[ / / / / / / / / / / / / / ] [ dir / random / 93 / biohzrd / hkacade / hkpnd / tct / utd / uy / yebalnia ]

/qresearch/ -  Q Research

Research and discussion about Q's crumbs
Name
Email
Subject
REC
STOP
Comment *
File
Password (Randomized for file and post deletion; you may also set your own.)
Archive
* = required field[▶Show post options & limits]
Confused? See the FAQ.
Embed
(replaces files and can be used instead)
Options

Allowed file types:jpg, jpeg, gif, png, webp,webm, mp4, mov, pdf
Max filesize is16 MB.
Max image dimensions are15000 x15000.
You may upload5 per post.


Welcome Page | Archive | qnotables archive | Q's Board: /projectdcomms/ | Legacy Boards: /CBTS /TheStorm | TOR link
Practice Bake HERE: /comms | /qrn |

File: 48e6c9d5750adfd⋯.png (64.31 KB,255x138,85:46,ClipboardImage.png)

2ef6f6 No.20448278 [Last50 Posts]

Welcome to Q Research General

We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.

"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."

VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH

Q's Latest Posts

>>18284019 Nov. - Dec. 2022

Q's Private Board

>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6

Find Q drops here

Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku

Q Posts Archives

* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u

* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app

* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news

* Q Raw Text Dumps: q-clock.com/q_raw.txt

* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/

* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188

* Q Research Notables: Archive Board >>>/qnotables/

* Q Adjacent infographs and moar: https://deepstatemappingproject.com/

Q Research Board

Key Resources below. Check Dough Resource thread for more: >>17225239

New to QR?

>>17240320 Welcome to Q Research | >>20424387 Board Info

Join Us

>>17322509 LEARN TO BAKE | >>17322518 E-BAKE Instructions

>>20440436 MEME WARRIOR UI 1.2 updated Feb 19, 2024 NEW

Threads

>>17253611 Dedicated Resource Threads

>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon

TOR Access

TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html

TOR Banner: https://www.youtube.com/watch?v=MLCupx1UExg

____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448281

International Q Research Threads

>>20092798 ——–——– Australia #34

>>20362754 ——–——– Canada #53

>>16694358 ——–——– France #7

>>19988670 ——–——– Germany #106

>>20187083 ——–——– Japan #21

>>16694250 ——–——– Nederland #10

>>17784579 ——–——– QAJF #1

>>20038152 ——–——– Scotland #9

>>19636057 ——–——– South Africa #12

>>19804572 ——–——– UK #51

GLOBALS

Bunker = https://endchan.org/qrbunker/catalog.html

>>20022853 Posting Guidelines

>>19832150, >>19957123, >>19737197 SPAM Removal; >>20184855 Jim W. on spam

>>19089056 Ban lifts, video downloads, Q clock, Joe M's videos, Qagg Download

>>18024378, >>18561054 Updated PROTO Instructions

>>20186509 How to filter namefags

Bakers:

>>19089065 Baking Tools & Guidelines - NEW BAKERS, PLEASE READ

>>17322509, >>17322518 How to bake/e-bake

>>17835052 Formatting Q posts

>>20186534 No "Muh Joos" in notes. Discrimination based on race or religion will be removed

Plz sign out clearly when e-baking or ghosting, use RED TEXT

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448282

NOTABLES ARE NOT ENDORSEMENTS

#25084 >>20447499

>>20447605, >>20447833, >>20447891 Planefags

>>20447611, >>20447618, >>20447649, >>20447747, >>20447758, >>20447780, >>20447983, >>20448013 Mil tweets

>>20447615 NYC Trump ruling draws strong backlash

>>20447651 IRS Asks Americans to Report Income From 'Illegal Activities'

>>20447659 The ‘Wolf of Wall Street’: Trump ‘will win’ in NY somehow

>>20447663, >>20447664 Famous fossil is really just paint, rocks and a couple of bones, researchers say

>>20447676 The Great Red Dragon: The Foreign Money Power in The United States (1890) L.B. Woolfolk

>>20447684 DJT: Town Hall with Donald Trump and Laura Ingraham tonight @ 7PM EST

>>20447716 Accurate reporting from CNN

>>20447746, >>20447761, >>20447783, >>20447811 Everything You Need To Know About The Motions To Disqualify Fani Willis

>>20447772 A new study has concluded sex change surgeries 'do not have an impact on suicide risk'

>>20447815, >>20447778 New York Moves to Begin Vaccinating Children Without Parental Consent

>>20447860 Growing Trend sees local and state law enforcement facilities listing Black and Hispanic offenders race as White

>>20447909 17 goals were scored between the Minnesota Wild and the Vancouver Canucks - this has not happened in a game since 1982

>>20447926 NSA announces the retirement of Rob Joyce, the Director of Cybersecurity and the Deputy National Manager, National Security Systems

>>20447944 (2023) Elon Musk claims the US government had 'full access' to private Twitter DMs

>>20447949 Kyrsten Sinema has spent over $200k of your money on private jets

>>20447955 A plan by President Joe Biden, called an “extortion attempt,” would shield more criminal illegal aliens from deportation

>>20447978 VTA prepares abandoned fleet for auction to recover taxpayer dollars after NBC Bay Area investigation

>>20447992 Some notes from today's KJP press conference

>>20447998, >>20448091, >>20447956 2 adults are charged with murder in the deadly shooting at Kansas City’s Super Bowl celebration

>>20448000 Donald Trump is Right about NATO

>>20448012, >>20448235 The actual crazy shit: Meryl Nass @ EU Parliament

>>20448014, >>20448057 .@realDonaldTrump is wheels down at Greenville-Spartanburg International Airport, in the Great State of SC…

>>20448025, >>20448092 Red Cross Faces Scrutiny as it Requires COVID-19 Vaccinated to Call Hotline to See if They’re Eligible for Blood Donation

>>20448044 Global operation smashes ‘most harmful cyber crime group’

>>20448051 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case

>>20448055 Tucker Carlson says Boris Johnson wants "a million dollars" from him to talk about Ukraine

>>20448056 3 KFC locations in Chicago join other businesses leaving due to rampant crime

>>20448065 Stella Assange on Julian Assange’s Hearing today - The Same Country Trying to Extradite him Tried to murder Him

>>20448070 Rep. Eric Swalwell spent millions of dollars in campaign funds on his own childcare costs, Four Seasons steakhouses + moar

>>20448071 Body of missing 11-year-old Audrii Cunningham found in river

>>20448076 Government-Backed Censors Who Rigged The 2020 Election Are Now Stealing 2024

>>20448081, >>20448120 What is a FISA?

>>20448082 Trump Truths the Eighth

>>20448089 Nevada’s Democrat Secretary of State Claims ‘Glitch’ Caused Unmailed Nevada Ballots to Show Up as Counted in Recent Primary

>>20448093 Former Obama CIA Chief Michael Morell Donates To Nikki Haley

>>20448098 "Pay your fair share, unless you're my children" -Joe Biden

>>20448100 ‘The Biggest Loser’ trainer and former boxer launches NY Senate bid to knock out Kirsten Gillibrand

>>20448108, >>20448114, >>20448119 ‘I’m Not Going Anywhere’: Haley Vows to Stay in Presidential Race Regardless of South Carolina Results

>>20448110, >>20448117, >>20448133, >>20448156, >>20448183 Opus Dei

>>20448128 CCP invaders using StarLink to use AliBaba in the jungle of Panama to organize their invasion of America and make financial transactions

>>20448132 E. Jean Carroll's Lawyer Says They're Looking to Sue Trump a 3rd Time

>>20448189 Did You Know Alexandria Ocasio-Cortez Was Elected Thanks To A Casting Call Put Out By Democrats?

>>20448196 The Mayor of City of North Las Vegas announces the city will discriminate against white business owners

>>20448200 French government prepared to arrest those who reject 'medical knowledge'

>>20448213 O'Keefe: The @UUCTucson has completely locked down their website

>>20448253 Video shows brazen broad-daylight NYC Gucci store heist — as bandits make daring getaway with $51K in luxury items

>>20448262 Japan has officially lost its spot as the world's third largest economy to Germany, per Bloomberg

>>20448270 #25084

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448284

#25083 >>20446656

>>20446697, >>20446796, >>20446803, >>20446768, >>20446864, >>20446991, >>20447117 Planefag

>>20446711 Russia making moves in Latin America as FM Sergey #Lavrov paid a visit to #Cuba

>>20446750 Everything You Need To Know About The Motions To Disqualify Fani Willis

>>20446770 Time to Recall Members of Congress

>>20446774, >>20446829, >>20447106, >>20447357 Swamp events

>>20446795, >>20446808, >>20446831, >>20446859, >>20446997, >>20447025, >>20447147, >>20447196, >>20447336 Mil tweets

>>20446819 Timelapse of US foreign aid since 1946

>>20446850 Anthony Sabatini Calls Out Establishment "Sneak Attack" To Implement Runoff Elections In Florida Against Gaetz

>>20446874 The Supreme Court's About To "Erase Half Of Jack Smith's Criminal Charges Against President Trump"

>>20446875, >>20446980 WHO Director-General Tedros pleads his case to the World Jury on the vaccine mandates

>>20446879 Mike Davis: "Democrats Hate Clarence Thomas Because Thomas Escaped The Democrat Plantation"

>>20446897 America's most wanted, Davie Albarran, arrested in Polk County for sexual battery charges on a 12 year old victim

>>20446937 Mexican Army Kills 12 Suspected Cartel Members In Shootout Near Texas Border

>>20446943 State Costs of Illegal Immigration

>>20446955 The Missing Crossfire Hurricane Binder - President Trump Demanded its Contents Be Released

>>20446967 Declassified J6 FBI Emails Reveal Private Emails of Top FBI Agents Discussing Julian Assange’s Trial

>>20446988, >>20447030 Haley mocking Christians?

>>20446971 Paoletta: Democrats Are Attempting To Destroy The Courts Following Conservative Judges' Ascension

>>20446976 'Glitch' on Nevada Secretary of State’s website caused unmailed ballots to show up as counted in the recent primary

>>20446977 Manure Dumped in Front of Pelosi’s San Francisco House as Leftists Torment Former Speaker at Home and in DC Over Support for Israel

>>20446984 Former First Lady of Haiti Indicted in Husband’s Assassination, Prosecutors Claim She Attempted to Take Over Presidency

>>20447004 DJT: Speaker Tim Moore is doing a fantastic job leading the North Carolina House of Representative

>>20447010 Musk Reveals Neuralink's First Human Patient Controls Computer Mouse With Mind

>>20447016 Assange Judge Worked For MI6 & Defense Ministry

>>20447031 Biden announces new "major" sanctions on Russia

>>20447035 Lady Gaga interviewed WikiLeaks founder Julian Assange in 2012

>>20447063 Here’s Bill Gates updated stock portfolio

>>20447078 Could Ronna's Replacement Already Be Involved In Election Fraud?

>>20447087 ‘Israeli apartheid worse than what South Africa endured’: ICJ hearings

>>20447095 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case

>>20447102, >>20447351 Twitter Suspends Then Unsuspends Navalny’s Widow’s Account

>>20447135, >>20446756 Truckers For Trump and Teamster members are starting the mass boycott of NYC deliveries today

>>20447141, >>20447176 The American Red Cross is now asking blood donors if they ever received the Covid vaccine

>>20447161, >>20447207 Russia takes sexy US hostage for allegedly providing support to Ukraine

>>20447230 Five passenger airplanes reached 800mph after strong winds pushed the planes to insane speeds

>>20447285 NYC shelters shipping migrants to Utah

>>20447286 Douglas Murray Announces New Doxing Database to Keep Critics of Israel From Getting a Job

>>20447307 (14 Feb) CIA helped trigger Trump-Russia probe: Matt Taibbi

>>20447309 Refresher: Biden unaware he's being recorded telling a small child that they're sexy and not to tell Mommy

>>20447344, >>20447454, >>20447349, >>20447044 Realtors are Consider Fleeing NY; a Precedent has been set

>>20447345 Law enforcement disrupt world’s biggest ransomware operation

>>20447350 Republicans ask why 9 boxes of Biden records were omitted in Special Counsel report

>>20447355 Yulia Navalny (Alexei's Widow): I will continue the work of Alexei Navalny to continue to fight for our country

>>20447356 Invasian @ Jacumba, CA

>>20447359 Fluorescent glow in the faces of the vaxxed under UV light

>>20447365 Ben Carson: Excited to be in South Carolina to campaign for our next President, @realdonaldtrump

>>20447378 Israeli army to launch probe into 7 Oct failure

>>20447390 Transcript of Tucker / Mike Benz Interview Regarding AI Tools used to Censor

>>20447400 About 1,600 Nike Employees To Be Laid Off

>>20447445 2 Adults Charged With Murder in Chiefs Super Bowl Parade Shooting

>>20447482 #25083

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448285

#25082 >>20445785

>>20445814 Michigan State is now asking residents to house illegals in their homes. How long until this becomes mandatory?

>>20445832 Capital One and Discover are merging - Will be 6th largest bank in US

>>20445871, >>20445920 turbo cancer and excess deaths - twat and youtube vid Dr campbell

>>20445872, >>20445878 "License To Play God": Physician Group Files Brief Against Biden In COVID

>>20445887 @NYCMayor is giving out debit cards to illegal immigrants up to $10,000 each in taxpayer money with no ID check, no restrictions and no fraud control.

>>20445906 Libs of TikTok w/CAP: Illegals ass*ult NYPD officers in the Randall’s Island migrant housing facility

>>20445941 Elon Musk is nominated for Nobel Peace Prize by Norwegian MP who praises him for being a 'stout proponent of free speech'

>>20445947 Ahoy! The Ship Show & Extra Gravy - 02/20/2024

baker change

>>20445847, >>20446002, >>20446008 DOD contracted injections as 'medical countermeasures', no trials, efficacy, safety

>>20445860, >>20446014, >>20445808, >>20445825, >>20445841, >>20445857, >>20445944, >>20446066, >>20446095, >>20446323, >>20446325 Assange trial LIVE

>>20445862 “NO LIVES WERE SAVED” by the COVID-19 injections, says researcher and scientist @denisrancourt.

