5b1da0 No.19971981 [Last50 Posts]
Welcome to Q Research General
We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.
"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."
VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH
Q's Latest Posts
>>18284019 Nov. - Dec. 2022
Q's Private Board
>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6
Find Q drops here
Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku
Q Posts Archives
* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u
* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app
* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news
* Q Raw Text Dumps: q-clock.com/q_raw.txt
* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/
* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188
* Q Research Notables: Archive Board >>>/qnotables/
* Q Adjacent infographs and moar: https://deepstatemappingproject.com/
Q Research Board
Key Resources below; ck Dough Resource thread for more: >>17225239
New to QR?
>>17240320, >>17238117 Intro, Board Info, Offsite Bunkers, Optics
>>17238430 Suggested Follow | >>17240363 Information Tools & Services
Threads
>>17253611 Dedicated resource threads
>>17242392 Q Encyclopedia by ArchiveAnon | >>17242386 Q Video Archive by ArchiveAnon
Join Us
>>17322518 E-BAKE instructions | >>17322509 LEARN TO BAKE
>>17240554 Meme Requests | LEARN MEME WARFARE https://archive.is/2iZX1
TOR Access
TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html
TOR Banner: https://www.youtube.com/watch?v=MLCupx1UExg
____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19971982
International Q Research Threads
>>19822242 ——–——– Australia #33
>>19911841 ——–——– Canada #49
>>16694358 ——–——– France #7
>>18551332 ——–——– Germany #105
>>19930440 ——–——– Japan #20
>>16694250 ——–——– Nederland #10
>>17784579 ——–——– QAJF #1
>>17352350 ——–——– Scotland #8
>>19636057 ——–——– South Africa #12
>>19804572 ——–——– UK #51
GLOBALS
Bunker = https://endchan.org/qrbunker/
Posting guidelines - report cp, gore, violent threats, no naked children
>>19089056 Ban lifts, video downloads, Q clock, Joe M's videos, Qagg Download
>>18024378, >>18561054 Updated PROTO Instructions
>>19957031 What's eligible for removal on QR NEW
>>19075778, >>19075920, >>19574181, >>19853166 Posting on children & teens - what's not ok
>>19832150, >>19957123, >>19737197 SPAM Removal
>>19892843, >>19892919, >>19893052 Jim W's response to mass deletions of off-topic posts
BAKERS
>>19089065 Baking Tools & Guidelines - NEW BAKERS, PLEASE READ
>>17322509, >>17322518 How to bake/e-bake
>>17835052 Formatting Q posts
No discrimination on the basis of race or religion in notes, they will be removed
Sign out clearly even when e-baking or ghosting, use RED TEXT
NOTABLES ARE NOT ENDORSEMENTS
#24518 >>19971162
>>19971668, >>19971673, >>19971741, >>19971743 ALBUQUERQUE, NM — Chaos has erupted at Coronado Mall at reports of an active shooter
>>19971329, >>19971501, >>19971728, >>19971451, >>19971865 Ireland has been Europe's guinea pig since they joined the EU
>>19971212 Right-wing MAGA politics caused Conservatives to turn backs on Ukraine, Trudeau claims
>>19971402, >>19971786, >>19971813 STILL suffering from TDS?
>>19971543 THERE'S A HAMAS COMMAND CENTER UNDER THE IRS BUILDING!
>>19971427 Until now, Americans didn't realize that the federal agents provoking the J6 riot were uniformed police
>>19971603, >>19971689 New Twitter Poll: Of the three groups, who is the greatest threat to Europe?
>>19971655 Police are riot gear as a citywide Tactical Alert has been declared for a large groups of Pro-Palestine protesters
>>19971704 PF: HAMPSHIRE AVIATION LLP out of France
>>19971720 U.S. Senator Ron Johnson CALLS OUT Shadow Government. LIVE on FOX!
>>19971731 A college Degree is now the fastest way to unemployment line - GWP
>>19971769 Nevada Judge Rejects Efforts to Place Pro-Abortion Constitutional Amendment on 2024 Ballot
>>19971779 The hospital IDF still raided, after confirming Hamas HQ miles away...
>>19971789 A federal judge in Georgia has ordered a trial for the case against Dominion voting machines.
>>19971799 Tucker is killin' it. Half a billion views on this interview alone.
>>19971817 16-YEAR OLD PALESTINIAN GIRL WHO TRIED TO STAB SOLDIER RELEASED
>>19971892 PENTAGON OFFICIAL FROM GEORGIA ARRESTED IN UNDERCOVER HUMAN TRAFFICKING STING
>>19971917 lb President Javier Milei confirms he will shut down the Central Bank in Argentina SOURCE NEEDED
>>19971960 #24518
#24517 >>19970285
>>19970328, >>19970453, >>19970637 Conor McGregor UNLOADS on Nasty Irish Lib Journalist Who Smears Opponents of Mass Migration
>>19970602 Irish Patriots Burn Hotel Housing Illegals After Mass Stabbing Attack on Irish Kids
>>19970353, >>19970430 Who is doing the looting? The Irish or the (male, fighting age) Migrants?
>>19970542 Israeli troops open fire at Palestinian civilians despite ceasefire -- AP
>>19970525 Hamas frees 24 hostages in exchange for 39 Palestinian prisoners as part of cease-fire swap
>>19970633 Pres. Trump RT's Nov 3 Israel Op op-ed
>>19970656 Netanyahu Says UN Isn’t Doing Enough for Palestinians in Gaza
>>19970697 FOUR ATTACKS TARGETED U.S. FORCES IN IRAQ, SYRIA WITHIN HOURS
>>19970731 "Israeli Air Force (reserve) Col. Nof Erez has described Israel's actions on 7 October as a "mass Hannibal" event
>>19970380 The Sea Organization of Scientologists have signed a billion-year pledge of service to Scientology
>>19970388 @FBIPittsburgh Hurricane Man Pleads Guilty to Bank Fraud
>>19970395 Driver taken into custody after smashing car into New York subway station entrance
>>19970413 Kim Jong Un celebrates North Korea's 'new era of space power' with his daughter and scientists after successfully launching spy satellite
>>19970416, >>19971112 RE: Q* algorithm search 'Q-learning'
>>19970419 Manila 'sleepwalking 'into Washington's plans poses a threat to regional peace and stability: China Daily editorial
>>19970436 Agency drops Susan Sarandon for saying Jews ‘getting taste’ of what Muslims go through
>>19970438 Musk on Twit-X posts
>>19970457 ADL's leader has curious praise for Elon Musk
>>19970448 Californians To Pay Billions To Cover Costs Of New $25 Minimum Health-Care Wage Law
>>19970537 Revolver: A federal judge, appointed by Obama, just ruled against voting machines in Georgia
>>19970583 National File Restores Patrick Howley’s Classic “Obama and Hillary Created ISIS” Scoop After Breitbart Pulled It Down
>>19970597 DeSantis Super PAC in Shambles
>>19970616 Terry Richardson sued by second model claiming he forced her into sex, used photo for ‘art’
>>19970626, >>19970630 Moderna Engaged in Covert Operations to Control Online Criticism of Vaccines
>>19970634 European Bonds Shaken As Germany Suspends "Debt Brake" To Allow Increased Borrowing
>>19970673 President Javier Milei confirms he will shut down the Central Bank in Argentina
>>19970676 Pentagon Wants AI Weapons to Make Killing Decisions
>>19970503 WHO Recommends Masks, Social Distancing In China Amid "Mystery Pneumonia Outbreak"
>>19970711 How covid advanced One World Gov't plan
>>19970738 Pfizer sues Poland for breach of contract over Covid-19 vaccines, demands $1.5 billion
>>19971009 New documents reveal Moderna is spying on you
>>19970811 'Calculated, predatory, manipulative' Aussie politician is jailed for 20 years for sexually abusing four boys aged between 10 and 15
>>19970846 More Fake Fed Nazis Show Up in Wisconsin
>>19970860 Dark Money Fund Poured Millions Into Unhinged Climate Activist Groups That Vandalize Priceless Art and Block Highways
>>19970873 Asian Brothels That Serviced Military Officials and Politicians Kept “Impeccable Records” as Feds Prepare to Identify “Johns”
>>19970896 Anon doomsday schedule
>>19971036 73 attacks on U.S. mil in the middle easts since Oct 7th
>>19971062 The United States Air Force have prohibited military personnel from attending a patriot rally organized by Turning Point Action, labeling the group as “pro-Trump” and “alt-right.”
>>19971144 #24517
#24516 >>19969368
>>19969567 Part III: Hezbollah’s Clandestine Terror Wing in America: the Michigan Mystery
>>19969416, >>19969426 United States v. United States of America
>>19969762 @gatewaypunditThe Errors, The Lie, and The Cover-Up in Georgia’s 2020 Election
>>19969776 After China's Xi visit to San Francisco, business owners are complaining that the city is reverting into a den for homelessness and drug use.
>>19969796 UnitedHealthcare accused of using AI that denies critical medical care coverage
>>19969800 Declining response rates to official surveys raise the possibility that government and central bank officials have been making decisions based on flawed data.
>>19969845 High-energy 'sun goddess' particle opens possibilities for new physics, exciting scientists
>>19969853 it matters not the HUMAN BEING'S NAME who tells LIES about another HUMAN.
