▀▓██▓▓▓▓▒▒▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█▓▓▓▓▓▒▓▓▓▓▓▓▓▓▓█▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█████████▄▄▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓███████▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█▓▓▓▓▓▓█████░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▀▀▓▓▄▄▄▒▄▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓████▀▀▀▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█████▓▓▓▓▓▓▓▓▓▓▓▓▓██████▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▒▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╣╣╣╣▒▒▒▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▒▒▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╢╣▒╢▒▒▒▒▒╢╢▒╢▒▒▒╢▒▒▒▓▓▓▒▒▒▓▓▓▓▓▓▓▓▒▒╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╢╢╢╢╢╢╢╣╣╢╣╢╢▒╢╣▒╢▒▒▒▒▒╢▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╣▒▒▒▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╢╢╢╢╢╢╢╢╢╢╢╣╢╢╢╣╣╣╣╣╢╣▒▓▓▓▓▓▓▒╣╢╣╣╣╣╣╢╣╣╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╢╢╢╢╢╢╢╢╣╣╢╣╢╢╢╢╢╢╢╣╢▓▓▓▓▓▓▒╣╢╢╣╣╢╣╢╢╣╢╣╣╣╣╢╣▒╢▒╣╣▒╣╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒
╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢▒▓▓▓▓╢╢╢╢╢╢╢╣╢╣╣╣╢╢╣╣╣╣╣╣╣╢╣╣╣╣╣╣╣╣╣╣╣╣╣╣╣╣╣╢╢╣╢╢╢╢╣╣▒╣╣▒╢▒▒▒
╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢▒▒▒▒╢╢╢╢╢╢╢╢╢╢╢╢╢╣╣╢╢╢╣╣╢╢╢╢╣╢╢╣╢╣╣╢╣╣╣╢╣╣╣╣╣╣╣╣╣╣╢╣╣╣╣╣╢╣╣╢╢
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6d54ad No.20449091
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3afed9 No.20449092
>>20449086
>Now, all my filters are gone and I am actually worse off.
CLASSIC Q RESEARCH OUTCOME
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
151104 No.20449093
>>20448392
>>20448392
no text.
no sauce
nothing
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f60158 No.20449094
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9b6c6 No.20449095
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3958d2 No.20449096
>>20449033
Those of us without a supply of "special" mushrooms?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
94d11b No.20449097
>>20449086
Calm down mix a drink if you drink you got this
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f88cf8 No.20449098
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75e8da No.20449099
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1cafce No.20449102
gingur rasberies almost stole dat heimat
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bf048 No.20449103
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠙⠛⣁⣤⣶⡿⡿⢿⣿⠇
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠘⠟⠋⣡⡴⠀⠀⠙
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠿⠋
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠐
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢂
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠁
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠄
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠰⠃⠀⠂
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢀⡀⠘⢢⡀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⣠⡀⢰⣦⣄⠈⢠⢂⣾⡗⣄⣀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢹⣀⡞⢹⣏⣶⣿⣿⣿⣷⣿⣿⠓
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⣿⡿⣷⣿⣿⣿⣟⣹⣏⣻⠿⢿⣧⡀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢿⣷⣿⣿⣿⣿⣿⠛⣿⣿⣵⣤⣈⠑⡄⠀⠀⠀⠀⠀⡀⠀⢠⡄
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡼⠷⣿⣿⡏⢻⣿⣿⣸⣿⣿⣿⣿⣿⣷⣆⢠⢀⣾⠗⠛⠀⠀⠀⠉⠧
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⣐⢿⣶⣴⣿⣿⢿⣿⣿⣿⣿⣿⣿⣿⣿⠀⠀⠀⠈⠻⡁⣀⣀⣄⣀⣰⣤⣤
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢀⣿⣿⣿⡁⠹⣿⣿⣿⢹⣿⣿⣿⣿⣿⣅⠀⠀⠀⠀⠀⢸⣿⣿⣿⣷⣿⣸⣿⡀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢾⡿⢿⣿⡷⣦⠘⣿⣿⡟⣿⣿⣿⣿⣿⣿⡿⡄⠀⠀⢠⣿⣿⣿⣿⣿⣿⣿⣿⣧⣶⡄⠀⠀⡄
⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠈⠁⣸⣿⢧⣿⣷⣿⣿⣯⣿⣿⡿⠻⣿⣿⡇⣷⠀⢠⣿⣿⡿⠋⢻⣉⣹⣿⢿⣿⣿⣿⣶⣦⠻⣆⣀
⢤⡤⠀⠀⠀⠀⠀⠀⢀⠀⠀⠀⠀⢰⣿⣿⣿⣿⣿⣿⡿⣻⣿⣿⠇⠀⣨⣿⢱⣿⢦⣾⣿⠏⠀⢹⣿⣿⣯⣾⣿⣿⣿⣿⣿⣿⣦⡹⣿⣾
⢷⣧⡠⡀⠀⡠⣸⡤⡌⡇⢠⢀⣠⣿⡿⣿⣿⣿⣿⡿⢠⢿⣿⣿⣠⣶⣿⣿⢸⣿⡄⣻⡁⠤⣦⣾⣿⣯⡎⣿⣿⣻⣟⠏⠹⡿⢿⣿⡧⠾
⣀⣀⠀⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡆
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1cafce No.20449105
>>20449102
>gingur rasberies almost stole dat heimat
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
526863 No.20449106
>>20449079
Kirk says: what if “This is the “Great Awakening”, it is not the fall of America, but the restoration of our country!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bf048 No.20449109
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4541b No.20449112
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.