>>20445867, >>20446094 ‘Crime of the Century’: Research Raises Horrifying Possibility Covid Patients Were ‘Euthanized’

>>20445876, >>20445881 Ukraine’s AI Drones Seek And Attack Russian Forces Without Human Oversight

>>20445889, >>20446103, >>20446295, >>20446390 Trucker Says Boycotting New York City Is Bigger Than Trump

>>20446020 State Dept. Official on Black Leadership in Foreign Affairs

>>20446028 Lockbit cybercrime gang faces global takedown with indictments and arrests

>>20446029, >>20446038, >>20446042, >>20446045, >>20446271, >>20446284, >>20446302 American ballerina Ksenia Karelina detained 'high treason' in Russia

>>20446034 The Future of Pakistan and U.S.-Pakistan Relations Center for Strategic and International Studies (CSIS)

>>20446068 GoFundMe re calls to shut down DJT fundraiser: This fundraiser is currently within our terms of service

>>20446081 Tucker Carlson Interviews Mike Benz about the surveillance state and censorship

>>20446087, >>20446199 How Chinese Censorship Is Going Global–With Help From US Companies

>>20446100, >>20446200, >>20446245 Sergey Poletaev: 2nd anniversary Russia Ukraine conflict approaches, who has upper hand

>>20446163, >>20446418 Nasa's private IM-1 mission is carrying Hindu guru Pramukh Swami Maharaj to Moon

>>20446185 Per CBP sources, another 208 Chinese nationals apprehended by Border Patrol in San Diego sector yesterday

>>20446196 Joe Biden’s Great-Great Grandfather Pardoned by Abraham Lincoln After Allegedly Committing a Violent Crime

>>20446228 Montana Gov. Greg Gianforte (R) discusses affordable housing challenges event hosted Bipartisan Policy Center

>>20446229 Australia seeks public help to design its 1st moon rover, Roo-ver

>>20446250 Zelensky Complains (Again) that Foreign Aid Delays Are Making Life ‘Very Difficult’

>>20446252 Reflections on Ukraine War W/General Wesley K. Clark, USA (Ret.), the 12th Supreme Allied Commander, Europe

>>20446253 BELARUS TO CRIMINALIZE "LGBTQ PROPAGANDA" AND NOT HAVING CHILDREN

>>20446260, >>20446270 "License To Play God": Physician Group Files Brief Against Biden In COVID

>>20446316 Massive underground laboratory in China joins the quest to find dark matter

>>20446339 Gaetz: ‘I love’ CNN article on cause of ‘brain drain’ in Congress

>>20446378 Pizza Hut worker is arrested for shooting dead manager, 55, over $7,000 inheritance check

>>20446393 The party has 0 infrastructure in place try to register these people..They're going to blow this aren't they?

>>20446508 Daily Press Briefing by Spokesperson Secretary-General, spokesperson President General Assembly UN

>>20446518 Republicans ask why 9 boxes of Biden records were omitted in Special Counsel report

>>20446576 JUST IN - Russia places US Senator Lindsey Graham on 'terrorist and extremist' list

>>20446601 Kim Jong-un receives luxury car as gift from Vladimir Putin?

>>20446644 #25082

Previously Collected

>>20445764 #25081

>>20443029 #25078, >>20443831 #25079, >>20444740 #25080

>>20441455 #25075, >>20441317 #25076, >>20442191 #25077

>>20437658 #25072, >>20438526 #25073, >>20439307 #25074

>>20436010 #25069, >>20436126 #25070, >>20436893 #25071

Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com

Q Research Notables Archive Board >>>/qnotables/

Q Research Notables #21: Purpose >>19961525

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448296

File: c7808031d07417c⋯.png (88.06 KB,585x711,65:79,ClipboardImage.png)

Dough

https://fullchan.net/?ee43a6bc50cd1c73#FTiJvBhMH1FHQUTU5tzkhphBscpxzpDRgCiByJFDn6b1

Can continue or defer

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9fc25f No.20448313

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

yung juw rasberries

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

83b330 No.20448315

File: baa290864ff8442⋯.png (786.66 KB,778x889,778:889,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

903f03 No.20448316

File: 4b1f128413e5a84⋯.png (1.84 MB,2978x1429,2978:1429,ef54e671_ac0b_477c_83e3_d3….png)

>>20448296

Thank You, Baker.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a3e5e3 No.20448317

>>20448308 (pb)

manipulator agency troll, you might bake the breads but your crap doesn't wash with anon.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8bc9cf No.20448318

Will wokeness ever end? Or is it here to stay 'cause of how the internet works?

I'm re-watching media from the early 2000s and i miss when women were women and it was okay for a woman to be sexy FOR men.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9d9563 No.20448319

>>20448180 LB

>if humans were genetically modified into existence in the same way that humans genetically modified the Dog into existence…who created the humans and what purposes do humans serve

Don't you see? We did. God does through us.

Recognise the signs of the times.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e3de21 No.20448320

File: b83b7cc41b2882a⋯.gif (2.5 MB,480x200,12:5,b83b7cc41b2882abf02f50554a….gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

86b763 No.20448321

File: 318a87836674e50⋯.png (1.21 MB,792x792,1:1,B58D1F73_6BFC_438F_9CCE_06….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59f738 No.20448322

File: 0b4d1c83092da42⋯.mp4 (605.73 KB,480x480,1:1,ride_never_ends.mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448323

File: 61ad7f8f0715b89⋯.mp4 (3.36 MB,1280x720,16:9,THE_LIE_TrickyNikki.mp4)

>>20448304 lb

>https://twitter.com/DanScavino/status/1759933378282033308

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cdca73 No.20448324

>>20448189 lb

She's from Central Casting

/ourgirl/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448325

>>20448317

Why aren't you forgiving me?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a3e5e3 No.20448326

File: 091b2ac9a1d6ec1⋯.jpg (169.75 KB,2537x1247,59:29,Screenshot_from_2024_02_20….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448327

File: a80ac558dbddc26⋯.png (665.89 KB,1062x1080,59:60,a80ac558dbddc26a65c3477993….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f088c4 No.20448328

YouTube embed. Click thumbnail to play.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a3e5e3 No.20448329

>>20448325

are you admitting to being a manipulative agency troll?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

03e78a No.20448330

>>20448261 pb

wrong. it is a private board.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

091131 No.20448331

File: 432328e0c734f2f⋯.png (1.14 MB,1484x1172,371:293,Image6.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448332

File: 05ba6486966d8ef⋯.png (6.54 KB,300x168,25:14,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448333

>>20448325

You won't do anything VPN.

/filtered

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

58ddd7 No.20448334

File: 9a30ba8d1f92d95⋯.mp4 (7.18 MB,406x720,203:360,000_Biblical_Mission_Impos….mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59f738 No.20448335

File: 777c201f21de4f0⋯.mp4 (469.49 KB,360x202,180:101,spaceforce.mp4)

File: 03747e825ed7095⋯.gif (872.98 KB,260x228,65:57,star_wars_deployed.gif)

>>20448320

gonna have to steal that

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

903f03 No.20448336

>>20448330

Then make it Private.

If Anon can post on it, it's not private.

Mark yer shit

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448337

>>20448329

Check my notes and you decide.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448338

File: 441894a9815417b⋯.png (1.58 MB,1239x951,413:317,13EBAE6D_2A7B_4D8C_879C_24….png)

>>20448296

morning katana.

tyb

o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

667c26 No.20448339

File: dc555bab2126455⋯.jpeg (113.4 KB,915x915,1:1,IMG_8725.jpeg)

File: 4e46d0a8392a2f6⋯.png (372.16 KB,500x500,1:1,IMG_8684.png)

File: 5169a709991435c⋯.png (116.12 KB,1500x518,750:259,IMG_8685.png)

File: 74701a72b6ed4c4⋯.png (167.91 KB,500x500,1:1,IMG_8666.png)

File: ced4ce1b445a056⋯.png (301.29 KB,500x500,1:1,IMG_8669.png)

Looking Ahead

America can be as free and prosperous as ever if we stand firm on our principles and hew to what has always made America the greatest nation in the history of the world. There is no holding back freedom and American prosperity if we lean on the principles and pillars outlined in this agenda – such as a strong national defense, free markets, traditional values, the right to life, school choice, patriotic education, border security, free, fair, and reciprocal trade, confronting the Chinese Communist party’s aggressive agenda, – and if we keep faith with our Constitution. Securing these pillars is essential to the survival of freedom. The solution to any problem can be found in strengthening American culture, American opportunity, and American leadership. WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage. For our country and our future, for our children and our grandchildren, we must move forward united and with faith in the One who has ever guided the destiny of our land – move forward to ensure that the best days for the greatest nation on earth are yet to come.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448340

File: 6fbe93de0f66ece⋯.jpeg (142.76 KB,493x659,493:659,IMG_0507.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

03e78a No.20448341

>>20448336

you are clueless. Private ownership does not mean the public cannot post.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

26e788 No.20448342

YouTube embed. Click thumbnail to play.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7bf048 No.20448343

File: 5269967077b6271⋯.png (649.47 KB,1080x997,1080:997,5269967077b62714f77e1b0491….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

176c9c No.20448345

File: d8e6b1cc1334cbb⋯.png (1.54 MB,3774x1470,629:245,bill.png)

Tater landsempty callsignmaybe he gets out without tripping.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0b733c No.20448346

YouTube embed. Click thumbnail to play.

excellent look at migrant crisis in NYC

mind blowing - they live in full-service fancy hotels and are paid and provided for, but can't work 7 months after their arrival. they all thank Biden for their circumstance. meanwhile tax-paying Americans continue to struggle and suffer.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

334c2b No.20448347

File: 152beeada05b5a3⋯.jpg (301.06 KB,1280x720,16:9,Hydrogels_in_COVID_Vaccine….jpg)

Hydrogels in COVID Vaccine as Programmable Human Interface

watch video here https://t.me/gregreesevideoreports/457

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

24035c No.20448348

File: 8bbcbb49e60e971⋯.jpg (72.84 KB,645x407,645:407,adls.jpg)

>>20448344

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448349

>>20448341

If there's no demand for it, you can keep it closed, and if there's another space, you can post it there, so what's the problem?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9fc25f No.20448350

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

@$$wuz$old

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

334c2b No.20448352

File: c10eeb958163e00⋯.png (549.85 KB,1233x579,411:193,Screenshot_800_.png)

https://www.bitchute.com/video/kefnCXMJrNTg/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a3e5e3 No.20448353

>>20448337

sorry, I have places to go people to see, and I am bowing out for this bread.

maybe I'll be back later in the evening.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448355

File: c286a668819f1fd⋯.png (752.29 KB,798x801,266:267,c286a668819f1fdea7159d8656….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448356

File: 0d9755a45006e7f⋯.mp4 (2.6 MB,854x420,61:30,DOVAKIN.mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448357

>>20448341

There are plenty of environments where you can speak freely at all times, so why stick to a particular place?

What is the reason?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448358

File: 6cdbd95df6244fd⋯.mp4 (12.38 MB,720x1280,9:16,5_Steps_to_Make_Your_Day_B….mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9fc25f No.20448359

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

wut bout duh child seks slavurs french nazi xinu juw iphones invade

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448361

>>20448353

You don't sound very forgiving.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

99b597 No.20448362

File: 62655924f1515bf⋯.webp (45.47 KB,500x742,250:371,512px_The_Authoritarian_P….webp)

"THE AUTHORITATIVE PERSONALITY" Adorno T. W. (1950)

Read here: https://archive.org/details/dli.ernet.469826/mode/2up

Only 'God's Chosen People' are permitted to have ethnic, religious, racial, social and geographical purity and exclusivity, led by a strong, responsible, loving, patriarchal based, family unit.

For everyone else Equity Diversity and Inclusivity are essential factors in all areas of life with White European Masculinity considered Toxic with a capital T. and must be neutralized.

No more portrayal of 'Masculine White Male Heroes' allowed in your (((their))) media, ask Henry Cavil or any other White Male actor who hasn't been castrated.

Where do all the so called 'Woke' social justice philosophies come from? Certainly not from a grass-roots, fundamental societal (Family) sources.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448363

>>20448341

If there was a reason to stick with it, did you articulate it?

It seems as if you're just complaining.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448364

File: a8758a6cd041f96⋯.jpeg (103.45 KB,387x619,387:619,cuomo_andrew_really.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448365

File: 3f68045e3999795⋯.png (89.02 KB,419x259,419:259,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cf489c No.20448366

File: b26a62aef71269e⋯.jpeg (392.39 KB,1106x577,1106:577,baffled.jpeg)

>>20448347

maybe the vaxxed have been programmed to reckless behavior that will result in death- like driving into buildings and trees, taking street and big Pharma drugs, more vaxx, suicide, murderous rampages, sacrificing of children, chaos, madness

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

334c2b No.20448367

File: 83a96e5a5fa4632⋯.jpg (67.01 KB,804x503,804:503,photo_2024_02_20_07_34_06_….jpg)

File: e5e4e1ce23fe381⋯.jpg (73.8 KB,640x440,16:11,photo_2024_02_20_07_34_06.jpg)

What is Smart Dust?

Smart dust is in the chemtrails. This is why we are seeing a decline in birds and other wildlife. Smart dust has the potential to cause environmental damage. As these sensors are very small and light, they can easily be blown away by wind and end up in rivers or oceans where they are harming wildlife. These are single-use items, and there is no practical way to retrieve them once deployed. Similar to microplastics, smart dust could eventually accumulate in us and the environment and cause irreparable damage.

Smart dust is highly intrusive and poses a threat to privacy. Thousands of virtually invisible sensors collecting data on our movements, conversations, and activities without oversight is a significant cause for concern. Fallen into the wrong hands, the data collected by smart dust will be used for nefarious purposes. I assume it already is.

https://www.bitchute.com/video/PrxgloqkIduY/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e57533 No.20448369

File: 1d4b48568ac89d0⋯.jpg (145.87 KB,553x369,553:369,cuomobill.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

31d6f5 No.20448370

>>20448196 PB

>The Mayor of @CNLV announces the city will discriminate against white business owners.

White people should boycott Black businesses.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

65d375 No.20448371

YouTube embed. Click thumbnail to play.

https://youtu.be/Rqacvc9UJfw

Fani Willis HEATED in Disqualification Hearing & Cries Victim At Church

CartierFamily

901K subscribers

2/20/2024

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448373

File: f682c51d8948101⋯.jpg (173.98 KB,960x625,192:125,willow2.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448374

File: 102749ebeb405fc⋯.mp4 (2.71 MB,720x1280,9:16,Eric_Adams_SHUTS_DOWN_prot….mp4)

>>20448368

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

03e78a No.20448375

>>20448349

you have the problem.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448376

>>20448367

>This is why we are seeing a decline in birds and other wildlife

Don’t they have seed vaults around the world?

Surely those planners have bird seeds stored.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448377

File: 278fe06a052943d⋯.png (751.44 KB,946x509,946:509,278fe06a052943d53d4a887374….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

56ae9d No.20448378

File: 733c4dbcc3e1e1e⋯.png (34.6 KB,630x512,315:256,rush.PNG)

OMFG looks like they are finally admitting COVID shots hurt people and are blaming Trump's Warp speed.

You can't make this shit up.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

334c2b No.20448379

File: 85d6d9ce819d768⋯.jpg (89.55 KB,1080x989,1080:989,photo_2024_02_20_12_46_35.jpg)

https://www.thegatewaypundit.com/2024/02/judge-engoron-accused-banging-secretary-opposing-counsel-previous/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448381

>>20448341

If you are talking about anomalous deletions in QR

Don't.

That's been going on for ages.

It's a new thing now.