>>19969906 China's youngest space station crew send home spectacular views from space (video)
>>19969914 Time Travel, Portals & the Montauk Project - Interview with Stewart Swerdlow
>>19969924 Argentina's Milei says shutting central bank 'non-negotiable'
>>19969956 Is US on the Verge of 'Catastrophic' UFO Leak? What We Know
>>19969960 Algerian migrant stabs Irish children. Irish newspapers the next day:
>>19970030 Judge Threatens to Jail Cops for Civil Asset Forfeiture Games
>>19970036 Joe Rogan grills UFO whistleblower David Grusch on alien entities as ex-intel officer says ‘variety interacting with us’
>>19970081 New retirement extensions allow the Army to retain critical talent
>>19970093 RepAdamSchiff twats
>>19970105 planeFag: Europe-RAF IN at Rzsesow/Eastern Med: Italians Spanish left Tel Aviv and two Egyptian locations
>>19970122 Data from Fermi Gamma-ray Space Telescope reveal gamma radiation pulses from Sagittarius A*
>>19970149 China Launches Fifth Military Force – ‘Near-Space Command’
>>19970166 China conducts launch to test satellite internet capabilities
>>19970218, >>19970225 Space Force Reports 2 Suicides This Year, Marking the First in the Service's Short History
>>19970258 Global tyrannical government isn’t a distant, future threat. It’s a clear and present danger
>>19970270 Concentration Camps, Watchtowers going up in Ireland?
>>19970273 #24516
Previously Collected
>>19969505 #24515
>>19966673 #24512, >>19967537 #24513, >>19968425 #24514
>>19964350 #24509, >>19965040 #24510, >>19965941 #24511
>>19961629 #24506, >>19962608 #24507, >>19963450 #24508
>>19959036 #24503, >>19959903 #24504, >>19960685 #24505
Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com
Q Research Notables Archive Board >>>/qnotables/
Q Research Notables #20: Not Giving Up >>19567242
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19971984
DOUGH
https://fullchan.net/?bfdb08c5d069cc7f#3b9SGT8cJss6v7SdcQWzFS3n24wFaWbaZGWRJnAzszXe
>seeking handoff
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19971985
>>19971984
>>seeking handoff
back in 20 if offer is made
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3a2c8 No.19971986
Rumble embed. Click thumbnail to play.
>>19971984
tyb
vvelcome to the end of the vvorld
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
801321 No.19971987
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19971988
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19971989
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
98f574 No.19971990
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
52a691 No.19971991
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
567207 No.19971992
>>19971983
Shit the bred Fred!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0e594 No.19971993
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19971994
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cc6557 No.19971995
"Protesters on Nantucket cheer, jeer Bidens after hostage address "
https://www.bostonherald.com/2023/11/24/protesters-on-nantucket-cheer-jeer-bidens-before-early-dinner-out
someone yelled out 'free Palestine' and that's a 'protestor'
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19971997
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c514e8 No.19971998
>>19971984
bless this bread
in Jesus name
amen
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19971999
https://twitter.com/thejimwatkins/status/1728170563196395656
James Watkins
@thejimwatkins
Wouldn't you like to be a pepper too.
Image
Quote
Kai On Your Side🌺
@PupScouts1
·
3h
Replying to @BloggsSir @thejimwatkins and 3 others
Q sent me…. Just saying…
10:55 AM · Nov 24, 2023
·
773
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
52a691 No.19972000
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972001
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972002
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972003
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
50f8ca No.19972004
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972005
Al-Quds Brigades destroy 11 Zionist Military Vehicles
https://en.althawranews.net/2023/11/al-quds-brigades-destroy-11-zionist-military-vehicles/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
567207 No.19972006
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7960f1 No.19972007
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972008
https://www.bizpacreview.com/2023/11/24/texas-officials-warn-of-winter-rolling-blackouts-unreliable-energy-sources-population-boom-all-factors-1414884/
Texas officials warn of winter rolling
blackouts; unreliable energy sources,
population boom, all factors
BizPac Review, by Vivek Saxena
Posted By: Imright, 11/24/2023 7:57:08 PM
The organization that operates Texas’ electric grid has warned of potential forced power outages this year if temperatures drop to below freezing like they did last year. According to The Dallas Morning News, “when Texas’ power demand outstrips available supply,” the organization — the Electric Reliability Council of Texas (ERCOT) — “is forced to shut off power to some customers to maintain the stability of the grid.” The Morning News reported on Thursday that ERCOT has predicted there’s a 14.4 percent chance that these controlled outages — known as rolling blackouts — will be required this year if temperatures drop to the levels seen last year.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
50f8ca No.19972009
https://www.stripes.com/theaters/us/2023-11-24/dodea-administrator-leave-human-trafficking-sting-12150198.html
Senior DODEA administrator takes leave after arrest in human trafficking sting
The Department of Defense Education Activity administrator arrested recently for allegedly soliciting a prostitute during a human trafficking sting in Georgia has been freed on bond and is on leave from the agency.
Stephen Hovanic, 64, of Sharpsburg, Ga., was among 26 people arrested during a two-day operation by the Coweta County Sheriff’s Office, according to a social media post Tuesday by neighboring Haralson County Sheriff’s Office, which provided support for the operation.
The chief of staff for Defense Department schools in the United States was released from custody Nov. 16 on a $2,675 bond, according to a release report provided by Coweta County.
Hovanic is on leave from the agency, DODEA spokesman Will Griffin wrote in an emailed statement Wednesday. He did not specify the type of leave or whether it is paid or unpaid.
“We are aware of an alleged incident involving a DoDEA employee in the Americas Region,” Griffin wrote. “As there are ongoing legal processes, it would be inappropriate to comment further at this time.”
Griffin referred further questions to the Coweta County Sheriff’s Office. A spokeswoman there referred questions to the department’s open records clerk, Missy Gravitt, who supplied the incident, booking and release reports but declined to provide more information.
The sting was initiated Nov. 15 by members of the Coweta County Sheriff’s Office, according to the post on X, formerly known as Twitter. Coweta is approximately 25 miles southwest of Atlanta.
Hovanic was arrested on a pandering charge at 4:29 p.m. on the sting’s first day, the incident report said. He was taken into custody at a SpingHill Suites by Marriott in Newman, which is approximately 12 miles west of the DODEA-Americas headquarters in Peachtree City.
Hovanic is accused of soliciting sex from an undercover officer in a hotel room where the sheriff’s office had set up the sting, Fox 5 Atlanta reported Wednesday. The report said he told officers he thought he was purchasing a massage, not sex.
Hovanic was booked the next day and released at 5:37 p.m.
Of the 26 arrests, 12 were for prostitution, 10 for pandering and four for pimping, the X post said. Six trafficked victims were rescued and three of the arrested individuals are under investigation for human trafficking and drug charges.
Pandering is the legal term for paying or attempting to pay for sex. It — along with pimping — is a misdemeanor under Georgia law.
Hovanic, an honorably discharged veteran who attended the U.S. Military Academy at West Point, has worked for Department of Defense Education Activity for nearly three decades, the past 13 years as chief of staff for the Americas region, according to the activity’s website.
He joined DODEA in 1996 as an assistant principal at Quantico Middle-High School after working for 14 years in the Virginia public school system. He also served as principle of Dahlgren Unit School, according to his DODEA biography.
In 2008, Hovanic moved to Peachtree City as an instructional systems specialist and was named chief of staff two years later, the biography states.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972010
>>19972008
>Posted By: Imright
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972011
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972012
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc889f No.19972013
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7040f No.19972015
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
452ff2 No.19972016
>>19971986
CACOCCCGAA TATOU GCGCGAGAA TGGGAACTATTG ACTOGATGCGTAT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7960f1 No.19972017
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0d5a2c No.19972018
THE HIGH FLYING BONDAGE RAPIST
Gets fueled up on cocaine and whiskey and goes nuts.
https://www.news.com.au/world/north-america/george-soros-righthand-man-accused-of-bdsm-crimes-in-his-sex-dungeon/news-story/d91a67e6c1c123b781772ac20d43e251
https://nypost.com/2019/09/26/howard-rubin-sued-again-by-another-alleged-sex-abuse-victim/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3aacd No.19972019
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972020
https://redstate.com/nick-arama/2023/11/24/questions-raised-after-biden-staggers-into-press-conference-n2166775
Video of Biden Appearing to Stagger Into
Press Conference Has People Talking
Red State, by Nick Arama
Posted By: Imright, 11/24/2023 6:55:40 PM
It's been an interesting day for Joe Biden. As we've reported, he's in Nantucket for his Thanksgiving vacation, staying at a billionaire's estate. On Thursday, people were raising questions about a picture of the Biden family taking a polar plunge on Wednesday. Many wondered if Joe had taken the plunge, especially since the picture showed him in sneakers with perfectly coiffed hair. A Democratic strategist also spread a pic of Biden in the water, but that picture was several years old.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
52a691 No.19972021
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
98f574 No.19972022
Why doesn't IDF / Mossad just constantly barrage the airwaves with:
Hamas is winning. We are losing. We are doing everything we can to win, and they keep beating us back.