I've outgrown this anon.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

03e78a No.20448382

>>20448363

I am not the one complaining. You are about free speech on a private board. so just fuck off with your free speech nonsense.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448383

File: 7aba0d1714dc675⋯.mp4 (6.07 MB,848x720,53:45,dance_if_you_want_to.mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448384

>>20448375

You too.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

52b3cc No.20448385

File: 841d7baac5b3b6e⋯.png (118.93 KB,374x210,187:105,ClipboardImage.png)

>>20448055 Tucker Carlson says Boris Johnson wants "a million dollars" from him to talk about Ukraine (PN) Why would anyone want BJ back? Would Nigel actually work with BJ, he's a criminal.

10 Dec, 2023 17:21

UK Tories plotting Boris Johnson's comeback – Daily Mail

The ex-British PM is seen by some Tory rebels as being the most formidable opponent to Keir Starmer’s Labour, according to a report

Tory rebels are considering a plan to “crash” UK Prime Minister Rishi Sunak’s Conservative government and reinstall Boris Johnson as leader as concerns rise over flagging poll figures and surging support for the opposition Labour Party ahead of an expected general election next year, according to the Daily Mail.

Amid the high-profile cabinet departures of former Home Secretary Suella Braverman and Immigration Minister Robert Jenrick, Sunak’s authority over Tory ranks is set to be further tested this week when he faces a pivotal vote over his flagship Rwanda migrant-handling plan.

Citing anonymous Conservative MPs, the Daily Mail wrote on Saturday that Tory insiders are urgently attempting to address a growing revolt – with peerages being offered to possible rebels to convince them to toe party lines. The tabloid claims that disgruntled Tories will increasingly seek to “crash” the Sunak government with a series of Commons votes and outspoken interventions, which the newspaper’s sources said is crudely referred to as an ‘Advent calendar of sh*t.’

Furthermore, the outlet cites anonymous sources as saying there is a belief within the party that Johnson – who stood down as prime minister in September 2022 – is the only person who possesses the necessary skills to pose a challenge to Labour leader Keir Starmer.

The newspaper also notes that the Reform Party, thesuccessor to Nigel Farage’s Brexit Party, is siphoning votes that might otherwise have gone to the Conservatives– with a so-called Johnson/Farage “dream ticket” beingfloated. It also notes that Farage’s appearance on a popular UK reality television series has bolstered support for the Brexit architect.

Johnson, who is a columnist for the Daily Mail, did not elaborate on his possible political ambitions when contacted by the newspaper. A spokesperson for Farage, who, like Johnson, is not currently an MP, said that any political alliance between the two would “soon end in tears.”

“Reform are going to kill us,” the newspaper cites an anonymous Tory MP as saying. “We have to buy Farage off. The plan is we get him into the Lords, give him some brief like we did with [David] Cameron – maybe even home secretary– then go to the country with the ‘Dream Team.’”

Another possibility for a post-Sunak scenario, per the Mail, would be for Johnson ally and former Home Secretary Priti Patel to be appointed as temporary PM while Johnson seeks a ‘safe’ seat in the election – after which he would hypothetically return to Downing Street.

Recent polling has indicated that Labour holds a commanding lead over the Tories ahead of the next general election, which must take place before January 2025.

https://www.rt.com/news/588843-uk-boris-johnson-tory-rebels/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448386

File: e76d498c7cc5b60⋯.png (416.53 KB,642x828,107:138,ClipboardImage.png)

STOP ALL FUNDING TO ISRAEL

STOP ALL FUNDING TO UKRAINE

CLOSE THE BORDER

SAVE MAUI FROM WEF GLOBALISTS!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448388

File: 7060dffd7da573f⋯.png (38.08 KB,170x118,85:59,Screen_Shot_2021_04_16_at_….png)

File: ca2895a21726283⋯.png (3.1 MB,1884x1404,157:117,Warp_Speed_Org_Chart.png)

File: 7c4e6dc394099fc⋯.png (1.69 MB,1162x776,581:388,Warp_Speed_Dad.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

03e78a No.20448389

>>20448381

you tagged wrong anon. Have been responding TO the haters.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448390

File: df7407f7a0bebfa⋯.png (567.53 KB,549x557,549:557,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448391

Yes Normies

you have AIDs

Not Full Blow AIDs

Just a Little Tiny bit of AIDs

Does Framing it like that make it Better?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

83b330 No.20448392

File: 27de22c9600e44e⋯.png (1.05 MB,1088x820,272:205,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

08dd54 No.20448393

File: 7cd27d354f2518c⋯.png (328.4 KB,658x620,329:310,ClipboardImage.png)

>>20448296

Thank you baker…………!

My neighbor is on point.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448395

File: 3412a4f62864cf5⋯.jpeg (100.79 KB,339x335,339:335,CF77C855_D012_4FB7_BAE2_D….jpeg)

>>20448382

Oh, I see.

OK.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9111ce No.20448396

File: 5daf062a270b653⋯.jpg (49.16 KB,600x600,1:1,st_small_507x507_pad_600x6….jpg)

The jab made people stupid. Moderate thinkers who could still manage critical thinking seem to have gone over to the dark side narrative repetitions after the jabs.

Could the nano particle graphene oxide really have made them antennas to pick up the narratives carried over the wireless airwaves?

seriously? I know that was a theory, but it seems to have borne fruit.

How do we pipe them free thinking again?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f41c45 No.20448397

File: 224fa08244ded33⋯.jpg (39.29 KB,524x485,524:485,ddfrbrsfdfghj.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448398

File: d5a4ce3c9002aca⋯.jpg (18.93 KB,140x432,35:108,borisj_freak.JPG)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448399

File: 832b4b11229ba98⋯.png (644.36 KB,1094x674,547:337,Screen_Shot_2022_04_09_at_….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b70f08 No.20448401

File: ed28d4ca3b25865⋯.png (334.45 KB,942x447,314:149,obamabutf.png)

>>20448378

mother jones already said that Trump can't take credit for Warp Speed. it was all put in place by Obama.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

caf1df No.20448402

File: 3c3d964558dd899⋯.png (679.95 KB,1683x948,561:316,Screen_Shot_2024_02_20_at_….png)

File: cfcd74991aa7f63⋯.png (1.28 MB,1024x768,4:3,TRUMP23.png)

https://jonathanturley.org/2024/02/20/pay-to-play-trump-faces-a-staggering-cost-for-appeal/

Trump supposedly has to come up with hundreds of millions of $ just to get an appeal.

How is that fair?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

32eca6 No.20448403

>>20448382

when is the concept of free speech nonsense?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448404

>>20448389

Huh?

Hate?

I'm looking forward to it, okay?

You see the hate?

Maybe that's projection, huh?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

65d375 No.20448405

File: ff6b3282462f025⋯.png (528.92 KB,1100x451,100:41,Night_Shift_escaping_the_m….png)

>>20448377

digits and kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448407

File: 10538218288df3c⋯.png (161.58 KB,1500x844,375:211,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448408

File: d88adc5e5033eab⋯.png (227.9 KB,515x290,103:58,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448409

>>20448389

Good morning, asshole.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448410

File: dc52453963faaee⋯.png (1.25 MB,890x909,890:909,ClipboardImage.png)

>>20448396

only 3% of the population is Vaccinated

Vaccinated = 8 Shots

97% of the Population isn't Complying

Which is a good sign

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

94c52b No.20448411

Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About ItWhy Journalists are Afraid

https://rumble.com/v4eofsi-tucker-carlson-mass-migration-is-destroying-america-and-no-one-is-doing-any.html

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

65d375 No.20448413

Dr Ardis says Vitamin C to help prevent cancer fyi

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448414

File: 236bae248bae7e8⋯.png (89.38 KB,568x413,568:413,IMG_0245.png)

>>20448403

When the Jewish don’t like what you say?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448416

INVADERS AND ILLEGALS GOT NO JABS NO JOBS

WHY ARE THEY HERE AGAIN?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448417

>>20448413

Cedar Leaf Tea

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448418

>>20448389

So?

What's up?

Aura fag.

What color is my heart now?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448419

File: d211a26a8af5534⋯.png (1.22 MB,1158x688,579:344,smart_dust.png)

>>20448367

vintage meme

2020

vintage sauce

2018

https://www.forbes.com/sites/bernardmarr/2018/09/16/smart-dust-is-coming-are-you-ready/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cdca73 No.20448420

>>20448393

Changes yours to FBIareFaggots

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9111ce No.20448421

>>20448410

thanks anon

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448422

File: db7248dee4b4482⋯.png (955.71 KB,720x1356,60:113,Capture_2024_02_20_18_38_5….png)

>>20448296

Keep the fur

TYB

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

215f76 No.20448423

File: 98d62538c74f9c1⋯.png (716.79 KB,569x429,569:429,capture_750_31122023_13000….png)

File: 614c1a7d66de0b3⋯.png (520.56 KB,587x302,587:302,capture_1921_21012024_0923….png)

File: 8d721cac52a5489⋯.png (695.04 KB,822x288,137:48,capture_1504_16012024_1001….png)

File: 829621839bc6c46⋯.png (125.11 KB,367x116,367:116,capture_694_30112023_19112….png)

File: 4ee1b7922853803⋯.png (541.23 KB,640x288,20:9,capture_563_17122023_01024….png)

aei

laffin

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

49200f No.20448424

File: da06718c6b02b29⋯.jpg (68.4 KB,553x572,553:572,1708193336503713.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

caf1df No.20448426

File: 9f8cc78b470c4c9⋯.png (858.69 KB,901x645,901:645,HALEY36.png)

The HO2 ticket

KaMOOla and Ikki Nikki!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448427

File: acb12fc10f0aee5⋯.png (836.48 KB,732x491,732:491,epsteinmovie2.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fda496 No.20448428

File: cef6ce02b522cae⋯.jpg (21.26 KB,480x360,4:3,aidsj.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3bb96a No.20448429

File: 7f2370fb35dd261⋯.jpg (8.05 KB,243x207,27:23,download_jpeg_7.jpg)

>>20448296

TYB

There's always time for forgiveness.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

385d14 No.20448431

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

rasberries make kenedy jealous >>20448379

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448432

File: 0490110eb872322⋯.jpg (25.49 KB,450x600,3:4,boris_morlock_johnson.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

08dd54 No.20448433

>>20448420

I was thinking CIA or NSA.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448434

>>20448416

Why are you here?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7db628 No.20448435

File: c006659fcdf2097⋯.mp4 (4.23 MB,1080x598,540:299,Actress.mp4)

File: 22db71dc0d50329⋯.jpg (283.45 KB,1500x998,750:499,22db71dc0d50329413e4332169….jpg)

https://twitter.com/WallStreetApes/status/1759948784904126620

AOC Is A Political Actor

Did You Know Alexandria Ocasio-Cortez Was Elected Thanks To A Casting Call Put Out By Democrats?

AOC’s Brother Submitter Her Application & She Was Chosen By The Executive Director of Justice Democrats Out Of 10,000 Candidates

It’s All On Camera. Here’s The Story, Watch To The End To See Footage Of AOC & Alexandra Rojas Confirming This On Camera

“Alexandria Ocasio Cortez is not really the congresswoman of New York's 14th congressional district.She is essentially an actress. She's merely playing the part of a New York congresswoman.I know this sounds crazy, but bear with me. In 2017, a group called the Justice Democrats held auditions for potential congressional candidates that they would run on their platform for various congressional seats throughout the country.

Alexandria Ocasio Cortez's brother Gabriel submitted her for the role. Now I've auditioned for many acting roles in my day. I've also cast many of my own projects. I know how this works. If you find somebody with star power, even if they don't 100% fit the part, you go with it.

Obviously, AOC has star power. Just look at her. She's a superstar, the most famous person in Congress, maybe ever. Their casting was perfect. Now I didn't have to go digging for evidence for this because they freely admit it.

They brag about it.”

Alexandra Rojas Executive Director of Justice Democrats “Back in 2016, we put out a call for nominations. We got over 10,000 nominations. Out of those 10,000 nominations, we found Alexandria.”

Alexandria Ocasio-Cortez “My brother told me that he had sent my nomination in the summer, but I was, like, literally working out of restaurant. It's like, there's no way.”

“- A casting call. They had a casting call. They cast Alexandria Ocasio Cortez in the role of congresswoman.”

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b70f08 No.20448436

File: 6c5c461d318aa2d⋯.jpeg (22.75 KB,474x474,1:1,stewie.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6b7289 No.20448438

>>20448416

neither did your mail carrier and that fed comes to your house every day

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448439

YouTube embed. Click thumbnail to play.

>>20448401

>>20448401

>Trump can't take credit for Warp Speed

surely such fake narratives were anticipated by PDJT well in advance!

he knew other people would try to take the credit, and he told everyone at CPAC to never let them!

because the Trump Administration is fully responsible for the vaccine, said POTUS at CPAC!

AFTER he left office!

vidrel

23:15 begins vaccine review and credits

https://youtu.be/9kL9KiUNoZQ

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448440

>>20448437

I'm glad there are people like you on the Research board.

I feel like I'm still allowed to speak this way.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

83b330 No.20448441

File: e021a8861512541⋯.png (1.01 MB,1080x809,1080:809,ClipboardImage.png)

File: 9a663ec53517796⋯.png (86.26 KB,1821x346,1821:346,ClipboardImage.png)

File: 1c5017ad39bd7ef⋯.png (1.52 MB,3654x3962,261:283,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

15bc06 No.20448443

File: f8b2562d71e4540⋯.png (638.9 KB,818x821,818:821,Screenshot_2024_02_20_at_2….png)

The Record From Recorded Future News

@TheRecord_Media

5h

.@TheJusticeDept has unsealed indictments against two alleged members of the #LockBit ransomware group, Artur Sungatov and Ivan Kondratiev, also known as Bassterlord. The Treasury Department also announced sanctions against them.

Feb 20, 2024 · 6:27 PM UTC

https://twitter.com/TheRecord_Media/status/1760008351906242654

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448444

>>20448434

to nail VPN's of the cyber engagement center

/filtered

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448445

>>20448366

The social credit system was the driving force behind control over the vaxx and lock downs inside chyna. Now analyse those who complied with vaxx and lockdown measures outside of chyna where no "social credit" app exists (yet) and people still did as thy were told through social manipulation and taking sides with a misguided morals.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448446

File: 89114522e1e36ee⋯.png (1.66 MB,1024x1024,1:1,89114522e1e36ee724e8c63bdb….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

891c2f No.20448447

>>20448304 LB

Her Snek no good

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448448

>>20448438

Cyber engagement center horse shit propaganda

/filtered

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448449

>>20448416

I would wager

That Cargill

Stole all their land with the new shipping ports on the Amazon and Congo basins

Then they get counted and given an A number

So that they can borrow on their asses

Just like they did you

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

31d6f5 No.20448451

>>20448401

Once again, Trump uses himself as bait.

They will only let the truth leak out if they think they can somehow use it to try to dis Trump.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8b47b6 No.20448452

File: bf2e6eca7c22662⋯.jpg (166 KB,1200x628,300:157,Cuomo_Homes.jpg)

>>20448364

targeting conservative voters, likely to actually vote

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448453

>>20448444

I don't filter. It's a hobby.

I feel like a guy who can't handle the truth.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448454

>>20448449

since you have ttwo posts I think you are paid by BEHAVIOUR MATRIX 120 k a year.

But still you are really just a VPN piece of shit for the cyber engagement center

/filtered

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

790580 No.20448455

File: dcf6f5fe290db55⋯.jpg (33.63 KB,500x349,500:349,20240220_184550.jpg)

Get ready for the dancing nurses.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8b47b6 No.20448456

>>20448367

cell phones work better, and actually exist

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448457

>>20448341

It is playing the "muh censorship" card again

Generally a sign the DOAR faggots are around again

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448458

File: 9db2bc102717d03⋯.png (281.76 KB,400x508,100:127,ClipboardImage.png)

>>20448398

>>20448432

SHE MAN, 'ta ta tata ta ta taaa'

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

124dce No.20448459

File: 99a6d8f6be8d247⋯.png (7.29 MB,2048x1416,256:177,ClipboardImage.png)

File: 77df40400095ede⋯.png (4.85 MB,1920x1080,16:9,ClipboardImage.png)

>>20448402

>How is that fair?

Fairness is a plot device.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fda496 No.20448460

File: 539c72273a7c2d5⋯.jpeg (40.48 KB,610x411,610:411,obamatom.jpeg)

>>20448451

exactly…mother jones claimed Ivanka was trying to give her Father all the credit and poor Obama was the real hero

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

31d6f5 No.20448461

>>20448452

Also, a good way of getting rid of the useless eaters who are using up Medicare and Social Security dollars.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448462

>>20448454

And I think

You need

To spit that dick out

It ain't yours

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c3bc22 No.20448464

File: 38ef0a779e763ee⋯.png (60.47 KB,492x405,164:135,1708383686284306.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448465

>>20448450

Why did so many unusual deletions start?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

385d14 No.20448466

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

wrong war reich rasberries

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448468

File: 3746c5d5eefb2a1⋯.mp4 (771.63 KB,640x360,16:9,You_No_ticket.mp4)

>>20448463

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448469

>>20448429

Get lost, guilt trip shill.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448470

>>20448455

notable

Recruitment underway for 'Disease X' Dance Choreographers for 2024 planned pandemic and lockdown

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a771bf No.20448471

File: 31c57aa434a881c⋯.png (161.76 KB,275x375,11:15,IMG_20240216_084223_remove….png)

File: 7ab96d83947f02a⋯.jpg (14.91 KB,292x257,292:257,1708298332003895.jpg)

Unfinished meme any takers….o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

49200f No.20448473

File: 30a2c2d87f5095f⋯.gif (507.69 KB,640x412,160:103,1663732660372387.gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448474

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

58ddd7 No.20448476

Twitter embed. Click thumbnail to play.

What english accent is this?

(Video of a mercenary in Avdiivka)

Anon hears two accents, American (calling FUCK, let me get back there for a minute) and Australian (you're OK mate… can you get up, you gonna have to get up)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fdd8e4 No.20448477

>>20447355 pb

Asked this question the other day, didn't get an answer. Cui Bono? Who benefits with the death of Navalny? Putin or Putin's enemies?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

597e91 No.20448478

>>20448455

Where da sauce?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448479

>>20448385

I'm just going to nix this in the bud. NO, Bojo is not making a comeback in the Conservative party. He is a remnant of the old tory gang. Cameron is also, but is a different fish (or pig) all together. Eyes need to be on him and Samantha.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

691de4 No.20448480

File: d840694f8831713⋯.jpg (146.43 KB,600x600,1:1,06899f4e7dafd4f543c552b7c2….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

47b43c No.20448481

File: dfe788072c01b85⋯.png (1.53 MB,768x768,1:1,dfe788072c01b85c2aace1a355….png)

File: ab8341abb9804e3⋯.jpg (184.53 KB,1024x1018,512:509,868160352_3a7c1fafd5_b_182….jpg)

File: 8d84d25e10bbde1⋯.png (392.78 KB,635x640,127:128,8d84d25e10bbde1b73c589baf4….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7d9c76 No.20448482

YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

99b597 No.20448483

YouTube embed. Click thumbnail to play.

NUMBER 1 on Radio Jerusalem since 1969.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

47b43c No.20448485

File: 6c552559b1ce2d3⋯.jpg (161.02 KB,1200x815,240:163,It_s_the_.jpg)

File: 7688d9d35f88368⋯.png (3.06 MB,1920x1080,16:9,Biden_and_the_Jews.png)

File: 34f60656b67bc94⋯.png (3.47 MB,1920x1080,16:9,Trump_and_the_Jews.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5467b No.20448486

File: 5424e9d878646a0⋯.jpg (163.15 KB,1024x1024,1:1,OIG_4.jpg)

>>20448296

Holy, has it finally been two weeks?

Or should I check back in a fort night?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c3bc22 No.20448487

File: ac94a30bdbce41b⋯.jpg (94.6 KB,640x604,160:151,ac94a30bdbce41b4261541cbca….jpg)

File: b0d9e73cf2013d3⋯.png (672.8 KB,1200x1600,3:4,b0d9e73cf2013d383d6a920482….png)

File: 5dffc64ed9e6704⋯.png (471.2 KB,490x842,245:421,58064786245ff0897cda02e929….png)

Prayer Time Soon

Get ready, it's going to be Biblical

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3bb96a No.20448488

File: b648da6cd8a3767⋯.jpg (1.04 MB,2048x2048,1:1,nft.jpg)

>>20448469

No one is guilting anyone. I forgive you for your projections. You consider forgiveness as weakness when it couldn't be further from the truth. It makes you stronger. God bless you, and thank you for baking.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c81173 No.20448489

File: 8ee319c4bf40492⋯.png (804.31 KB,1079x741,83:57,ClipboardImage.png)

Wonder who took down Brendon O'connels channel after it was posted earlier?

Pathetic.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2aa2d0 No.20448490

File: 7e380670ab6e2c1⋯.png (822.97 KB,1062x781,1062:781,ClipboardImage.png)

We all photograph sawdust, dont we ?

Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

https://www.thegatewaypundit.com/2024/02/hunter-bidens-lawyers-lash-special-counsel-claim-photos/

Hunter Biden’s lawyers lashed out at Special Counsel Dave Weiss and claimed photos on Hunter’s iPhone are sawdust, not crack cocaine.

The Justice Department last Tuesday released photos from Hunter Biden’s iPhone showing his use of cocaine, crack cocaine, and drug paraphernalia.

Last year, Hunter Biden was indicted on federal gun charges. He faced indictment in a Delaware court on three counts relating to his possession of a firearm while using drugs.

These charges include one count of making a false statement in the purchase of a firearm, one count of making a false statement related to information required to be kept by a federal firearms licensed dealer, and one count of possession of a firearm by a person who is an unlawful user of or addicted to a controlled substance.

The Gateway Pundit reported back in October 2020 that his then-lover and deceased brother’s widow, Hallie Biden, tossed the gun in the trash. Hunter admitted this in an online conversation with his family when they accused him of inappropriate conduct in front of a child.

Five years after Hallie Biden discarded his firearm in a trash can behind a Delaware grocery store, the weapon underwent further examination by FBI officials, according to the New York Post.

According to a court filing by Special Counsel David Weiss, FBI agents retrieved the sealed Colt Cobra 38SPL revolver from a state police vault. They photographed the weapon and noticed white powder on the pouch that contained the firearm.

The DOJ released photos from Hunter Biden’s iPhone showing his illicit drug use to prove he was addicted to drugs while he lied about it on a federal firearm form.

Hunter’s lawyers attacked the special counsel in a court filing on Tuesday.

“Mistaking sawdust for cocaine sounds more like a storyline from one of the 1980s Police Academy comedies than what should be expected in a high-profile prosecution by the U.S. Department of Justice,” Hunter Biden’s lawyer said in a court filing.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

385d14 No.20448491

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

bizzare parra adumma mortgage late

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448492

File: 7e6f0730c1e5558⋯.jpg (77.86 KB,945x612,105:68,7e6f0730c1e555817509b62552….jpg)

>>20448403

When it is mentioned by you fuckheads

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

15bc06 No.20448493

File: ef6e4230312b9c0⋯.png (488.68 KB,818x757,818:757,Screenshot_2024_02_20_at_2….png)

https://twitter.com/TheRecord_Media/status/1758634152570814736

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

691de4 No.20448494

File: d69f45895a9611d⋯.jpg (30.94 KB,290x290,1:1,1109cef5c4c8ef4b04be5d9742….jpg)

File: 46bca926a734159⋯.jpg (41.69 KB,297x246,99:82,3341cd07d51886124c6af8a1df….jpg)

File: 0ee7ff9ef45b1e1⋯.png (45.34 KB,325x278,325:278,7326e4e95cf613782eee8efb3f….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

47b43c No.20448495

File: 1efb705f32f0b99⋯.png (278.75 KB,325x507,25:39,zrtedg.png)

File: 51173bdc729b776⋯.png (714.57 KB,840x472,105:59,hjzfgd.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448496

File: 529b6cf4762d52e⋯.png (293.63 KB,265x583,5:11,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448497

commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist and identity fraud who hold government office are stealing money and putting the blame for war crimes on us when we can't control the US government anymore.

These fucking trans national war criminals have conspired to KILL EVERY AMERICAN.

The SHERIFF PROTECTS THESE MOTHERFUCKERS!!!

https://www.youtube.com/embed/8leaZ7GzjmM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448498

File: 177b09a457fd03d⋯.png (633.5 KB,500x635,100:127,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

31d6f5 No.20448499

>>20448463

kek

They thought he was one of them.

That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

691de4 No.20448500

File: 296f91a2fc50a8e⋯.png (731.32 KB,600x794,300:397,a1.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2029b0 No.20448501

‘Don’t touch the kids,’ Putin tells gays

Adults can live and let live, but children are off limits, the president warned

Russia is actually tolerant of people with non-traditional sexual orientations, so long as they don’t target children or flaunt their preferences, President Vladimir Putin said on Tuesday.

The president made the remarks while addressing visitors to the ‘Strong Ideas for a New Time’ forum, a yearly event organized by Russia’s state-backed Agency of Strategic Initiatives.

“We are quite tolerant towards people with non-traditional sexual orientations. We just don’t flaunt it, and we don’t believe it’s right to flaunt it. Let everyone live – the adults – as they want. Nobody limits them in anything,” Putin stated, explaining that, basically, there are only a handful of rules which limit the LGBTQ community in the country.

As for children, I have already said many times: ‘Don’t touch the children.’ That’s it. This is the first one. And the second one is, we are, first and foremost, a state that is guided by traditional values.

Over the past few years, Russia has gradually tightened its legislation aimed at countering the spread of what it calls “LGBT ideology.” The drive began in 2013, when the dissemination of said propaganda was outlawed among minors.

The ban was reinforced in December 2022, when new legislation introduced major fines for anyone found guilty of promoting “non-traditional sexual relations,” pedophilia, and transgenderism among minors and adults alike.

Late last year, the Supreme Court of Russia outlawed the “international LGBT public movement,” designating it as extremist. The ban stemmed from a lawsuit filed by the Russian Justice Ministry, which asked the top court to do so, arguing that the movement has been involved in “incitements of social and religious discord” as well as exhibiting unspecified “extremist traits.”

The extremist designation has been harshly criticized by multiple rights groups in the West, which have argued that it is “absurd” and vague, and that it has had a “catastrophic” effect on the LGBTQ community in Russia. The inclusion of any group in Russia’s “extremist organizations” list effectively bans all of their activities and outlaws all of their associated symbols.

https://www.rt.com/russia/592788-gays-welcome-putin-says/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448502

File: e285d0a54832924⋯.png (292.03 KB,436x395,436:395,ClipboardImage.png)

>>20448479

>pig

Kek

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a771bf No.20448503

File: 8a9e861c92054d9⋯.png (1.54 MB,1080x1398,180:233,Screenvg.png)

>>20448496

Lmao good one anon…o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448504

YouTube embed. Click thumbnail to play.

>>20448483

surely you're not tuned to the right frequency

THIS is the number one song, in Jerusalem and throughout the world

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

312af8 No.20448505

File: 8076b6eb39dfc30⋯.png (150.92 KB,1444x290,722:145,You_are_not_alone_3931.png)

File: 84efe3a6aa8dfed⋯.png (45.01 KB,619x272,619:272,The_Lord_is_not_slow_in_ke….png)

Wow, just tried to red-pill someone on Trump's goodness by using the whole Trump Sneaker thing. I thought if they actually knew someone who got in on buying the sneakers that they would say “Oh, if it worked for you then there must be something to it.” Nope, nothing. He just kept saying “no one is making money on these sneakers.” I say, “Sure they are look on eBay.” He says, “eBay has all kinds of scams, you won’t receive the sneakers or the money.” Told friend that I was one of a thousand people in America who bought them! I didn't get a congratulations or a raised eyebrow, ZERO curiosity. Not a single question. He just shook his head saying you're going to get ripped off. He's FOOLED you!" Why wouldn't he say “how did you do it? Was it all online, when do you get them, can I see them, what do you mean they are selling for $5,000?” Not a single question, he just said I gotta go. And I said “do you want me to tell you next time this happens?” The answer was “it won't happen again, Trump's trying to rip you off, I gotta go.” He wouldn't accept that the money is not going to Trump and looked upset. I said "Why are you upset, I'm telling you I just won the freakin' lottery?" and he said "You haven't won anything, you are being taken advantage of and I gotta go."

I pray in the name of Jesus that they wake up and see the Light. Strange thing is these are REALLY good, generous, considerate, Jesus loving people, but they are completely blind to the good in what Trump is doing. Keep on praying for these people, please. Don't write them off. They're not all bad, there are still A LOT of good people who are 100% blind to Trump. Do not give up on them, please. Prayer works. Thank you for your prayers, Patriots.

"The Lord is not slow in keeping his promise, as some understand slowness. Instead he is patient with you, not wanting anyone to parish, but everyone to come to repentance." 2 Peter 3:9

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448506

File: 89404b249ca0c65⋯.png (66.08 KB,956x646,478:323,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

47b43c No.20448507

File: afa31e58acf46ce⋯.png (478.28 KB,525x469,75:67,afa31e58acf46ced2ed14bbf7f….png)

>>20448499

>That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.

Retard, half of his family are Yids, the other part are Kikes!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448508

File: 9b87a3c12d2cb5d⋯.png (119.41 KB,258x261,86:87,ClipboardImage.png)

Owned by 6 corps

and 272 execs

bla bla bla it's WRONG!

THIS IS FUKING Feb 20, 2024

FCC + BBG are tainted and controlled by the color of laws.