It would really make a provocative psyop.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972023
https://twitter.com/IvankaTrump/status/1728184350339223992
Ivanka Trump
@IvankaTrump
Spending Thanksgiving with you @lexfridman
was as epic as that scene from The Godfather ! ♥️🦃🥰
Visit again soon ! 🌊☀️🌴
Quote
Lex Fridman
@lexfridman
·
6h
I'm grateful to have spent Thanksgiving with @IvankaTrump, @JaredKushner, and family. Especially epic was us watching Godfather. Greatest film of all time ❤ Leave the gun take the cannoli 🤣
11:50 AM · Nov 24, 2023
·
212.6K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bbade No.19972024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972025
>how old are you?
hm, that depends, is time a thing for you?
>hmmmm
I am precisely 6,000 years old. to the day.
vs.
>how old are you
time works different. how can you say you are this old when I - now - talked to you a year ago? the time thing you got wrong, but I tell you that, I would never lie to you.
sometimes verführen is a thing, I do that all the time. how are you? white US (no foam on the beer though, seriously? :) ) does not even answer.
someone bought a new car? why not cheer him up for that, I liked that often in the past. love+love= more love.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972026
>>19972005
Wow super weird shit
SOOOOooooo
Realrawnews.com has a sister site in Yemen ?
>https://en.althawranews.net
Is real raw scrambled
Is it a franchise?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972027
>>19972018
he's got one black eye here, maybe freemasonic
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1df74a No.19972029
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
942224 No.19972030
>>19971984
tyb
note full article below about central bank closure plus context.
just talk at the moment.
Careful anons, reuters is a globalist entity and they desparatel want another distraction. Meliei smells funny to anon
Wilder of Netherlands seems ok.
lets wait and see before anything is decided.
Actions speak louder than words.
o7
---
ARGENTINA NEW PRESIDENT MELEI - THIS HEADLINE IS FROM A X POST AND HE HAS NOT PICKED HIS CABINET YET!!!
Note: Right now, this is just a pledge, similar to his quote recently about taking back the Falkland's. Maybe he is making the right noises to stay relevant to the news before he is forgotten. Wait and see, probably know in a months time once he has his cabinet in place.
==========
Argentina's Milei says shutting central bank 'non-negotiable'
Reuters
November 24, 20232:25 PM GMTUpdated 11 hours ago
https://www.reuters.com/world/americas/argentinas-milei-says-shutting-central-bank-non-negotiable-2023-11-24/
--
BUENOS AIRES, Nov 24 (Reuters) - Argentina's President-elect Javier Milei said on Friday that the closure of the country's central bank, a signature campaign pledge, was a "non-negotiable matter", according to a statement from his office posted on social media platform X.
The comments, in response to what he called "false rumors", come as the outsider libertarian economist races to put together his team ahead of taking office on Dec. 10, with some signs that he is picking a more moderate Cabinet that expected.
Argentina's social security administration ANSES, a key institution given Milei's pledge to slash state spending and subsidies, will be lead by economist Osvaldo Giordano from the key central Cordoba region, the statement added.
That marks a shift from a previous plan that Milei would appoint a close ally to lead the administration.
Horacio Marin, a private energy sector executive, was also confirmed as the incoming chief of state oil company YPF.
Milei faces major hurdles to implement his more radical reform plans, which include dollarizing the economy, shutting the central bank and privatizing state companies like YPF, which will take time if they can be done at all.
His libertarian coalition has a limited number of seats in Congress and no provincial governors. Milei also has to juggle demands from the more mainstream conservative bloc, whose public backing was key to him winning the run-off election last week.
Reporting by Gabriel Araujo and Adam Jourdan
Our Standards: The Thomson Reuters Trust Principles.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
567207 No.19972031
>>19971993
I remember you. God bless you fren anon.
Shadilay!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7960f1 No.19972032
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972034
>>19972023
https://twitter.com/elonmusk/status/1726542015087927487?
Elon Musk
@elonmusk
youtube.com
The Godfather I (1972)- Baptism Scene, Michael Kills all the heads of…
The baptism scene of The Godfather I.Follow me on instagram: https://Instagram.com/the.godfatherFollow me on Facebook: https://Facebook.com/thegodfatherig
11:04 PM · Nov 19, 2023
·
10.1M
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972035
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
36daf9 No.19972036
>>19971388
Dumping as many ideas bad ideas as anon can as quickly as possible. Sorry about that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
50f8ca No.19972037
>>19972018
https://en.wikipedia.org/wiki/Beaky_Buzzard
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972038
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
98f574 No.19972039
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3cac28 No.19972040
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972042
>>19972024
not necessarily.
the cars at the Israeli rave that was supposedly shot up by Israeli Apaches looked staged
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9594 No.19972044
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686a59 No.19972045
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
36daf9 No.19972046
>>19972023
Smart dude. Wonder if he'd ever have a reason to block someone? Seems like he's all about discussing ideas.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
50f8ca No.19972048
>>19972014
>There's an Anon command center under the glownigger echo chamber
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0d46a2 No.19972049
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6ad197 No.19972050
>>19971984
Thank you baker!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
52a691 No.19972052
I noticed last bread that two ID's shared the same formatting and writing style. Only capitalized their "I's" too. Talked back and forth. Praise exchanged. One of those ID's was accused of being a certain shithead. A bread or two before that, the CP linker posted his 1 post and a few numbers after that a one poster posted the SP Gollum variant. Duper's Delight? Is the mimic also the CP linker? Is the CP linker now mimicking? Let's wait and see.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
632218 No.19972053
>>19972048
>>19972034
>>19972046
>>19972047
sirs
is this more so a hangout now than a q-tard convention?
asking for a friend
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972054
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972056
>>19972025
one truth?
cross?
the tiniest thing that might be or shift into any sort of inconvenience, might be a cross for me and for me alone.
whatever it is, something sweet to eat or a thing considering moral or the basic architecture of life.
if you are looking for one truth and a cross, it might be bc when making this one son happy, worlds will be most awesome and a lot can be learned, throughout time and about connecting times.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9594 No.19972057
BERLINUR LOLI PRON HAD STUNT NIGGGAHY$ AN JUW ASSHOLE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e40bb1 No.19972058
if this post were made in the current year
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972059
>>19972050
a sick person did this video
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972061
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972063
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972066
>>19972023
1st Thanksgiving with her mom.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972067
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
307815 No.19972068
Isn't today FF Friday?
Any FF's today???
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972069
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
782c78 No.19972070
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
36daf9 No.19972071
>>19972051
That's not very nice.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a0f0f8 No.19972073
https://www.brunswickgroup.com/media/11259/geopolitical_eightelections2024_091523_final.pdf
Eight Key Elections
to Watch in 2024
In 2024, countries making up over 50% of global
GDP will undergo decisive elections. The results will
both reflect and impact an increasingly precarious
geopolitical and economic environment. The votes
take place against a backdrop of heightened bloc
rivalry, driven by competition between China and
the West, Russia's invasion of Ukraine and increased
posturing by non-aligned countries.
These have accelerated trends like “derisking” and
“friendshoring” while complicating international
cooperation on global issues like climate change and
pandemic management. This lack of geopolitical
coordination on international economic policy cushioning
has also heightened the risk of any prospective shock
to the precarious economic environment, especially in
Global South countries with preexisting fiscal pressures.
We have highlighted for you below eight key elections to
watch, the current state of play in these races, and the
key factors to monitor in the run-up to the votes. The
outcome of Taiwan's vote at the start of the year could
set the tone for cross-strait and US-China relations for
the following year, amplifying the role of China in the US'
own November election. Elections in the EU and UK will
meanwhile influence how Europe positions itself
relative to this great-power competition, while also
providing indications on the longevity of support to
Ukraine. If Russia's elections offer limited indication of
the government's popularity, a low turnout could add
pressure on the Kremlin and its stalling invasion of
Ukraine. The US elections are likely to impact global
economics, politics and geopolitics.