18 USC 1001b

smith mundt modernization act

ndaa

patriot act

aumf

cog

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2cda72 No.20448509

File: 3413efe3df7da34⋯.jpeg (29.32 KB,474x316,3:2,cabin.jpeg)

File: 4c7809b1892d8ee⋯.png (919.99 KB,944x715,944:715,pepenews.png)

the stage is set

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2029b0 No.20448510

File: 6e07e94015c2266⋯.png (139.71 KB,984x629,984:629,ClipboardImage.png)

Leader of drug trafficking organization imprisoned for international cocaine distribution scheme

https://www.justice.gov/usao-sdtx/pr/leader-drug-trafficking-organization-imprisoned-international-cocaine-distribution

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

903f03 No.20448511

>>20448341

It's not Private.

It's not marked Private

It's not Unlisted

It's Public.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

49200f No.20448512

File: 8ce8a1e322b640f⋯.png (1.27 MB,673x801,673:801,1657407050944.png)

File: ae4680492b077dd⋯.png (1.27 MB,622x834,311:417,1657420085585.png)

>>20448490

"Sawdust"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448513

>>20448488

You forgive because you are too weak to get even.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

31d6f5 No.20448514

>>20448495

Once all of the non-Jewish White people are gone, the White Jews will stick out like a sore thumb and will be slaughtered in the streets.

They are eliminating their camouflage by getting rid of the non-Jewish Whites.

Did they think this thru all the way?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

447a0d No.20448515

YouTube embed. Click thumbnail to play.

Watch this and you will understand why PCR testing can be a problem., INCLUDING IN DOGS AND PAPAYAS.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448516

File: 2ec70b886d22bbf⋯.png (42.43 KB,680x392,85:49,ClipboardImage.png)

>>20448498

Now then, now then…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448517

>>20448472

>>20448474

If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.

I'm pretty sure you could state in red text that you were banned or why, right?

Like this person was banned for this reason.

Is that what should do instead of deleting?

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448518

File: 358368e06507a19⋯.jpg (355.43 KB,720x1600,9:20,Screenshot_20240219_162148….jpg)

File: f4c48608fd9bf5f⋯.jpeg (138.48 KB,1600x900,16:9,GGy6X5NXYAA2Urm.jpeg)

File: 9fb49c2bc5675db⋯.png (598.55 KB,610x407,610:407,9fb49c2bc5675db0714a7d95ca….png)

File: 4f7f4566cb78f91⋯.jpg (21.52 KB,255x211,255:211,c20fa702aa5a55bd701b8e70f4….jpg)

File: d172f6365a8a031⋯.png (14.93 KB,255x158,255:158,bd7fede6a5680b24557eb38eae….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

691de4 No.20448519

File: cc1617e45111307⋯.png (191.85 KB,388x416,97:104,11a1.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448520

>>20448416

TO TAKE YOUR JOB, YOUR HOUSE, YOUR MONEY and YOUR WOMEN

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448521

>>20448510

it's DOJ trying to justify existance when they should be deactivate the DOJ and SENT INTO THE US MILITARY FOR THE NEXT WAR THEY START.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448522

So

Sanctions on the countries with a viable currency

Only thing that gets me

They can say this shit with a straight face

Bastards deserve Emmy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

65d375 No.20448523

File: 3449b6dae9f77ee⋯.png (583.23 KB,1000x735,200:147,epstein_maralago_judge_cli….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

152579 No.20448525

File: 49b9a3f0cd43bf6⋯.mp4 (725.07 KB,320x568,40:71,CreepyDoorLady.mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

676f0e No.20448526

TRUMP LIVE ON LAURA INGRAHAM

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448527

File: 57c41a6e213c965⋯.webm (1.69 MB,854x480,427:240,joe_biden_get_rid_of_whit….webm)

>>20448520

(whitelisted this anon)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cd3944 No.20448528

File: 76a82d79a23c5cf⋯.png (366.44 KB,1109x1536,1109:1536,xsy.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17bbd5 No.20448529

File: 0f2a2616bb53f2e⋯.jpg (12.21 KB,255x254,255:254,0f2a2616bb53f2ede0219c5f72….jpg)

I listened to her speech today and it sounded like a little girl Karen sing songing that she was not quitting…yah,yah,yah, yah, yah!

Wanted to slap the bitch!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2029b0 No.20448530

File: a42b14c980e1039⋯.png (207.38 KB,855x367,855:367,ClipboardImage.png)

Israel has the same Western support as Hitler – Maduro

The president of Venezuela backed the assessment of the Gaza conflict made by his Brazilian counterpart Lula da Silva

Modern Israel enjoys “the same encouragement, the same funding, and the same support” of the collective West like Adolf Hitler’s Nazi Germany before the World War II, Venezuelan President Nicolas Maduro has said.

The president made the remarks on his own TV program With Maduro Plus, backing the assessment of the situation in the Middle East provided recently by his Brazilian counterpart Lula da Silva.

“Powerful family names in the US, Europe and London supported and celebrated Hitler’s arrival to power in 1933. They encouraged him and allowed him to persecute my Jewish ancestors,” Maduro stated. The president made public his Jewish ancestry back in early 2010s, revealing his grandparents were Sephardic Jews who converted to Catholicism.

The Western elites “kept quiet because they were preparing Hitler for him to launch his military power against the Soviet Union,” Maduro explained, stressing that, ultimately, Hitler was “a construct, a monster” created by the collective West.

Modern Israel has turned into the very same thing, the president asserted, urging Jewish people who are still true to their roots to end the ongoing “massacre” of the Palestinians.

“The criminal military apparatus of the State of Israel also has the same encouragement, the same funding, and the same support” of the West, Maduro stressed. “As President Lula da Silva said, the Israeli government is doing the same thing [to the Palestinians] that Hitler did to the Jewish people.”

Brazil’s da Silva delivered the explosive remarks over the weekend, describing Israel’s military action against Hamas militants in Gaza as “genocide” and “slaughter.”

https://www.rt.com/news/592798-israel-hitler-comparison-maduro/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

31d6f5 No.20448531

>>20448513

Why not both?

Just because you forgive someone doesn't mean that you alleviate them from justice.

Forgiving them just prevents them from living rent free in your head.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448532

>>20448526

True Story

https://streamfare.com/foxnews

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

58ddd7 No.20448533

US and EU are not the only ones suffering an invasion crisis. Australia is quietly right up there and with a population of only 25 mil, will be gobbled up by Muslims in short time.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

58ddd7 No.20448534

File: 9d6c69aad8a9e4e⋯.png (155.12 KB,652x456,163:114,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e45293 No.20448535

File: f0d862976bd2a28⋯.png (2.59 KB,368x40,46:5,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448536

>>20448439

That's part of the fun

PDJT says take the vaxx, lefties hate everything PDJT likes, so no vaxx

Lefties steal election, sheeple already scared by MSM, so not only do lefties say "take the vax" but go to mandate the shit or you go to the camps

Now it's time to play the "no, we never wanted the vax, it was all Orange Man" when there's so much video and shit out there proving them liars

Old timey "damned if you do, damned if you don't"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

447a0d No.20448538

>>20448515

Baker, make this notable

This is knowledge that will demolish the deep state.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5be13f No.20448539

>>20448378

So you mean what everyone has known and been saying since he was pimping the Vaxx? Yeah you said they were fedboi shills retard

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448540

File: f8d3902d237678f⋯.jpg (974.79 KB,3548x2037,3548:2037,ANDD2446eeec849a329389ee60….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448541

Transnational Coordinated Terrorism on America is what the fuck is happening and our LOCAL SHERIFF Protects it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

676f0e No.20448542

>>20448532

LISTEN UP……TRUMP LIVE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448543

File: b917f374e469ef5⋯.jpeg (29.81 KB,500x500,1:1,IMG_0510.jpeg)

>>20448512

Apparently a lot of folks are smoking sawdust.

They sell a shit-ton of that online. They don’t even try and hide it either.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c81173 No.20448544

File: c7865797239c644⋯.png (529.38 KB,628x596,157:149,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

544a35 No.20448546

File: 6ef6d155dded440⋯.jpg (134.59 KB,1013x1013,1:1,6ef6d155dded4402d95c51b27e….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448547

File: 0c31789a00b9764⋯.png (1.44 MB,1362x688,681:344,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448548

File: 8c624ff762e0da8⋯.jpg (13.24 KB,255x244,255:244,8c624ff762e0da8aefd9c579ff….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448549

>>20448542

https://usnewson.com/watch/fox-news-live

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b363d7 No.20448550

>>20448378

[Fauci]

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

ba2c6f No.20448551

File: ebabe033aa67ad8⋯.jpg (17.78 KB,255x247,255:247,792bfc213064cfb527731ad6ae….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448552

Big

BIG

BIGLY

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448553

3300 sheriffs just got GAZA GENOCIDE TRAINING…

WHAT DO THEY PLAN TO DO NEXT?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

49200f No.20448554

File: 6736cac7323b7b3⋯.mp4 (1.54 MB,778x360,389:180,6736cac7323b7b3119f05ac020….mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2029b0 No.20448555

File: e02e6e22ea52739⋯.png (236.61 KB,506x554,253:277,ClipboardImage.png)

US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

Russia has already been subject of the most steadily applied US and EU sanctions regimen on earth over the last two years due to the Ukraine war. But in the wake of Alexei Navaly's reported death in a far northern Russian prison, which Western officials are blaming "dictator" President Putin for, Washington is about to roll out with… more sanctions – which it should be noted are "major".

US National Security Council spokesperson John Kirby on Tuesday previewed what he's calling a "major sanctions package" targeting Moscow in response to Navalny's death.

The new sanctions, to be formally unveiled Friday, will "hold Russia accountable for what happened to Mr. Navalny, and quite frankly, for all its actions over the course of this vicious and brutal war that has now raged on for two years."

An course the administration hasn't missed the opportunity to tell House Republicans they must pass Biden's massive $60 billion for Ukraine defense aid bill.

"One of the most powerful things that we can do right now to stand up to Vladimir Putin, of course, is to, again, pass the bipartisan national security supplemental bill and support Ukraine as they continue to fight bravely and assess their country," Kirby continued in his remarks to reporters on a conference call.

The White House is talking about various 'options' in terms of consequences for the Russian opposition activist's death in custody:

In 2021, Biden told reporters that if Navalny died, the consequences for Russia would be “devastating.” Asked directly about that on Friday, the president said his remark was three years ago, and they’ve faced “a hell of a lot of consequences” since then.

Biden directly blamed Russia for Navalny’s death and said: “We’re contemplating what else can be done,” adding, “We’re looking at a whole number of options.”

In Europe, various governments' embassies have been summoning the resident Russian ambassador to condemn Navalny's death and gain answers. Poland was the latest to summon the Russian ambassador Tuesday.

Meanwhile, Navalny's widow, Yulia Navalnaya, has quickly become spokesperson for her husband's cause, having addressed the Munich Security Council over the weekend. While she's relatively unknown, over the past days since her husband's death Western media has been highlighting her words of denunciation aimed at Putin and Moscow. Putin "killed the father of my children," she's told press briefings.

https://www.zerohedge.com/geopolitical/us-hit-moscow-new-major-sanctions-package-over-navalnys-death

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

676f0e No.20448556

>>20448549

TRUMP LIVE

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448557

>>20448538

Anon, self-nommed is automatically rejected

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3bb96a No.20448558

File: dad0606ef919910⋯.jpg (36.35 KB,730x800,73:80,0573cce340d40895f7345e725b….jpg)

>>20448513

>>20448513

I forgive you for your baseless projection without any context or proof. I get even, then I forgive. God bless you.

>>20448531

See what this anon said. Then forgive this Anon for being more spiritually and intellectually ascended than you.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

fda496 No.20448559

File: 21a44e995e53992⋯.jpg (162.65 KB,1280x782,640:391,morellfauci.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e45293 No.20448560

File: 381d97c3e4fd09b⋯.jpg (104.49 KB,453x1183,453:1183,nhed867e6711ae91930fb69e34….jpg)

"Well I settled it about three months ago."

–Trump

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

24eefd No.20448561

>>20448334

<000_Biblical_Smoke_On_The_Water.MP4

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448562

File: 0bcca3bebb44b22⋯.png (721.98 KB,500x713,500:713,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f18ab7 No.20448563

File: 6d992639152ad4f⋯.jpg (143.06 KB,720x847,720:847,20240220_165759.jpg)

File: 69e87ba5f2cc983⋯.jpg (77.77 KB,1024x682,512:341,20240220_165243.jpg)

Hunter Biden attorneys say prosecutors mistook sawdust for cocaine in evidence dump

https://twitter.com/nypost/status/1760057741899333778

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448564

File: 49856c818262090⋯.png (1.13 MB,1214x683,1214:683,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448565

File: 226268d298f5ba8⋯.png (26.06 KB,250x186,125:93,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448566

>>20448536

games without frontiers

war without fears

>That's part of the fun

except humanity dies

including (You)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

451bf7 No.20448567

>>20448296

> Donald Trump and Laura Ingraham

The energy here in Greenville, South Carolina is electric! You can feel the anticipation in the air for tonight’s Town Hall with Donald Trump. Tune in to

@FoxNews

at 7 PM sharp.

6:21 PM · Feb 20, 2024

·

42K

Views

https://twitter.com/IngrahamAngle/status/1760082364858827142

:17

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448568

>>20448543

Man

Bimbo Bakeries

Uses up the sawdust

Cellulose ……..

Who owns the smokable….

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0ad31 No.20448569

File: 8db744f4b385726⋯.png (277.59 KB,712x505,712:505,hunterd.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

676f0e No.20448570

>>20448532

>>20448549

TRUMP LIVE … Town Hall of Laura Ingraham

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

451bf7 No.20448571

Twitter embed. Click thumbnail to play.

>>20448567

>https://twitter.com/IngrahamAngle/status/1760082364858827142

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448572

>>20448557

thats not auto true

this anon has an 80% success rate self nomming

1) use sparingly if needed

2) ulmost always appreciated

spam is spam

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7bf048 No.20448573

File: ea4f6d290943fb4⋯.png (439.45 KB,640x761,640:761,8613dcc46b0c6b1a8cf4440c2d….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448574

File: eed1948ccbfdf14⋯.png (386.29 KB,550x310,55:31,ClipboardImage.png)

>>20448563

Hey Hunter!

I gots wots ya needz

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448575

>>20448555

clown pushing Navalny story

FILT HERD

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448576

>>20448553

I'm hoping they plan on finding you a nice heavy cotton jacket that lets you hug yourself

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

58ddd7 No.20448577

>>20448561

Correct, anon stolled it and frenamed it for anon convenience.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8b47b6 No.20448578

File: 887a634359bb93d⋯.jpg (5.01 KB,169x177,169:177,clown.jpg)

>>20448555

glowing

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448579

File: 1b34276cc7c35de⋯.jpg (295.43 KB,720x1600,9:20,Screenshot_20240219_190440….jpg)

File: 81b05a146b09dba⋯.jpg (378.49 KB,720x1600,9:20,Screenshot_20240219_190432….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448580

It was the Israel Sheriff's that protected against the HAMAS Tunnels and Baby raping head cuttin (p[ropaganda/lies) by shooting thru their own people to get them.

Now 3300 American sheriffs just got GAZA GENOCIDE TRAINING…

WHAT DO THEY PLAN TO DO NEXT?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

451bf7 No.20448581

Twitter embed. Click thumbnail to play.

Trumps Daily Attacks Won’t Stop

6:11 PM · Feb 20, 2024

·

13.9K

Views

https://twitter.com/THEUNITEDSPOT_/status/1760079882669945202

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448582

>>20448531

Empty words; Justice is the opposite of forgiving.

>>20448558

Empty words; getting even means no forgiveness is required hence why it's called getting even.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

971bdd No.20448583

YouTube embed. Click thumbnail to play.

Interesting the speech contents…they touch on what to do with the migrant issue…caused by the democratic opposition…the timing is so…with Our.. The Plan.

We are just continuing their plan..script…proofs here that we are so on target…COZY

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448584

Has you seen picture of GAZA? why not

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d903a5 No.20448585

File: 8b6c5536ad36d23⋯.jpeg (444.11 KB,828x894,138:149,40EF2F18_9D9C_4805_997A_4….jpeg)

Bad doggie comms for the Shift

https://x.com/ktla/status/1760093253418840122

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

447a0d No.20448586

File: c6402a8bb978976⋯.png (262.19 KB,1272x1055,1272:1055,Screenshot_at_Feb_20_18_19….png)

File: 1137bc079283225⋯.png (328.07 KB,1244x1271,1244:1271,1.png)

>>20448557

Well that sucks bro, just watch the video then and you will see why papaya are turing PCR c-19 tests positive

btw this is just 2 of the first non-spike primer sequence I looked into that they possibly use and there might already be a problem..

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448587

Will America look like GAZA after the Sheriff protects Bidens Multinational Invasion?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8b47b6 No.20448588

>>20448569

sawdust pipe

i have been wrong all along, huh

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448589

>>20448472

>>20448474

If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.

I'm pretty sure you could state in red text that you were banned or why, right?

Like this person was banned for this reason.

Is that what should do instead of deleting?

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

If were to state the reason for each and every deletion, we would have to increase the BV.

Well, in other words, are these anons trying to say that there is a problem with the criteria for deleting BOs and BVs here?

That was the point?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1d56f5 No.20448590

File: 6350c05049e8f5c⋯.jpg (581.88 KB,1224x817,1224:817,Ican.jpg)

>>20448567

hint of a threat

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9d9563 No.20448591

>>20448582

>Justice is the opposite of forgiving

Just ice

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448592

How many of the Sheriffs got the Bio Agent Jabs?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1935e3 No.20448593

YouTube embed. Click thumbnail to play.

>>20448322

>the ride never ends

o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

385d14 No.20448594

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

rental rasberries

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448595

File: 7e17f009f2ea823⋯.gif (250.38 KB,498x345,166:115,7e17f009f2ea823f6a4b772aec….gif)

Trump LIVE Faux News TOWN HALL

get in here

FREE WATCHING

https://streamfare.com/foxnews

https://usnewson.com/watch/fox-news-live

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448596

File: c8e66bc3f5a4f6f⋯.jpeg (32.66 KB,381x400,381:400,IMG_0512.jpeg)

>>20448568

Fuck-all. I never knew it did anything. Did you?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

152579 No.20448597

File: 2d74729bc20c4b1⋯.png (412.2 KB,495x578,495:578,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

447a0d No.20448598

>>20448557

They have an entire crew on twitter fucking with antiv c-19 vax peeps and these people don't know much about this video I posted.

It would be fucking aweseome to get someoen to actually talk sense

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448599

America is already over.

The SHERIFF did it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9bdbd9 No.20448600

>>20448585

compton

pitbulls code for blacks

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

03e78a No.20448601

>>20448511

you are literally too stupid to continue this conversation.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448602

>>20448555

As long as your against Russia

Biden will forgive your sins

Even a Nazi Sympathizer

meanwhile an American Journalist dies in a Ukraine Jail

Not a Peep

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448603

File: 7f867c806e2eb2f⋯.png (454.95 KB,500x500,1:1,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

971bdd No.20448604

YouTube embed. Click thumbnail to play.

>>20448583

The New Rogan here humanizing a bit the huge mistake of not seeing History repeat itself or the Dangers of Living in the feels of Ignorance is Bliss

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448605

>>20448597

Okay, you can stay…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448606

File: 8960770eb269c1c⋯.jpg (20.68 KB,236x217,236:217,IMG_20221014_185551.jpg)

File: 2b40347f23e1f97⋯.jpg (23.99 KB,320x230,32:23,IMG_20221201_124446.jpg)

File: 3d715650c4ec99c⋯.jpg (54.27 KB,480x331,480:331,IMG_20221201_124532.jpg)

File: 5f34ded352609a8⋯.jpg (15.61 KB,255x185,51:37,IMG_20221201_124702.jpg)

File: 3607f6704b2a726⋯.jpg (72.06 KB,640x426,320:213,IMG_20221201_124859.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d903a5 No.20448607

Mosquito drones with micro explosives honing in on the ear buds?

Hot summer indeed.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7db628 No.20448608

File: fc8b5d86ee12e14⋯.jpg (456 KB,2560x1169,2560:1169,aaaaaaaaaaaaaaaaaaaaaaaaaa….jpg)

>>20448586

>sequence

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2029b0 No.20448609

File: 3482d5a65e47b83⋯.png (154.89 KB,649x543,649:543,ClipboardImage.png)

>>20448575

>>20448578

Seriously you shills are retards

How am I glowing for pushing what is happening?

Here is your usual sauces then

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0c1f5a No.20448610

>>20448599

the sheriff is just the last Illusion of just law enforcement to die

my sheriff knelt with BLM, did yours?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e45293 No.20448611

File: bb13646dfde5c42⋯.png (278.33 KB,643x643,1:1,ClipboardImage.png)

>>20448543

"smoked" salmon

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448612

if there's ever a new government, I say one line that could have stopped all this non-violently is a new law and oath….

Old oath wasn't bad but the founders missed the new threats commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist or identity fraud

+ so help you god

now make the LAW go with it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7b9427 No.20448613

File: 9c858d23be28309⋯.jpg (172.07 KB,960x960,1:1,fallen7.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

24eefd No.20448614

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448615

>>20448603

Nailed it

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5467b No.20448616

File: 7dba11ed78ab950⋯.png (1.24 MB,1280x720,16:9,ClipboardImage.png)

>>20448382

>so just fuck off with your free speech nonsense.

Evening, Arnold.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448617

>>20448589

But this deletion issue is something we've been talking about for a long time.

Maybe I have to change myself after all?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

451bf7 No.20448618

File: c699ea96eb751a4⋯.png (378.04 KB,758x659,758:659,ClipboardImage.png)

File: d782abcac915174⋯.png (300.06 KB,562x438,281:219,ClipboardImage.png)

>>20448595

>https://usnewson.com/watch/fox-news-live

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448619

>>20448596

Many moons ago

Got some shit

Looked like sawdust

Tasted like fuel oil

And …..shooooooweee

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448620

>>20448611

No. Fucking. Way.!

People are smokin’ fish too?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

08dd54 No.20448621

File: 3b9ab3891136f83⋯.webp (12.09 KB,646x431,646:431,bb.webp)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448622

>>20448610

(whitelisted)

I have no evidence MY sheriff knelt. But I agree with your opinion they knelt to transnational terrorists (and yes I paraphrase you)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

861f29 No.20448623

link to town hall

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448624

>>20448623

https://streamfare.com/foxnews

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

861f29 No.20448625

>>20448623

>>https://usnewson.com/watch/fox-news-live

nevermind

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a674ae No.20448626

>>20448538

your dumfukkery is notable

me me me me me my post my post my post

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e45293 No.20448627

>>20448620

it's crazy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8b47b6 No.20448628

File: 08ce78c58e7614f⋯.jpg (451.75 KB,1101x925,1101:925,clown_mob.jpg)

>>20448609

i was referring to the bereaved widow

who already had a speech written and ready to go two hours after…

but if you identify as a clown, don't let me interfere

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6b7289 No.20448629

File: d8d326c39dd852f⋯.jpg (315.57 KB,880x546,440:273,gavincit.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b25592 No.20448630

>>20448563

was he building something?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448631

File: 7d8b3a6aaacdb72⋯.png (157.75 KB,461x314,461:314,phood.png)

>>20448568

>>20448596

shaped like food

flavored like food

never grows mold

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3bb96a No.20448632

File: 6862f3282978a40⋯.jpg (38.52 KB,444x563,444:563,aP9Z62Q_700b.jpg)

>>20448582

>>20448582

Justice is irrelevant to forgiveness. You can get justice with totally getting even then afterwards you're faced with a choice to harbor resentment or otherwise forgive. You forgive to let go of the negativity. You choose not to forgive to maintain the negativity. I can easily get even with with sub par intellect when it comes to these discussions then very incredibly easily forgive you for all of it. You should try it sometime. God bless you.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

861f29 No.20448633

>>20448624

thanks. sometimes one has to have a backup

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c81173 No.20448634

File: 5cbe3e5dcb2ee6e⋯.png (554.4 KB,911x510,911:510,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7b9427 No.20448635

File: d6906c01e2435a6⋯.jpg (71.32 KB,600x400,3:2,Fallen1.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

385d14 No.20448636

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

not duh first parra adumma

butt wuz tribute

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448637

File: 0c1e78b86d3346a⋯.png (945.08 KB,564x764,141:191,0c1e78b86d3346a95f6543f07c….png)

>>20448597

Morlock bikini line. Yup. Didn't expect that one today.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448638

You guys think Hunter smokes fish?

Joe said he’s pretty smart (I know, consider the source).

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

49200f No.20448639

File: eb8db5f80564a13⋯.mp4 (14.85 MB,1280x626,640:313,eb8db5f80564a13f0abf5b1ce5….mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a674ae No.20448640

>>20448609

nobody gives a shit about navalny

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448641

>>20448617

So you are trying to get me to make the choice to leave by telling me I have to change myself?

Is this Boot Camp for the soul?

Hmmm.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448642

File: 8f4f01d1ed80306⋯.png (233.21 KB,541x308,541:308,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448643

>>20448638

He's been known to smoke parmesan cheese, so who knows? Anything could happen with a crackhead, especially rich ones.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448644

>>20448618

>GREENVILLE SOUTH CAROLINA

>GREENVILLE SOUTH CAROLINA

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448645

>>20448592

called the local cops said at least of the force 17% of the force might be prudent control group.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448646

>>20448631

no that came from Micrographx simply 3d dawg…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448647

File: fd83899b44a3360⋯.png (825.79 KB,750x500,3:2,ClipboardImage.png)

File: dd8d49e6bdbb069⋯.png (829.33 KB,922x499,922:499,ClipboardImage.png)

File: 8d052213a5bc2f5⋯.png (706.56 KB,752x499,752:499,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

58ddd7 No.20448648

>>20448595

>https://usnewson.com/watch/fox-news-live

Thanks anon. Watching…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448649

Notes ~315

#25085 >>20448296

>>20448595, >>20448571 Trump live for Town Hall with Laura Ingraham

>>20448345 Planefag

>>20448362 The Authoritative Personality (1950), Adorno T. W.

>>20448367 What is Smart Dust?

>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid

>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group

>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme

>>20448515, >>20448586, >>20448608 Understanding PCR

>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton

#25085

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448650

>>20448643

it's meth that he smokes, anon

not crack

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7d9c76 No.20448651

File: 2c5e243b66d7743⋯.jpeg (115.87 KB,960x726,160:121,trumptold.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448652

>>20448555

Distraction needed, sanctions won't mean much soon

Remember the discussion last year about the death of the petrodollar once it was not a currency of international trade?

Cairo Officially Ditches American Greenback for Trade

February, 17, 2024

TEHRAN (Tasnim) – In a sign of an unfolding BRICS de-dollarization plan, Egypt has officially started ditching the US dollar in trade.

The country was one of five nations to accept an invitation to join the alliance at its 2023 summit.

The BRICS expansion was the first time the alliance grew since 2001 and had massive geopolitical implications. Alongside Egypt, Iran, Saudi Arabia, the United Arab Emirates (UAE), and Ethiopia have joined the bloc. Now, Egypt has already expressed its desire to move away from the greenback in trade.

Egypt has decisively severed its reliance on the US dollar, aligning itself with the BRICS bloc's strategic move towards de-dollarization.

For much of the last year, BRICS made countless headlines for its activities and initiatives. Those actions were defined by its desire to decrease the international prevalence of the US dollar and to grow its ranks. Subsequently, both of those goals coincide with a development that occurred this week.

Indeed, now part of the BRICS alliance, Egypt is set to ditch the US Dollar in its trade activity, watcher. guru reported.

Specifically, the country’s Ministry of Foreign Affairs stated its intention earlier this week. The country assured that it will work to urge countries it trade within national currencies to lessen the burden of the rising cost of utilizing foreign currencies for settlements.

Furthermore, Egypt said that the decision was a result of a global economic shift. As a matter of fact, they noted the “international crises over the past four years,” as a major development in its decision. Subsequently, it is likely the change in trade currency is rooted in similar factors that have pushed the same action in many of the BRICS nations.

https://www.tasnimnews.com/en/news/2024/02/17/3040570/cairo-officially-ditches-american-greenback-for-trade

More sauce:

Egypt Abandons US Dollar for International Trade

Joy Onuorah 4 days ago

https://businesselitesafrica.com/2024/02/16/egypt-abandons-us-dollar-for-international-trade/?v=7516fd43adaa

Egypt starts getting rid of the US Dollar

Osama Ali Published February 16th, 2024 - 07:49 GMT

https://www.albawaba.com/business/egypt-starts-getting-rid-us-dollar-1553378

Egypt Stops Use Of US Dollar For Trade

By Lucy Adautin February 16, 2024

https://www.theheritagetimes.com/egypt-stops-use-of-us-dollar-for-trade/

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a674ae No.20448653

>>20448632

you are forgiving so many anons in your latest psyop slide you must be about to run out

how about you forgive yourself just before you neck yourself?

post livestream when you kys

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

447a0d No.20448654

File: e346bfe6e32e035⋯.png (166.38 KB,247x528,247:528,Screenshot_at_Feb_20_19_14….png)

TTACAAACATTGGCCGCAAA

GCGCGACATTCCGAAGAA

Screenshot attached has some of their other sequences.

I have to double-check them I might have mistyped into my computer one given night but they should be horrible.