Brunswick is available to support you through these
elections, working with our offices on the ground all
over the world to help you manage possible operational,
reputational or regulatory risks emanating from the
results. Further information is available at the end
of the document.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
567207 No.19972074
>>19972054
It appears to be Ivanka telling [AnOn] activity of some kind. Reason is that everyone knows anons will instantly research anyone they mention.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
98f574 No.19972075
https://twitter.com/TheInsiderPaper/status/1728168545727426613
WATCH - Biden: “I cannot prove what I’m about to say,” but Hamas attacked Israel because I was working very closely with Saudis and others to bring peace to the region by having recognition of Israel
From Tom Elliott
4:47 PM · Nov 24, 2023
·194.7K Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972076
>>19972005
>>19972026
>>19972042
>>19972024
https://www.bitchute.com/video/I0Np2BrhtnoG/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972077
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972078
https://www.bizpacreview.com/2023/11/24/nancy-pelosi-dealt-another-blow-when-longtime-ally-announces-retirement-1414917/
Nancy Pelosi dealt another blow when longtime
ally announces retirement
BizPac Review, by Tom Tillison
Posted By: ladydawgfan, 11/24/2023 5:54:37 PM
In what is being perceived as another blow to Nancy Pelosi’s power hold, a close ally of the former speaker has announced plans to retire from politics. U.S. Rep. Anna Eshoo (D-CA), who represents Silicon Valley, will not seek reelection at the end of her term. At the age of 80, Eschoo is yet another octogenarian who has, in her case, been entrenched in Washington for 30 years. “As the first woman and the first Democrat to ever represent our district, I’m very proud of the body of bipartisan work I’ve been able to achieve on your behalf in Congress,” Eshoo said in a video she shared online.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bacb6 No.19972079
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d43cb7 No.19972081
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972082
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972083
https://www.wired.com/story/hemisphere-das-white-house-surveillance-trillions-us-call-records/
Security
Nov 20, 2023 1:25 PM
Secretive White House Surveillance Program Gives Cops Access to Trillions of US Phone Records
A WIRED analysis of leaked police documents verifies that a secretive government program is allowing federal, state, and local law enforcement to access phone records of Americans who are not suspected of a crime.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3aacd No.19972085
Q quit posting because he ran out of jokes
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972086
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972087
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972088
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972089
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eda71f No.19972090
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c717d8 No.19972091
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972093
https://www.thegatewaypundit.com/2023/11/proud-boy-zachary-rehl-continues-endure-inhumane-treatment/
“Well I believe one of the reasons Hamas
struck when they did because they knew
that I was working very closely with the
Saudis and others in the region
Gateway Pundit, by Staff
Posted By: ladydawgfan, 11/24/2023 4:03:44 PM
The Gateway Pundit has reported on numerous examples of the inhumane treatment J6 political prisoners have faced. Prisoners, like Infowars reporter and War Room host Owen Shroyer, are spending extended periods in solitary confinement, often without explanation. John Strand was sentenced to 32 months in prison and despite the Bureau of Prison’s own scoring system, he was sent to prison and placed in isolation. J6 political prisoner Barry Ramey, who was stabbed in the face for watching Tucker Carlson, shared the malnutrition they face, the mail discarded over political views, medical care being denied, and more. The prisons also continue to use COVID
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7bacb6 No.19972094
>>19972082
Ray Epps is that you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972095
>>19972080
>faggot.
>FILTERED.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972096
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972097
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972098
YouTube embed. Click thumbnail to play.
>>19972089
>promotes free speech
denies freedom of choice
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b08836 No.19972099
>>19972075
Sounds like relative who believes in the life saving jab and inflation is eating too much turkey
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
931628 No.19972100
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972101
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bbade No.19972102
>>19972085
Not possibru.
The jokes write themselves and never end.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972103
>>19972076
>https://www.bitchute.com/video/I0Np2BrhtnoG/
footage looked pretty accurate to me (mil background)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
307815 No.19972104
>>19972050
Sorry, I could never do this to people.
This is Evil thinking, and is part of the sickness in the world.
Just document the thefts and get them arrested by presenting the evidence to the police.
There was absolutely no reason to harm or potentially kill people.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e40bb1 No.19972105
>>19972064
there was a question asked
in it, pope and roths mentioned
the pope was clearly answered as being the chair (a puppet since you're too stupid to understand that part) and an obvious question as to who the master is when there's only one logical answer left, being rothschild
and jacob rothschild is the current head of the family
that is why you're a faggot
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23c8ee No.19972106
>>19972089
Free Speech doesn't mean someone has to subject themselves to your useless posts
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972108
https://t.me/Teoanon17/26710
Rumors about Pizza-Gate, Conversations about 🍕 Gate, and then we have Follywood, who comes outta left field with this shit… Truth is they told us all along.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972109
>>19972097
Black sea looky like Australia
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40fec1 No.19972110
>>19972034
>>19972023
so you have ivanka, lex fridman and jared kushner including Elon musk.
They are trying so hard to attract the anons attention to Q.
And a mention of Godfather 1
not GodFarther 3, which is the correct version Q quoted.
Elon is such a attention seeking faggot,
Good Grief.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6ad197 No.19972112
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972113
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4b46d0 No.19972114
>>19972096
Trump is growing he's becoming more powerful everyday.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972115
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972118
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d59674 No.19972119
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972121
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
52a691 No.19972122
YouTube embed. Click thumbnail to play.
Moar writing required. Breads have been snail paced today anyway.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972123
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972124
>>19972109
base for the nose.
bei vs. von. (advanced knowledge, 6000 years, obv. nice!)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972125
https://rumble.com/v3xmd3p-11.24.23-trump-massive-comms-tucker-unloads-elon-godfather-things-are-movin.html
11.24.23: Trump massive comms, Tucker unloads, Elon + Godfather?, Things are Moving! Pray!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b08836 No.19972126
>>19972009
Leave of absence office party was off the hook. All those humans in mid traffic - big pimpin resolution.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972127
YouTube embed. Click thumbnail to play.
the world from above
JonLevi
https://youtu.be/TfSXAMP3A8M?si=cCZ8wOp7s1vhUifJ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972128
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972129
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972130
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
881be0 No.19972131
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bdef93 No.19972132
"into every
sphere" -picrel guest
Decree On the Means of Social Communication, Inter Mirifica
Author: Second Vatican Council
DECREE ON THE MEANS OF SOCIAL COMMUNICATIONS
INTER MIRIFICA
SOLEMNLY PROMULGATED BY
HIS HOLINESS POPE PAUL VI
ON DECEMBER 4, 1963
INTRODUCTION
1. Among the wonderful technological discoveries which men of talent, especially in the present era, have made with God's help, the Church welcomes and promotes with special interest those which have a most direct relation to men's minds and which have uncovered new avenues of communicating most readily news, views and teachings of every sort. The most important of these inventions are those media which, such as the press, movies, radio, television and the like, can, of their very nature, reach and influence, not only individuals, but the very masses and the whole of human society, and thus can rightly be called the media of social communication.
2. The Church recognizes that these media, if properly utilized, can be of great service to mankind, since they greatly contribute to men's entertainment and instruction as well as to the spread and support of the Kingdom of God. The Church recognizes, too, that men can employ these media contrary to the plan of the Creator and to their own loss. Indeed, the Church experiences maternal grief at the harm all too often done to society by their evil use. Hence, this sacred Synod, attentive to the watchful concern manifested by the Supreme Pontiffs and Bishops in a matter of such great importance, judges it to be its duty to treat of the principal questions linked with the media of social communication. It trusts, moreover, that the teaching and regulations it thus sets forth will serve to promote, not only the eternal welfare of Christians, but also the progress of all mankind.
https://www.ewtn.com/catholicism/library/decree-on-the-means-of-social-communication-1514
dude is ecumenical in all speech. thanks, no thanks.
btw, you can't quote from any english translation. must be in canonical Latin.
they punk asses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972133
>>19972120
well the collective IQ of the place is definitely lower than it was in November 2017-November 2018
but that's our collective fault for letting cretins take over
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972134
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972135
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972137
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972138
https://t.me/KanekoaTheGreat/7720
[ Album ]
.@JoeRogan and @ComicDaveSmith, listening to your latest pod, and you missed @elonmusk's posts right below where he explicitly stated that he was addressing the ADL and any other group promoting anti-white, anti-Asian, or any form of racism.
https://twitter.com/KanekoaTheGreat/status/1728147117565444113
@KanekoaTheGreat
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
255bdc No.19972140
>>19972133
Next time you should vote instead of bitching all the time. Every vote counts and that is what is going to fix all our problems.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972142
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a63074 No.19972143
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0e594 No.19972145
YouTube embed. Click thumbnail to play.
>>19972031
What a wonderful thing to say.
Thx for picking up my spirits fren.
God bless.
Shadilay!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972147
https://t.me/RealSKeshel/9461
Will be focusing quite a bit of energy in the coming week on Nevada judicial corruption. I posted a video this week about Robert Beadles' case in Nevada against Washoe County, and the stunning disregard shown by the judge (Russell).
For more on Russell - read here -
https://thenevadaglobe.com/fr/opinion-big-questions-surround-judge-russells-small-foundation/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972148
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c717d8 No.19972149
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bdef93 No.19972150
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972151
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972152
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0d732 No.19972154
>>19972133
Sometimes the message must be gaited by the abilities of the audience. Since Pizza is back in the MSM, might be time to repoint the normies to those archives.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972155
https://redstate.com/jeffc/2023/11/24/bbc-bars-employees-from-antisemitism-awareness-march-after-letting-them-attend-pride-marches-n2166764
BBC Bars Employees From Antisemitism Awareness
March After Letting Them Attend Pride Marches
Red State, by Jeff Charles
Posted By: Dreadnought, 11/24/2023 2:48:30 PM
The Israel-Hamas war has brought with it increasing displays of antisemitism in the Western world. In response, many individuals and organizations opposing anti-Jewish bigotry have stood up to combat those who inflame hatred against the Jewish people. Unfortunately, the British Broadcasting Corporation (BBC) is not one of those entities. The BBC is prohibiting Jewish employees from participating in an antisemitism awareness march, citing concerns about impartiality and bias. The BBC is facing criticism from some Jewish staff who feel they have been banned from attending a march against antisemitism.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a3a2c8 No.19972156
>>19972016
AACOACG ACAGAACGCAGGATTAATTTGGAG ATA GGCUGAAAGCAGC. GATOAGGGAAGAT ATGOAGCACCCTATAC. CACOCCTGAG TATOU GCACGAGAA TGGGAACTTTTA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972157
>>19972140
pointing out facts is not bitching.
voting is required for the Republic's survival, after that it's the Constitution.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972159
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1566c6 No.19972160
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23c8ee No.19972161
>>19972144
>Expand your thinking
Expand your copypasta folder
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972162
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972164
>>19972154
true
Pizzagate confirmed by lawyer debunker being picked up for child porn.
you are right
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e40bb1 No.19972165
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972166
YouTube embed. Click thumbnail to play.
>>19972155
The New Rules of Horror (2011)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972167
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
255bdc No.19972168
>>19972157
As a gay, black, journalist I have come to the conclusion my vote doesn't count.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972169
>>19972158
HAVE A MEME ANGRY INCH……..
CALL IT AN EARLY CHRISTMAS PRESENT JUST FOR YOU.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aec970 No.19972170
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972171
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4d9a2 No.19972172
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1566c6 No.19972173
>>19972150
Q said Obongo plugged him in the booty.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3cac28 No.19972175
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972176
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972177
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41c1e8 No.19972180
>>19972141
> Q TELLS YOU BASICALLY THAT SATAN DOES NOT EXIST
Q never said that. Q asked if Satan exists and if the thought of Satan exists. The thought of Satan doesn't mean Satan is imaginary, but the THOUGHT of satan, as in invasive thoughts.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972181
https://www.breakingreports.org/archives/711942
LGBTQ Activist Learns Prison Sentence In Child Porn Case
By
Joseph Ellis -
November 24, 2023
Former College Park mayor and LGBTQ activist, Patrick Wojahn, has been sentenced to 30 years in prison after pleading guilty to 140 charges related to child pornography.
The conviction followed the discovery of illicit images linked to his government email.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b96b3d No.19972182
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0d732 No.19972183
>>19972157
Ben Franklin well understood the entrenched corruption of a government and it's courtiers. Why do you think he warned us that a republic is great if we can keep it. A republic only works in a nation or moral citizens. Old Ben was a debauched scum who drank, whored and cut people up with the worst of them. He also got the French to give us money. John Adams was too much of a prig to make that happen.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972184
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972185
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972186
I'm here for you.
Jesus loves you, filterfag
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3742b No.19972187
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972188
https://twitter.com/WallStreetApes/status/1728072195526816022
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
30f49f No.19972189
https://m.youtube.com/watch?v=26lWfya0xSI where the heck are all the elite researchers here ..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0891dc No.19972190
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6c3a2e No.19972191
Notable
New terms to quash stereotypes while still calling out
the combative subgroups.
While we coined the phrase "not anti-X but pattern
matching, so we can called out organized fanatical
combatives logically; this phrase does not go far
enough and should be used after we have defined the
subgroups distinctively. Whether it is anti- :: (Semitic,
Black, Muslim, LGBT, and other terms such as
Homophobia, Misogyny, and other isolate terms), there
is no pre-term to describe such subgroups with clarity;
although we do have terms like: (ultra, intra, radical,
etc…) they still leave these subgroups vaguely defined.
We need a term to describe:
a. that they are a subset and not a stereotype
b. that they converge around a mindset
c. that they have and use an excuse for their actions
d. that they will take actions that go beyond boundries
e. that they are will to destroy in order to accomplish
their agenda.
As I tried numerous combinations, I kept coming back
to "gang of" to describe their sub-grouping and
"organized" as in organization, whether explicit or
implicit, based upon "fanatical" principles.Thus the
post-term:
goofies
gang of organized fanatical indignant extremist
saboteurs
and the pre-term to describe an individual
goofi
gangster of organized fanatical indignants.
Examples:
Their is a faction of Migrant-goofies
He is acting like a goofi-progressive
This way we are neither prejudice, discrimminatory,
biased, nor stereotyping but calling out dangerous
subgroups that even the MSM cannot argue by our
definition. Pattern matching at this point is not only fair
and justified but undeniable.
Feel free to critique and make suggestions to better
exemplify a-e.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
931628 No.19972192
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23c8ee No.19972195
>>19972177
Finds the only Free-Speech site on the Internet
Posts repetitive useless spam
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972196
>>19971999 @thejimwatkins Wouldn't you like to be a pepper too.
lol wut
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972197
YouTube embed. Click thumbnail to play.
>>19972183
~1775: BENJAMIN-FRANKLIN-SOLD-US-OUT: SHORT-STORY: Russell-Jay: Gould.
https://youtu.be/UCDpxU_696E?si=5KU-VQkukDxXbG5I
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972198
>>19972184
>>19972177
Filtered for saying filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972199
https://www.wsmv.com/2023/11/22/tbi-10-men-charged-after-2-day-undercover-human-trafficking-investigation/
TBI: 10 men charged after 2-day undercover human trafficking investigation
As part of their operation, decoy advertisements were placed on websites known to be linked to prostitution and commercial sex.
The Tennessee Bureau of Investigation
The Tennessee Bureau of Investigation(TBI)
By Carmyn Gutierrez
Published: Nov. 21, 2023 at 2:02 PM GMT-11
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972201
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972202
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6096d2 No.19972203
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e2975b No.19972204
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2db357 No.19972205
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972206
https://t.me/robinmg/32337
Study Reveals More than Half of COVID-19 Vaccinated Feel Sick a Year Later - Naveen Athrapully
"Over half of COVID-19 vaccine recipients in a recent study were found to be suffering from some form of health complications one year after taking the shots.
The study, published at ScienceDirect on Nov. 10, examined potential post-COVID-19 vaccination syndrome (PCVS) among vaccinated individuals and assessed their quality of life (QoL). The study was conducted among adults aged 18 and above from India who had received either Bharat Biotech’s COVAXIN or the AstraZeneca COVID-19 vaccines.
Among vaccine recipients, 52.8 percent of individuals were found to have at least 1 PCVS a month after primary vaccination. At 12 months, 64.6 percent reported at least 1 PCVS. Though the quality of life rose at six months following vaccination, it subsequently fell at 12 months."
https://www.theepochtimes.com/health/study-reveals-more-than-half-of-covid-19-vaccinated-feel-sick-a-year-later-5531689
t.me/robinmg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972207
>>19972189
>where the heck are all the elite researchers here ..
We're here
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e0d732 No.19972208
>>19972150
O'Bummer likes his trannies clean shaven.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972209
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972210
>>19972196
Filtered for eating raw peppers
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972211
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
29a813 No.19972213
>>19972189
personally not really interested in MH70 by Anonymous, but that's just me
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23c8ee No.19972214
>>19972211
I'm not crying. I actually find you slightly amusing in a sad kind of way
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
655157 No.19972215
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cac4c No.19972216
https://x.com/elonmusk/status/1728228308331249673?s=20
>Guys I found Q*
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972217
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a63074 No.19972218
YouTube embed. Click thumbnail to play.
>>19972143
https://youtu.be/o2BymE3cFEU
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972220
FORTE10
USAF RQ-4 Global Hawk 10-2045
https://globe.adsbexchange.com/?icao=ae5420
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972221
>>19972018
Isn't Newsom into that S&M also?
Thought that's why Kimberly Guilfoyle left him, because of his sex dungeon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
71f255 No.19972223
>>19972202
MAGA Patriots are fully armed and ready for deployment.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972224
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972225
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eee226 No.19972226
>>19972006
10 % off For FE members or
Members of squarepupils.com
Deep State Castration tools 🔥🥵
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972227
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972228
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972229
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972231
>>19972209
Filtered for being a pathetic famefaggot
>>19972219
Filtered for speaking the obvious truth about the echo chamber shill protected by echo chamber shill BVs
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0891dc No.19972232
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aec970 No.19972233
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b9ce50 No.19972234
BO this was notable lb, and formatted better, then it wasn't. If you do not like the term then help create one that satisfies a thru e. What I write saves lives when understood and acted upon. I had this problem with the hockey player that killed Johnson #15 where my notable wasn't recognized. It wasn't unit; another anon did research and found out I was right that it was a pattern. In addition, there were Military comms at the time that when decoded shows I was right about it also being a threat to the new SOH Johnson and not only myself. With the chaos in Ireland, Palestine, and Israel there is already and will be more carnage due to "identity problems" where the innocent will suffer due to the actions of the guilty. My post and definitions go a long way to reducing the violence in our midst. There are comms for camps in Ireland, carnage in Palestine, and 9 armies will come against Israel if we do not do something about "identity". Please make it notable or discuss changes that have to be made, it is about saving lives.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972235
YouTube embed. Click thumbnail to play.
: CRITICAL-TIMELINE-CLOSURE BY THE >>19972197
POSTMASTER-GENERAL: Russell-Jay: Gould.
https://youtu.be/C8BrcnCwbiU?si=LsUGgdAKj5EDu-Gn
Premieres Nov 28, 2023
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972237
https://twitter.com/DonaldJTrumpJr/status/1727721764623397227
Donald Trump Jr.
@DonaldJTrumpJr
Evergreen Tweet
Quote
Donald J. Trump
@realDonaldTrump
·
Nov 27, 2013
Happy Thanksgiving to all–even the haters and losers!
5:12 AM · Nov 23, 2023
·
1.1M
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972239
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972240
>>19972227
Filtered for leftist quality memes
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8b1c6 No.19972241
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972242
YouTube embed. Click thumbnail to play.