These sequences are for regions other than spike.

https://blast.ncbi.nlm.nih.gov/Blast.cgi (site to search when you realize this is a problem to be focused on)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448655

>>20448640

naval a ny, under radar.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

451bf7 No.20448656

Twitter embed. Click thumbnail to play.

https://twitter.com/simonateba/status/1760030827935633577

BREAKING: President Biden just successfully boarded Air Force One after nearly tripping twice. In the end, the 81-year-old President made it safely to the finish line. CONGRATULATIONS Mr. President. WATCH

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448658

>>20448631

Don't Twinkies

Come with

A warranty……18 to life….

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8b47b6 No.20448659

File: fc7887ec481d153⋯.jpg (30.02 KB,440x198,20:9,npc_alerted.jpg)

>>20448609

>>20448628

you could wait for the autopsy

before you dispute the autopsy

Occam's Razor could be of help too:

why publicize an execution?

why do it less than a month before elections?

and

how many Americans even know who Navalny is?

this tempest is not organic, and is being pushed hard by the family that smokes sawdust

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448661

File: ca306fa0e7c124e⋯.jpg (12.55 KB,255x203,255:203,dredd_pepe2.jpg)

>>20448650

I don't care enough and the difference to even acknowledge the difference.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

447a0d No.20448662

>>20448654

*shouldn't be horrible, I don't expect too many fuck ups in eeeh eeeh fucking letters.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448663

>>20448646

copyright shit ya know

can not photograph offending foods

food disparagement laws

you can find 39% roadkill or euthanized pets in the meat

and

it may be 100% true

but if you SAY IT

you will be sued for "food disparagement"

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3bb96a No.20448664

File: e013565966e8d59⋯.jpg (8.23 KB,248x204,62:51,images_jpeg_4.jpg)

>>20448653

>>20448653

Completely and utterly 100% forgiven for your obvious violence shilling as a fed. God bless you.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

451bf7 No.20448665

File: d42ed0267064a8f⋯.png (438.53 KB,680x627,680:627,ClipboardImage.png)

File: f6eeb1e679e0fc9⋯.png (521.69 KB,680x438,340:219,aaa782ac9b7.png)

File: 0f8199e674d5f94⋯.png (941.04 KB,941x892,941:892,0f8199e88c.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448666

https://usnewson.com/watch/fox-news-live

Trump!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448667

>>20448661 (edit)

>and the

between the

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a9b5 No.20448668

YouTube embed. Click thumbnail to play.

>>20448322

>>20448593

this vid actually

it has most all

of the ride never ends gifs in it

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448669

>>20448661

if you don't care about looking stupid, by all means carry on in your ignorance

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

dca54c No.20448670

>>20448490

Witch hunt

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f18626 No.20448671

>>20448664

seriously,kys

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5467b No.20448672

File: ca97ac848d4fbd8⋯.jpg (162.28 KB,1024x1024,1:1,OIG4_2_.jpg)

>>20448492

>everyone I don't like is OSS

Everybody drink!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7b9427 No.20448674

File: eb6c141c028cda7⋯.jpg (257.18 KB,560x846,280:423,sa2.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448675

>>20448632

>Justice is irrelevant to forgiveness

They are polar opposites. Forgiveness is only possible if you have a bad memory.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

58ddd7 No.20448676

>>20448658

Twinkies is what anon finds in his pants after riding motorbike at 200 mph.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

726079 No.20448677

https://thehighwire.com/news/ny-bill-would-allow-children-to-consent-to-medical-procedures/

NY BILL WOULD ALLOW CHILDREN TO CONSENT TO MEDICAL PROCEDURES

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

32eca6 No.20448678

YouTube embed. Click thumbnail to play.

The documentary delves into the complex and often controversial topic of the depiction of violence by Yahweh, the God of the Bible, and its implications for those seeking moral guidance from the sacred text. Featuring insights from Dr. Joshua Bowen and other preeminent scholars, it meticulously examines the instances where divine commands and actions in the Bible are fraught with violence, raising serious ethical and theological questions. The documentary highlights the lengths to which believers might go to reconcile these narratives with a moral framework, including employing hyperbole or finding justifications for divine decrees that appear morally questionable by contemporary standards. This exploration sheds light on the profound challenges and dilemmas faced by individuals trying to align their faith with modern ethical principles, illustrating the complexities of interpreting ancient religious texts in a modern context.

https://youtu.be/RO_EuhPDdBg

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7ac3ba No.20448679

File: fed0212bb04fbdf⋯.jpeg (235.21 KB,868x778,434:389,149C49C9_5883_412A_BBA3_1….jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448680

File: 25d4dddd0c54ce3⋯.png (862.22 KB,750x500,3:2,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

447a0d No.20448681

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

63ef56 No.20448682

MIGRANT CRIME!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

59dc47 No.20448683

>>20448669

Oh, I'm sorry. I wouldn't want to offend someone by calling them a crackhead when they're a methhead, or vice versa. Who's the idiot now, fuckface? In the filter. Like I said, I don't care enough between the difference to acknowledge the difference. It's a self-destructive hole with those two.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

bcb2f9 No.20448684

File: 35872f0d270fb71⋯.jpg (68.29 KB,500x572,125:143,8gi7xu_1.jpg)

America is the most corrupted country on the planet worse that Israel.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7b9427 No.20448685

File: ad91f9638c16861⋯.jpg (318.28 KB,800x800,1:1,All_of_the_coincidences.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448686

>>20448645

I hear the .mil is worse.

in 2024 when I say Military I have to wonder if they are Illegals, or Mavni or actual foreign attack on us soil, just what the fuck they are.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448687

File: ed0035b106a642f⋯.png (85.11 KB,766x716,383:358,81_2_.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448688

>>20448672

This is a post with Punch/Spice.

Blabo.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9d9563 No.20448689

>>20448675

No that's forgetting. One can forgive while remembering.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448690

File: 573ded87aaf5e23⋯.png (1.54 MB,906x1454,453:727,I_Dream_of_Genocide.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cd3944 No.20448691

File: e1182a37a97921a⋯.png (693.55 KB,1120x630,16:9,A12C4151_1BF8_4CED_8467_49….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7b9427 No.20448692

File: c02418c03264b4a⋯.jpg (499.51 KB,2048x2048,1:1,Divine4.jpg)

>>20448684

Israel corrupted America numb nuts

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

24eefd No.20448693

>>20448517

If the reasons for filtering or filtering were made into a well-written formula, it might reduce the number of filterings.

I'm pretty sure you could state in red text that you were filtered or why, right?

Like this person was filtered for this reason.

Is that what should do instead of filtering?

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

Or simply scroll on by?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448694

>>20448684

All the merchants waxed rich from her.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448695

File: 934d8ce34e45fd6⋯.jpeg (26.81 KB,474x322,237:161,fauci_rats_of_nih.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448696

File: 2e5339397e25c7b⋯.png (303.39 KB,960x638,480:319,2e5339397e25c7be9560ecc99f….png)

>>20448595

>https://streamfare.com/foxnews

Thank you Fren!!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448697

File: abd19cce93246c9⋯.jpg (64.87 KB,680x676,170:169,1db.jpg)

File: c269bac138444b9⋯.jpg (80.57 KB,500x775,20:31,moke.jpg)

File: 96c9baef1038c1c⋯.png (1.16 MB,1083x1088,1083:1088,96c9baef1038c1c48f6e929db5….png)

File: a0cbabf79c47313⋯.png (682.88 KB,549x616,549:616,a0cbabf79c47313beab69b57fd….png)

>>20448650

crack

coc and crack

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6a0f00 No.20448698

>>20448330

you fuckhead….QR is public facing,anyone can post here

finish 3rd grade before posting here you ignoramus

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

385d14 No.20448699

File: 436f2b63af2caea⋯.png (Spoiler Image,239.87 KB,474x316,3:2,ClipboardImage.png)

calling a baldwin a faggot is a insult to french nazi xinu juw iphone invades

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448700

>>20448689

Same thing.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448701

can't tell you a 1000 years ago.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

31d6f5 No.20448702

>>20448532

Laura keeps interrupting him.

Did she take lessons from Hannity?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3bb96a No.20448703

File: fb2ec6b3c63b1ee⋯.png (2.44 MB,1024x1024,1:1,fb2ec6b3c63b1ee5e2e0a8152e….png)

>>20448689

Forgive the angry baker. He's only human. He doesn't get the point being conveyed. Maybe some day.

o7

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448704

File: 836dedcc5480ce3⋯.png (411.85 KB,696x662,348:331,836dedcc5480ce37ac7ae64dcd….png)

>>20448686

cops are muh neighbors moar good than bad

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

85d398 No.20448705

was just watching the Trump interview on ustvgo fox news and the blocked it. 403 forbidden.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448706

>>20448693

Sorry if that didn't come across well.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448707

Triangle what ¿????

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

152579 No.20448708

File: 54c37befedaf0f0⋯.png (389.93 KB,621x380,621:380,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

526863 No.20448709

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448710

File: 9a9706408592f0d⋯.jpg (173.66 KB,564x830,282:415,9a9706408592f0ded24f218406….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448711

>>20448676

they are fermented? for a long time

not cooked or baked forget

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0c538d No.20448712

File: c2fd4a7a1e562da⋯.png (944.96 KB,750x819,250:273,qpp3mkmbpew31.png)

Can a super nice anon post POTUS in SC on FOX here so all we haf to do is push the arrow? Please and TY!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6e6468 No.20448713

Laura Ingraham needs a bitch slapping if she keeps interrupting Trump..

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a7819 No.20448714

File: 888cfae7b537be4⋯.png (403.47 KB,557x755,557:755,fauciwar.png)

File: 63d7ad9442c2e99⋯.jpeg (287.87 KB,839x561,839:561,fau.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

861f29 No.20448715

>>20448362

Adorno is "Frankfurt" scholl

Tavistock

Study of Marxism.

Home of "Critical Theory"

https://en.wikipedia.org/wiki/Frankfurt_School

Adorno is said to have written all the songs of the Beatles

Social Engineering project by Marxist and neo-Marxists

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2604ae No.20448716

File: c2fd4a7a1e562da⋯.png (944.96 KB,750x819,250:273,qpp3mkmbpew31.png)

Can a super nice anon post POTUS in SC on FOX here so all we haf to do is push the arrow? Please and TY!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6a0f00 No.20448717

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448718

>>20448702

Very frustrating!!

Let him speak!!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448719

>>20448704

You live next door to a stash house?

That’s messed up.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

24eefd No.20448720

>>20448477

checked

>Who benefits with the death of Navalny?

The ©lowns

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448721

File: 323d5623122beb3⋯.png (352.24 KB,680x322,340:161,ClipboardImage.png)

File: fa643a66220e7c9⋯.png (358.61 KB,698x327,698:327,ClipboardImage.png)

See Maui is all Fixed. RIGHT?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f3a398 No.20448722

>>20448702

Laura interrupts everybody just like Hannity.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

526863 No.20448723

>>20448659

I thoroughly agree anon

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

215f76 No.20448724

YouTube embed. Click thumbnail to play.

Doug Sahm and Band Dealer's Blues

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

83894e No.20448725

>>20448595

thanks!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448726

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448727

File: 4215f49fbfcb868⋯.png (2.77 MB,1928x1266,964:633,faucicide.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448728

>>20448716

See here, fren anon posted it…

>>20448595

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448729

>>20448711

Landing a plane on ice will make your ass pucker so tight you don't have that problem

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448730

>>20448693

I've tried to think of a good way to solve some kind of anomalous deletion problem.

Well, but it's been going on for so long that I'm tired of it.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448732

>>20448704

well how ever good they are .

They still protect WAR CRIMINALS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

24eefd No.20448733

>>20448720

>The ©lowns

Oops

*NOT the ©lowns

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448734

File: 0833c896ce3ce65⋯.png (643.8 KB,663x561,13:11,ClipboardImage.png)

Reading from a Card

Get a vet up there

Vet's don't read cue cards

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d916aa No.20448735

File: fdaab9f3930ed93⋯.png (75.01 KB,663x376,663:376,ClipboardImage.png)

>>20448296

TY, baker.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5467b No.20448736

File: 3ba078f02a25a5f⋯.png (2.15 MB,1024x1024,1:1,ClipboardImage.png)

>>20448666

notable

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7b9427 No.20448737

File: 64e27ed7c2a3f1f⋯.jpg (238.24 KB,1018x678,509:339,TheLightOfTruth.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448738

File: 6360b087bed2f2b⋯.jpg (711.98 KB,1436x986,718:493,6360b087bed2f2ba87b00342ac….jpg)

>>20448696

covfefe later

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

9111ce No.20448739

>>20448505

Its truly bad out there in this regard. We seem to be at 'awakened saturation' point. I'm hoping we get an 'I told you so' moment in the near future to break the bottleneck.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

dca54c No.20448740

The United States is already done and finished. You dumfucking tards just don’t realize it yet and it’s ALL YOUR FAULT. USLESS CUNTS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

83894e No.20448741

>>20448595

>>20448595

local fox but at least the ingraham show should show up later tonight.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448742

File: f65654d74f44c6f⋯.png (1.28 MB,1500x936,125:78,never_fauci.png)

File: 679c3166b2cb67a⋯.png (2.46 MB,1110x1490,111:149,fire_fauci.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6e6468 No.20448743

>>20448702

I mean if she didn't have that nasally annoying voice it wouldn't be so bad but it's like a knife in anon's brain that takes the focus off anything Trump is saying.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

14c3ab No.20448744

File: fccd295fdb329c7⋯.jpg (101.23 KB,500x776,125:194,8ge2hb_1_1.jpg)

File: 7ab214abcb3af07⋯.gif (2.93 MB,638x360,319:180,1708292983618667.gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448745

File: fcc9b555067bbdd⋯.png (40.99 KB,657x525,219:175,ClipboardImage.png)

>>20448740

In an Information War

Comms are Vital for Victory

Comms & the Truth

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448746

>>20448740

Then you have to tell them exactly what you want them to do.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448747

File: 0693187cacda460⋯.png (887.7 KB,1214x683,1214:683,ClipboardImage.png)

File: 66b341092d1dde0⋯.png (808.07 KB,1214x683,1214:683,ClipboardImage.png)

File: 336093ea36b48ae⋯.png (1.03 MB,1214x683,1214:683,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

385d14 No.20448748

File: cea280eda5381a5⋯.png (13.07 MB,2000x2818,1000:1409,cea280eda5381a54d7f90dbf08….png)

divorced butt stuff available

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448749

File: 0dc6dfa485ecc8c⋯.jpeg (155.21 KB,1024x754,512:377,GGtq1PiXsAEgbnJ.jpeg)

File: 55eed51eae81f72⋯.png (64.17 KB,766x694,383:347,149_6_.png)

File: e32e1b415964a38⋯.png (19.05 KB,255x255,1:1,3d90e6ed8bf218fec096c5b593….png)

File: 264344ff958398a⋯.gif (629.99 KB,220x220,1:1,264344ff958398a328cb71d667….gif)

File: 3a0e87bfb28e545⋯.jpeg (85.13 KB,862x485,862:485,8b6732d8e63e806f31b484d27….jpeg)

>>20448732

blunt force

>>20448719

the court ball. noice bums.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448750

>>20448702

from Bannon the Bloviator

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a9b5 No.20448751

File: 3e673358575f5e5⋯.gif (2.34 MB,600x240,5:2,E4167DEB_8D10_4AC2_8AAB_9D….gif)

File: 682d79c4732491e⋯.gif (4.16 MB,600x313,600:313,221E7BD5_9C0F_4271_8325_AB….gif)

File: c633e7fc02adaea⋯.gif (3.84 MB,600x1067,600:1067,65FD602F_2DD0_471A_A72F_8A….gif)

File: 3de480739647109⋯.gif (1.11 MB,480x268,120:67,7FC0D95B_9DC0_4EF3_9B93_76….gif)

File: fa273ac3c805ff2⋯.gif (2.09 MB,600x600,1:1,4CBA9F70_4A42_4C6A_B9EC_96….gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

af132c No.20448752

they get away with all of it because it's a world wide pyramid scheme and they at the top are too big to fail. follow the money. they don't care. to fight the system is suicide [for you] while they live on eternal

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448753

Dis and Mis, a little difference!