Brace Yourself For What's Coming in 2024 - Victor Davis Hanson
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
655157 No.19972243
>>19972223
Why do you behave like what a liberal soi boy thinks a Redneck Gun Owner sounds like.
Oh maybe I just answered my own question…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b9ce50 No.19972244
>>19972191
I do not know why the link didn't come through.
Revised:
BO this was notable lb, and formatted better, then it wasn't. If you do not like the term then help create one that satisfies a thru e. What I write saves lives when understood and acted upon. I had this problem with the hockey player that killed Johnson #15 where my notable wasn't recognized. It wasn't unit; another anon did research and found out I was right that it was a pattern. In addition, there were Military comms at the time that when decoded shows I was right about it also being a threat to the new SOH Johnson and not only myself. With the chaos in Ireland, Palestine, and Israel there is already and will be more carnage due to "identity problems" where the innocent will suffer due to the actions of the guilty. My post and definitions go a long way to reducing the violence in our midst. There are comms for camps in Ireland, carnage in Palestine, and 9 armies will come against Israel if we do not do something about "identity". Please make it notable or discuss changes that have to be made, it is about saving lives
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972245
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23c8ee No.19972246
>>19972228
You are bad at this. Dad jokes next?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972248
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972250
>>19972221
Interdasting that Kimberly is wearing butterflies.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972252
>>19972242
this is a week old. he rehashes all the things done to Trump in the past and barely touches on what to brace yourself for. whatever he seems like a good guy imo.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
15479a No.19972253
>>19972087
¿Got a higher resolution version?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
655157 No.19972255
>>19972236
Nothing new under the sun.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972256
>>19972246
daddy loves you
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972257
>>19972244
The Board Owner has nothing to do with this.
I, baker, thought it was interesting but then you kept posting it over and over again talking to yourself
A common theme among shills.
This changed my opinion on your presentation.
Thus, it was un-notabled
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972258
https://t.me/WeTheMedia/94573
🚨The EU could be facing another departure from the bloc, as the new President of the Netherlands is eyeing plans to leave the bloc.
https://www.gbnews.com/politics/geert-wilders-eu-brexit-netherlands
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
848f35 No.19972259
>>19972250
Can't trust her.
Dunno what Jr's game is with her.
But… GAIV NEWSOME had his dick in that.
F no, thank you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972260
>>19972237
Evergreen comms from Don jr
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
881be0 No.19972261
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d70c06 No.19972262
YouTube embed. Click thumbnail to play.
Daughtry - Artificial
No blood in the veins
Built to feel without the pain
Circuits for the brain
Wide awake
A vision of perfection, all lies
A deadly resurrection disguised
Just another lethal injection to mankind
Welcome to your worst nightmare
Days are gettin' dark, you should be scared
It doesn't have a heart
Plug into the new you
Don't resist 'cause it's no use, it's no use
It's digital warfare
The death of who we are is right here
It's never gonna stop
Plug into your new soul
Ice cold, mechanical
Artificial
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cac4c No.19972263
>>19972259
She is older than Melania
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
930252 No.19972265
>>19971984
Bread title is mega-keck, baker!!! Made my day!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972266
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972268
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
604478 No.19972270
>>19972013
Fun fact: ask any railfag. Trains/Trucks and derails are not a rare occurrence. It happens more than you know.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972271
https://t.me/chiefnerd/8293
Jim Breuer Roasts the Victims of Trump Derangement Syndrome 🤣🤣
https://x.com/thechiefnerd/status/1728119313700192665
@ChiefNerd
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972272
>>19972265
>Bread title is mega-keck
Can't take credit.
Anon found it in the wild.
>>19972267
>so yer having fun and are entertained?
no, do a flip
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6ad197 No.19972273
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972274
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972275
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
71f255 No.19972276
>>19972243
Cobert is that you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972277
>>19972257
Filtered for being a comped baker glownigger
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972278
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972279
YouTube embed. Click thumbnail to play.
>>19972275
Are you sharing my screen, Mr. Pig?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
255bdc No.19972280
>>19972216
Makes sense. I always thought it was this.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972282
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
255bdc No.19972283
>>19972277
Will you filter me?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972284
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972285
>>19972272
Filtered for posting the gayest faggot memes on the internet and should slit your wrists and neck yourself for posting doge memes
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23c8ee No.19972286
>>19972256
It's even funnier that you don't realize what just happened
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972287
https://arizonasuntimes.com/news/group-releases-analysis-of-pinal-countys-2022-election-finds-deliberate-malfeasance-concludes-election-should-not-have-been-certified/
Group Releases Analysis of Pinal County’s 2022 Election, Finds ‘Deliberate Malfeasance,’ Concludes Election Should Not Have Been Certified
November 23, 2023 Rachel Alexander
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972288
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972289
>>19972222
Checked and kek'd
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4cac4c No.19972290
https://x.com/BNONews/status/1728232022852894898?s=20
>BREAKING: Former police officer Derek Chauvin, convicted of killing George Floyd, seriously injured in knife attack in prison - AP
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972291
>>19972282
not bad, the direction of the shadows is just a little off. maybe 40-50 degrees or so.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
930252 No.19972293
>>19972265
>>19972272
>>19972267
Then it's a good find, baker! Innderdasting times we are finding ourselves in, so at least it's not boring. Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972294
>>19972283
Filtered for asking stupid obvious questions
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972295
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972296
>>19972284
Anon would make a meme but don't want that disgusting 🤢 on muh device
Packet your bags loser.png
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aec970 No.19972298
>>19972287 Group Releases Analysis of Pinal County’s 2022 Election, Finds ‘Deliberate Malfeasance
notable
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972299
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972300
>>19972293
Filtered for licking baker ass
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972301
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972302
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
71f255 No.19972303
I've been doing some forensics analysis and those Washington DC folks really are perverted pedophiles… From the top down.
Valerie Jarrett had Bathhouse Barry's chain way before he became president.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972304
>>19972301
Filtered for one word post
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972305
>>19972294
#MeToo. Will u filter me?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972307
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972308
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e40bb1 No.19972309
>>19972273
>farm and eat humans
well that's one way to plant the seed
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972310
>>19972305
Filtered because asked for it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972311
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68ce8d No.19972313
>>19972290
I'm just gonna say it
Innocent man gets stabbed in prison while severing sentence for a crime he didn't commit, because the overlords don't like his skin color
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a862c9 No.19972314
>>19972304
Filtered for announcing filtering.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972315
>>19972282
The pedo bunch goes to Nantucket
There once was a pedo from Nantucket
Whose cp collection was so large…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972316
YouTube embed. Click thumbnail to play.
200 Fabricated Years
JonLevi
https://youtu.be/9wnh_qM6ZVI?si=3yLf98TFirjvOGgK
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
40fec1 No.19972318
YouTube embed. Click thumbnail to play.
INTERESTING SECTION ON THE LOTUS EATERS, GROK, ELON MUSKS NEW A.I PLUS ITS CONNECTIONS THE U.N AND THE W.E.F, AND YET, NO ONE MENTIONS THE B.I.S, WORLD BANK AND THE I.M.F ON THE PUSH FOR AUTOMATION AND SUPPLY SIDE REFORM!!!
Note: This is a all encompassing build back better, great reset and the fourth industrial revolution powered, monitored and controlled by A.I project, think internet of things, bodies and social credit. Klaus has stated that to bring this into reality, first a thing must be destroyed, than deconstructed and finally reconstructed they way they want it to perform.
p.s anon is working on a new project to explain what supply side reforms will be as they will be replacing interest rates which were once controlled by Libor but are now controlled by the B.I.S and implemented by the central banks.
=============
===========
ALL HAIL GROK (elon A.I)
First published at 20:46 UTC on November 24th, 2023.
https://youtu.be/DhGiAX1Zglg
https://www.bitchute.com/video/DhGiAX1Zglg/
p.s bitchute link is not working on 8kun so youtube also provided.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972319
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972320
>>19972306
Filtered for using red and bold text
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972321
>>19972288
dub dubs chkt
[They're] absolutely repugnant
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41c1e8 No.19972325
They're always 33.
https://nypost.com/2023/11/22/entertainment/melissa-barrera-speaks-out-after-scream-vii-firing/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
255bdc No.19972326
>>19972294
Check your filter settings. It's not working. Be a woman of your word.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972327
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972329
>>19972314
Filtered for saying filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972330
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972331
>>19972097
>>19972025
>>19972056
>>19972058
Roger that, dad?
>"Wein auf" - Bier - das rat ich dir.
beer. monks. bread. crumbs. David. Daniel. white. planes. autists. Luke.
if there is bread letting you know the wine is bad you give info on new wine. (Mark 2 22)
>"Bier auf Wein" - das lass sein.
never good to mix things, even when architects talk, or rather communicate (those that
build worlds by talk and share building plans are not needing bad shit, only super symbolic
talk in babylon bee.
the mixng that you think to be doing is bulk date bc of comms as well as sharing the
architectursal (not irl) concept of having stuff connected and disconnected again. not for
actual irl folks to do.
another thing, also not to be done, but as a comforting explanation to understand those
capable folks who want to help.
imagine you having a painting in your appartment. when you walk by in the morning, you have
a thought, a feel (bread and wine, thoughts can be winy as well though), when being there
again in the afternoon, you maybe pick up on that thought or feel (unknowingly).
this is you being connected through time and, depending on if you were to carefully check
the appartment from a holyday loction what you might have taken a pic of and put it in your
appartment, in realms. was there this kind of tree?
many such things, not exactly a burden, may change. that is a blue sort of wushie thing.
you did do homework back in school, but what exactly it was on what day is not only hard to
say, but not relevant to anything in your life, in most cases.
<3 is the base, always.
do not be confused by my sylbolism or the sometimes shy way of talk. when those whose talk is time(ing) learn to adjust, it´s awesome. tropfsteinhöhle.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972332
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972333
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aec970 No.19972334
>>19972312
>QRESEARCH ADMIN DO NOT WANT ANONS TO READ THE ARTICLE CONCERNING THE ISRAEL SITUATION THAT POTUS RETRUTHED YESTERDAY?
>>19970633 Pres. Trump RT's Nov 3 Israel Op op-ed
notabled two breads ago
now it's spam.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972335
>>19972325
Never heard of her
So there's that
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2cf8f1 No.19972336
>>19972326
Double filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972339
>>19972329
filtered for filtering those who say filtered
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972340
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972341
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972343
>>19972148
But muh [RR] memes.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972344
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972346
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
255bdc No.19972347
>>19972336
You will never beat filterfag. That man knew how to filter. I think him and Daniel were in cahoots.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e40bb1 No.19972348
>>19972331
my dude
take your meds
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972349
>>19972287
>Concludes Election Should Not Have Been
All I want for Christmas is a DECERTIFIED 2020 ELECTION
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972350
>>19972331
yeah, the thing with the eyes.
dunno yet bc fo that convenient thing with body and time. but have at this point
experienced enough to explain, sorry for those folks asking me 20 years ago with white
shirt ;)
so some gather info not with eyes and ears, but more like being the living water in a room,
feeling where the walls and things are or if they move.
it seems doe to being connected to many of those, my vision slightly alters, shifting more
to non eye view.
do not blind paul though, symbolism, now you get it, now you all get it, bc I got it.
why? dunno. that I know, blue knew, ages ago. did now know why though. there white/black is
more skilled.
>holy
>flash
>vision
that stuff is called linking, psalms, bite out of the apple to think different, dsicern-
what initself is pleasing to the Lords.
ausgezeichnet. sharp.
pump up? "so defined"?
so = white worship.
de fine d? dwight is nice and might be of help tp those wanting to wal all sorts of ways.
that is how it´s done, carefully choosing words? nah, making every letter holy and have
hinterstübchen do that stuff.
can you understand that the holy and sacret knowledge being handed over for tens of
thousands of years I just wrote as a post?
do those folks know I work throughout time?
<3
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e9a66d No.19972351
>>19972328
What if…
that ONE SHILL isn't actually a shill…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d1b59e No.19972352
YouTube embed. Click thumbnail to play.
Anons, this is a phenomenal video put together by Bill Cooper about the Federal Reserve and the theft of the United States of America by globalist bankers. More about Bill Cooper at the end. In the last portion of the video, he also makes some remarks and ties the whole thing to the JFK assassination (more below)
Video Sauce:
https://youtu.be/kOp6TPDZxxs?si=Yx9TO0Vwv8v38Y6q
Points of interest in the video:
15:24
When the Federal Reserve was formed (1913/1914), what it was (private corporation), who authorized it (congress), and what the stipulations were for the Federal Reserve (exempt from audits, does not have to pay income tax), how it was formed (the Federal Reserve Act).
Then he goes into 3 ways they steal.
(1) being that the US Treasury requests 'money' from the federal Reserve. The Federal Reserve pays the printing costs for that money to the US Treasury (no profit). The Treasury then prints X Federal Reserve Notes and gives an equivalent in X Treasury Bonds to the Federal Reserve as collateral. The Federal Reserve profits from the difference they paid vs loaned, AND the interest of the bonds, as well as the interest of the loan.
19:54
(2)
Interest can't be paid back because it was never created, it never existed. Which means more notes need to be created, which means more interest can never be repaid, which means the debt can never be repaid. Flooding of Notes creates inflation. In order to prevent hyper inflation Notes need to be removed from circulation. They do this through the IRS which is also a private corporation that collects these 'taxes' for the Federal Reserve.
31:15
(3)
Fractional-reserve lending
Loan out 10x more than in reserve. This isn't real money, just FIAT. Loaned out as credit against the Fed Bank. Have them deposit that all back into the same bank and now they have 10x the original on that balance sheet, and can lend out 10x on the 10x.
36:44
First national bankers were actually Knights Templar they were rounded up in France only and arrested by king phillip
(Nov 22 1307 pope clement issued papal bull condemning knights templar to torture)
JFK was in the process of creating an interest free US Note, and may have been why he was assassinated. The entire Assassination was a free Mason ritual done on the Nov 22 (11/22 [33]) as revenge for 1307. Dealey Plaza is an outdoor free Mason temple. JFKs wounds were the same as those suffered by Hiram Abiff (head, heart, neck).
41:22
Bill says, multiple times, the only solution is to nationalize the Federal Reserve, arrest those responsible. No more IRS. Create anninterwst free US note backed by the fsith and credit of the United States until our gold supply is rebuilt. He says every nation will thank us for taking us out from under the yoke of these secret societies and only then will our economy improve and we be able to eliminate the debt by fraud/theft decree, and begin again.
42:42
The US' gold was all sold at a discount during Nixon administration. Only insiders were told. Sold at $32 an ounce on the world gold market when the price was well over $100 an ounce. Americans never had a chance to buy it.
Bill Cooper was in the Air Force, then joined the Navy. He eventually found himself working on a submarine as a part of the Office of Naval Intelligence. When he was getting his security clearance, there was not a box for Demolay on the application, so he checked Free Mason. He believes this is why he was given the access he was. He was talking about UFOs and documents he had seen, until the government threatened him. Then he recanted and remained silent. He said, until he saw that they appeared to be implementing a contingency plan, he had read about, years later in a magazine. Then he started disseminating his info, and stated his own investigations. Bill Cooper's story is a very interesting one, and you can find his videos and such scattered on YouTube, and Rumble. I believe there's an archive of his Hour Of The Time radio broadcasts too. I believe he has a few books our too. Behold a Pale Horse was a good one because he used all FOIA and public documents in the book to show that information can be found. He also has a video out there that walks through all of the symbolism of the JFK assassination at Dealey Plaza.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aec970 No.19972355
>>19972345
ever hear of the little boy who cried wolf?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972356
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cafe23 No.19972359
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23650a No.19972360
>>19972237
Bossman calling hillary a loser even back then kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972361
https://twitter.com/elonmusk/status/1728232986624348653
Post
See new posts
Conversation
Elon Musk
@elonmusk
·
33m
Guys I found Q*
Image
Elon Musk
@elonmusk
Grok will do both
3:03 PM · Nov 24, 2023
·
184.1K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972362
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972363
>>19972350
blue angels, as others, work with time.
in relation to me alone it is the way.
it is a shakra, trust, joy, the connected feeling of you having nice food at work always.
relatable.
can do time bubbles, can sort of pull thinks (think to think or thing to room), can be
overridden by other angels, colors, forces, horses.
does not need charge, but helps you trust and such, despite working with reality itself,
which is not much visible if not want to be seen, but aims at you all doing fine. (struggle
to say well, bc that is not a must have. a cross? nah, not if educated.)
one truth?
what cross?
yeah, there will be stones on the way to be turned, if nicely connected it has niceer
effects.
angels stuff.
also, angels are angels and not deceased people. do not worry, almighty.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41c1e8 No.19972364
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
255bdc No.19972365
>>19972351
I can't leave this place no matter how hard I try. Now I just shill and shitpost. Gold ends the Fed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972366
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972367
>>19972363
and yes, for the millionst time I do forgive you. bc I invented the heaven not to torture
anyone, but bc a fake starting point made me "care", there is new and better care, love. it
moves. architecturally defined. irl more easy if adjusted. I alter the 99% around you. seen
a "wave" yet? all new. God.
love+love=more love.
Adonay. bridal veil, needed for Schroedinger´s cat and twists. Twists? HI. GG. S.
A.men is rather advanced. one would say futuristic.
6g.
(Jes.) 11.
Rumbling, schieben, flimmern, alles normal. Godspeed.
Simpsons fan? "Ausgezeichnet", angels mostly speek german too.
I do love GoLd and working bulls.
I AM. the way. you will find me, and I will give some crumbs before that. future options
(me spawning or having an animal talk to you to say hi. mountain stuff prolly, my picks
though.) will be unlocked later, bc I am. in the meantime, figure out how to treat everyone
well in case God´s symbolism might have been confusing.
No sacrifice, ever. I sit on my couch.
quanaq.
A.men?
AdAm & EvE? mAgA? China? Edgar costume? Wifes?
EvA engaged? Evelyn reports to God. CODE > command. Live at=34.
He.brew BeeR.
"Wein auf" - Bier - das rat ich dir.
"Bier auf Wein" - das lass sein.
Bread is to be spread, by fish, provides for nicest of wine, eternal.
if you know burger and wanna try steak you do not order burger.
Water into wine by marriage.
No miracles in hometown though.
J ES US from Gallilee? Nah. Flags out.