Kek!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448754

>>20448617

>>20448641

The "deletion issue" has been a favorite of the shills and schizos trying to throw shade on the BO and BVs

halfmind, VD, last-fag-standing whine about deletion frequently

Behold:

General Research #23139 >>18851346

Not going to work anymore. The cycles are becoming clearer. Gore and cp to test the defenses, then cycle through tons of muh joo, then racist/white supremacy, then some slide like "RRN is legit" and then when the garbage gets tossed, scream "muh censorship"

Bitch about BO and BVs and the truly retarded among you bitch about bakers deleting stuff all you want, not going to work, not going to change anything.

The Fuckitol has taken effect. The continuous bombardment of all the playbook shit has finally done the same thing as the pussyhats screaming nazi, or racist. Overused to the point of uselessness. Game Over shill bois. You have induced "Fuckwad Fatigue" and become nothing but noise to be easily tuned out. Like a dog with fireworks, every now and then, flash and bang and Fido cowers. But this was Fourth of July Finale shit basically 24/7 for six years. You turned Fido into a Cavalry Horse, the shit simply no longer matters. It's "oh, this shit again" and every angle is known.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

b8a1b1 No.20448755

File: 1afbc25d0300382⋯.png (5.85 KB,236x48,59:12,report.png)

>20448731

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d231d9 No.20448756

File: 380fcbe2c38ae52⋯.jpg (90.34 KB,1024x595,1024:595,380fcbe2c38ae520d7b3af22e8….jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5eff94 No.20448757

>>20448339

>WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage

Excellent discourse.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

526863 No.20448758

>>20448555

None of the sanctions worked before, Bidan is just making Putin and Russia stronger

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448760

>>20448731

God help us

These people are sick evil

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448761

My sheriff is a good sheriff. bla bla bla.

Ya sure about that? Have you TESTED the theory lately?

I thought the same thing.

Do yourself a favor, TEST.

Remember See something say something.

well they seem to want to fuck the people REPORTING THINGS UP.

Yes tell us the GPS coordinates of your house Sir or Mam so we can send the 2K LB bom I mean Help..

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448762

>>20448745

If that COMMUNICATION is a honey trap…

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

386368 No.20448763

File: 8a606b2d95df3df⋯.png (454.13 KB,746x508,373:254,a131850dc90c0372fd6bb33e2f….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a06b32 No.20448764

File: 53370e5d91bc936⋯.png (157.53 KB,997x838,997:838,jesusvax.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448765

appears the image server has shit the bed

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448766

>>20448740

True, the old corporation is done!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

152579 No.20448767

why did all the images turn into Join or 404?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

408f5d No.20448768

Hannity in a dress!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448769

File: 6eef6f633f6a81f⋯.jpg (45.7 KB,747x512,747:512,sfps_wizard.JPG)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448770

>>20448765

Thank You Anon!

I thought that was just my end

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e3f7cc No.20448771

File: 99a21e33ddfa6c9⋯.png (532.17 KB,919x964,919:964,ClipboardImage.png)

>>20448340

turns out you actually CAN grow a pair

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

90d17f No.20448772

YouTube embed. Click thumbnail to play.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448773

President Trump you look marvelous

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448774

>>20448731

Gen. 6:2 that the sons of God saw that the daughters of men were beautiful; and they took wives for themselves, whomever they chose.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448775

Voting is DANGEROUS because there are SECRET INDIVIDUAL CODE MARKINGS ON YOUR BALLOT THAT MATCH YOU. WHO EVER CONTROLS THIS METADATA COULD FEED IT TO MOLFAR AND HAVE YOU ELIMINATED OFF PLANET EARTH.

THIS IS WHY TRANSPARENCY IS IMPORTANT

THIS IS WHY THE SECRETARY OF STATE OF CALIFORNIA IS THE MOST DANGEROUS PERSON IN THE UNITED STATES

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

1297bc No.20448776

>>20448765

well hell!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cefe2e No.20448777

https://rumble.com/v4el4p9-young-black-man-schools-old-black-man-on-how-to-do-for-self.html

https://rumble.com/embed/v4bzuv6/?pub=9ikqh

I can't get a rumble vid to embed to save my life….

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2b5725 No.20448778

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

8a7819 No.20448779

who offended the image server

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

189b16 No.20448780

>>20448355

but not a name fag

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

7f033a No.20448781

>>20448532

>https://streamfare.com/foxnews

I love Trump. He won't answer her stupid questions and give her the soundbites she wants

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a9b5 No.20448782

Rumble embed. Click thumbnail to play.

>>20448765

and right after i went ahead and converted a bunch of fresh gifs

fuck man

heres an embed then👍

the ride truly never ends

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448783

>>20448752

>>20448765

>>20448766

>>20448767

>>20448767

rewind the clock manually 2 days. certificate.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448784

File: d3e67f2f12fd8bb⋯.webp (94.95 KB,1024x1200,64:75,POTUS_FLAG_wrap.webp)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448785

File: dcde1ef68f75386⋯.jpg (12.73 KB,255x255,1:1,cb8a94144d1fcd657acefac930….jpg)

>>20448738

You're on Fren!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448786

File: ce562014f39c3ee⋯.png (833.22 KB,634x1052,317:526,ce562014f39c3ee84e2cf005cf….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6d54ad No.20448788

>>20448754

Respect for coming right out.(Respect for fast work)

Is this a problem that can be solved by changing the BO?

If so, who would you nominate?

You?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

189b16 No.20448789

File: 083fce982e7b9a8⋯.png (3.04 MB,1181x1122,1181:1122,083fce982e7b9a85604fbade76….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

32eca6 No.20448790

>>20448779

I am thinking that Hunter Biden photo did

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

189b16 No.20448791

>>20448786

would those kicks fit inside a scooter?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448792

>>20448775

Somebody might have had a bit too much LDS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448793

>>20448783

>certificate.

this post and the subject matter reflect the incompetence of the 8kun administration.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c804bb No.20448794

File: f2ae13fa045f98d⋯.jpg (84.02 KB,635x500,127:100,8gi9q8.jpg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

597e91 No.20448795

Image server Borked?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

501cc3 No.20448796

>>20448781

Her low IQ is showing, let her know.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

75e8da No.20448797

File: 8033a98e82000f4⋯.png (1.47 MB,900x740,45:37,8033a98e82000f4d65c12400d8….png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

99b597 No.20448798

File: 6e2354362824993⋯.png (1.29 MB,1920x897,640:299,ScreenshotNYT_FriOct18_191….png)

File: 67efafef2bb1091⋯.png (1.14 MB,1920x897,640:299,ScreenshotNYT_FriOct18_191….png)

>>20448583

Notice his numerous recorded speeches, both audio and film, are never, never translated or subtitled to English, or other languages for that matter, on the History Channel or other Western Programming, to hear first-hand what is being said.

Only ever snippets of those sentences that serve to propagandize and indoctrinate the audience are permitted.

It was always going to be 'Six Million'. New York Times Friday October 18, 1918 Page 12.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

a82bea No.20448799

>>20448782

👍🏻

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a9b5 No.20448800

YouTube embed. Click thumbnail to play.

>>20448782

ok then,,,… youtube perhaps for one that always works

kekkitty

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

dca54c No.20448801

>>20448754

Found the free speech hating communist censorship fag

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f25fa7 No.20448802

>>20448792

so you are the first of the Cyber Engagement Center VPN to get filtered it is then.

/filtered with predjuce

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d6b4c2 No.20448803

q research is a battle cry

do not go gently into that good night

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

526863 No.20448804

Rumble embed. Click thumbnail to play.

biggest fundraiser in SC for Trump, $6.5 million. Bannon: "Trump's Representing The American People, He's Putting You First"

Birdbrain will hang on forever.

7:31

https://rumble.com/embed/v4c303r/?pub=4

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448805

>>20448771

That’s incredible on moar than one level!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f64695 No.20448806

>>20448795

seems so

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

189b16 No.20448807

>>20448797

shit's gettin' real out there folks

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448808

File: 5b89c1077fd59d9⋯.png (1.08 MB,831x656,831:656,5b89c1077fd59d97eb63a1018f….png)

>>20448791

Can you see it?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448809

File: 3cfa7495b306821⋯.mp4 (1.45 MB,400x224,25:14,Let_me_see_your_war_face.mp4)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448810

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

c2ca2b No.20448811

Laura ingraham

adopted children

supports anti weed legislation

works for the man

overpaid shill

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448812

>>20448788

>Is this a problem that can be solved by changing the BO?

Didn't you try that same shit about three months ago?

Seems like a familiar stench

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

189b16 No.20448813

>>20448808

a special "mark" by Nguyen at the factory?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448814

>>20448808

is that your taint?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

215f76 No.20448815

File: 04195e39bdecf10⋯.gif (3.51 MB,360x200,9:5,_Anonymous_You_17_minutes_….gif)

File: 03d7ad83f8f29e6⋯.jpg (54.38 KB,296x146,148:73,_Anonymous_You_17_minutes_….jpg)

File: 15266ae677baa25⋯.gif (914.14 KB,500x332,125:83,_Anonymous_You_17_minutes_….gif)

.>>20448779

>who offended the image server

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

152579 No.20448816

File: b6684487f7503f6⋯.png (511.23 KB,604x1026,302:513,ClipboardImage.png)

https://twitter.com/rawsalerts/status/1760086751484219554

🚨#BREAKING: Confirmed Explosion at a shopping center lockdowns and evacuation in place

📌#Tustin | #California

Currently, numerous law enforcement officers, including the Bomb Squad, are on the scene. As Officials have confirmed that there was an explosion in the Tustin Legacy shopping center or near the Bank of America in Tustin, California. Evacuations and lockdowns are in place, and the FBI is involved as the loud boom could be heard from miles away. It is not immediately known if anyone was hurt this is still developing

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

21b84f No.20448817

YouTube embed. Click thumbnail to play.

Be groovy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a5a6 No.20448818

File: ffe1842f8f331cf⋯.jpeg (107.82 KB,700x700,1:1,IMG_0506.jpeg)

File: 33893541dce9eab⋯.png (3.09 MB,1469x918,1469:918,IMG_0488.png)

File: 5edfe17ac003303⋯.gif (3.2 MB,498x498,1:1,IMG_0481.gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6fe189 No.20448819

File: d7f0767809aafe8⋯.jpeg (284.59 KB,1080x1350,4:5,nightp.jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

32eca6 No.20448820

hunter biden photo that was dropped fucked shit up my guess. Do not see people talking about on pol as stated and appeard to be choke fucking natalie at least that was what I think was implied.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448821

File: 8f1ba85ecf0e2a2⋯.png (1.2 MB,1282x663,1282:663,ClipboardImage.png)

File: 2bd5db418900cc5⋯.png (1.37 MB,1371x762,457:254,ClipboardImage.png)

Will show the face and Name of a man that is suspected of killing a child

Won't show the face of the men that fired into a crowd at a parade

So weird

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

cdca73 No.20448822

The two youts

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f88cf8 No.20448823

File: ffe451237d9557d⋯.jpg (11.35 KB,173x255,173:255,e5baf10b949b743e08e47efa44….jpg)

File: 7f9d195d159c672⋯.png (766.93 KB,960x1114,480:557,7f9d195d159c6728cf991666ef….png)

File: 339205490f646ec⋯.jpg (651.85 KB,1677x1118,3:2,_1x_1.jpg)

File: 603f98c01b963d2⋯.jpg (16.37 KB,194x255,194:255,0abe4380dc53ab55b3482cd0e6….jpg)

File: 2abd34889330a72⋯.jpeg (14.31 KB,255x176,255:176,6dce5b2cbe924a3743d77185f….jpeg)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

45a9b5 No.20448824

Rumble embed. Click thumbnail to play.

>>20448782

>>20448800

which is better rumble or youtube for embeds

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

f60158 No.20448825

File: debbb16fa559242⋯.png (3.01 MB,1398x1194,233:199,ClipboardImage.png)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5467b No.20448826

File: f0bf3e961312556⋯.png (688.06 KB,882x1024,441:512,ClipboardImage.png)

Dammit Jim

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6e6468 No.20448827

Potusonkillimageserver.jpg

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0fed43 No.20448828

>>20448813

>>20448814

You two are very special.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3afed9 No.20448829

>>20448801

it's the last phase of the QR larp

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

68b06f No.20448830

File: 64f166c27d13ef7⋯.png (509.01 KB,937x696,937:696,Q_mister_rogers.png)

Laura askin' some good Q's

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e45293 No.20448831

File: 9869971a54211ee⋯.png (195.39 KB,388x262,194:131,ClipboardImage.png)

Fuck that guy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

6578df No.20448832

>>20448826

INDEED!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

5a9a9e No.20448833

POTUS quotes the 8th amendment

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

17020f No.20448834

TRUMP JUST READ THE 8TH AMENDMENT!!

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d6b4c2 No.20448835

was that you Hunter Biden? fucking and filming your niece? who films, daddy Biden?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

2ef6f6 No.20448836

>>20448703

>He doesn't get the point being conveyed

Condescending guilt trip shill. I see beyond your comprehension.

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e0114c No.20448837

File: e44adc67d9ec6a7⋯.gif (1.22 MB,434x434,1:1,20231213_220457.gif)

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e9b6c6 No.20448838

>>20448834

>>20448833

We're going all the way to SCOTUS

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

e45293 No.20448839

>>20448835

>who films

this^^^

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

3958d2 No.20448840

>>20448802

Being filtered by you would make me ever so happy

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

0c538d No.20448841

>>20448835

dr jill?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

d5467b No.20448842

https://usnewson.com/watch/fox-news-live

https://usnewson.com/watch/fox-news-live