2216. "this means twelve btw." bank. who knew? marker.
6g.
The stormiest of crumbs? Nah. GOD. The one creator.
God? Nah, you GoLd go do that stuff, take care of that one son and it will be fine.
Cross? One Truth? Yeah, stones to be turned on the way, lurk and - so cody - act.
Love as base, always.
it´s all actually nice, fake starting point.
how great is that darkness, this time the scroll won´t be sealed, let "bad" be "bad".
please, approach me next year or the year after that. after I have organized bread to be
broken in church and lodge as well as spec ops in lodges. please, do not ever do military
help shit, this im my sort of Godly view, might lock bad stuff.
ritual is misunderstood, what you do is know about stuff happening, to not be afraid and
have that done in feels comms to others. "oh, Godspeed again army bro, nice one. now chill
day again? yup, dad´s gonna chill."
also it´s bulk data collection, spreading to other "times" or realms. angels are rather
capable at gathering and spreding info. when some of them talk, they actually define
reality, that migth be a disadvantage of basements, a white car driving by can obviously be
manipulated, but cars and birds and stuff might appear godly bc it is.
communiacte stuff, maybe in babylon bee, not irl, that is why I gave you info, so arcitects
can talk without rather big symbolism, no point in you doing that.
mason hush sign is a thing. and there is only one God, who is an actual person and for now
limited to his body.
relax. no worries. all time. 34.
washing is something for the future, needs to be ensured there is no left stuff in the
maschine. could be rather easy, I might at some point as 50 knights who work as handyman
(did you know having such a guy in the neighborhood is something very blue, bc giving trust
and being relatable?) (could worlds be better off if, achieved in whatever way, the way
itself does affect too, some random person (myabe the one giving the idea for the name
LuisA (Litt) Newbuilder to a person I by now like very much) relates to a certain handymen
in his neighborhood better? would it be ok to replace a roof worker with another guy for
the sake of the greater good? who is to decide? there is no math that could do it. angels
work in options, seeing all kind of ways, doing angels stuff, preferable with my tools and
not using my indeed rather big power, there migth be offering in the future after well
planned and understood, and after having not only observed but also altered options,
swapping a wave of water onto you or crodw. all new.
so a handy man could also, e.g. on how simple and not comprhandele things are, take up the
cross of having one week of from work, giving he uses spread stuff to seak at work, while
eating leberwurst brot for a whole week, bc of bood or bc of LW? the fuck is going on?
chill, bc I guess I would want to eat Leberwurst again and bc it´s the most common spread I
would, that is a cross for now for a guy considering gehört sich so important, relate to a
handyman guy.
<3
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6f176 No.19972369
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972370
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6c2760 No.19972372
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972373
>>19972367
so the thing with cats and dogs.
first of all, there are redactions and not everyone might be able to understand that there
is the concept of pov and not everything you consider real actuall is real. there are such
things as options, ON the move. ON IT.
surely you cannot be born into…again.
yeah, sort of. there are different versions of you.
in some you are a guy, in some you are sweet (alien, bc of west and et, I am a human
though.), in some you are an angel (that would be sweet + my shield in different versions),
in others you might be a God or a God that is internally referred to as Lord, or you might
be a cat.
in short:
connectiveness ensured by me defining it being the case and defining you not needing to
worry in any way. done. you clip your nails on sunday or eat a sandwich on tuesday for
dinner, yup, that would connect you to the angel or God you that could use eating a
sandwich as ritual, maybe using the noise the chewing makes to communicate a whole book to
other realms. that is the cat thing. one world, one cat? nah, more of a string (sandals)
thing, that would be white red and white blue cats. black blue cats is more crossroady. and
even than, a cat iis not "a" string but due to the nature of cats being a crowd thing. that
also means realities migth be connected and can even be connected in a structured way for
symbiosis effect. (this would be irl stuff, like having NY1-4 accessible via picking a
certain lane in a tunnel, constant times for nicer life, to be introduced by you over next
(dunno, 20? 50?) years, and thought of by me.
so in some versions you would have a voice talking inside of you.
in other versons you would do angels stuff and use the ambulance or police ride to do time
stuff. also motorcades, that is a horse thing, and knights stuff, "otto"mans, bc of the
helmet you do not notice time waves that much I guess. the logging in my horse movement I
imroved since having invented it half a year ago.
dog would be mike, uri, raph and gabe. shakras if you will.
or bread and shakras.
little more complicated as this is conceptual talk for architects to use.
this is a shared experience.
red, raphael, breastplate of righteousness, moral, also accuracy and such, does have an
awesome feature that can hardly be explained scientificly.
you can not only carry my voice inside of you, but also a library. in your heart (area,
shakra). this may be of help to you, it may not only offer thoughts and help you relate
when walking crossroads, it also does suggest a sometimes childish language that does lead
to a more soft voice (choisce of words, fett vs fette henne) when having much water in the
voice, hear, so that you make it rumble by having a crowd follow my ways.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972374
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972375
Now that I filtered half the board.
Afternoon actual anons.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972376
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972377
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972378
Books, jewelry and other Christmas gifts: The Biden family goes shopping on Nantucket as America waits for its hostages to be released from Gaza
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972379
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972380
>>19972352
>Anons, this is a phenomenal video put together by Bill Cooper about the Federal Reserve
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68ce8d No.19972381
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972383
>>19972373
the cat thing is even more shared.
it cannot be described and while seeing the hints in tv and such (not much of a book guy,
guess you tried hard as well) I realize it does not describe it very well.
(the wave coming at you is prolly not good for a movie initself, and the labyrinth running
movie which I like as irl nice does not transport the wave of "water" in the nice and
comforting way that having God swop some more nice reality onto you and crowd should have.
oh, also, there might be voices out of nowhere. and even in your brain, if you are up for
that.
so the cat thing is very shared, depending on the track you are on, depending on if you
attrackt more cats for education in my works (there is a vid of a small child holding a
glass of juice, walking to a table, stumbling a little, bc of that tilting the glass
slightly, stopping in the movement for a litte thought and then, cointinuing with what
seems closest, pouring out the tilted glass on the table, that he approached sort of. this
is advanced knowledge and should not be kept secret to those needing it, while not spamming
it out, while spamming it out bc architects may learn alot.
so "having a cat in your brain" is you walking simultaneously with reality. a shared
experience. you have common thoughts. you also feel individual and I can interrrupt
"nonsense" which is crucial and needed bc I myself as holy and perfect enjoy it alot at any
time. (nonsense would be childish appearing talk, choosing words that are more useful for
communicating to others and such).
it cannot by explained by e.g. having a chip in your brain, which I asked Elon on several
times to undo and not approach, same as cloning I do not like and as you to respect that
and follow.
chared and individual.
the super version of a track.
a track might be you getting up out of your chair and the tv saying up or toilet or
wherever you wanna go or chair or long or stand or such stuff.
that is reality itself.
my angelic shield which may be taken up allows for Godspeed, connecting crowds, and if more
advanced for higher tasks that feel not much like tasks but like being, bc tv says up or
such alot.
prolly, let me figure it out some more, but for noe, newst salty truth.
<3
77.
11.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
006dc8 No.19972384
>>19972376
The meatloaf!
We want some
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972385
>>19972365
When your eyelids become scrotums, it's time to die.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972386
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4dfa7c No.19972387
AHHHHH! DEREK CHAUVIN SERIOUSLY INJURED IN PRISON!!
AHHHHHHHHHH!
https://x.com/bennyjohnson/status/1728233699291038058
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972388
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972389
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b39d28 No.19972390
ALINA HABBA IS THE MOST IMPORTANT WOMAN IN THE WORLD RIGHT NOW PLUS SHE CAN SHOOT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972391
>>19972048
Let's talk about the Israeli "art students" that put explosives in the WTC.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972392
>>19972381
>Irish Lives Matter
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
95f82c No.19972394
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972395
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972396
Notables
#24519 >>19971984
>>19971999 @thejimwatkins Wouldn't you like to be a pepper too.
>>19972216 @elonmusk Guys I found Q*
>>19972206 Study Reveals More than Half of COVID-19 Vaccinated Feel Sick a Year Later - Naveen Athrapully
>>19972147 Nevada judicial corruption: Washoe County, and the stunning disregard shown by the judge (Russell).
>>19972199 Tennessee: 10 men charged after 2-day undercover human trafficking investigation
>>19972220 PF: FORTE10 USAF RQ-4 Global Hawk 10-2045
>>19972258 The EU could be facing another departure from the bloc, as the new President of the Netherlands is eyeing plans to leave the bloc.
>>19972287 Analysis of Pinal County’s 2022 Election, ‘Deliberate Malfeasance,’ Concludes Election Should Not Have Been Certified
>>19972318 ON THE LOTUS EATERS, GROK, ELON MUSKS NEW A.I PLUS ITS CONNECTIONS THE U.N AND THE W.E.F
>>19972381 Irish Lives Matter
@350
nom if missed
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972397
Let Zem Eat Zie Schisse'…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972398
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972400
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972401
>>19972388
fuck yeah, looks comfy over here.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972402
>>19972387
Someone's about to get hero status.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972403
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7e3e74 No.19972404
>>19972394
thesearenottheanonsyouarelookingfor.jpg
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972405
YOUR INTIMIDATION DOES NOT SEEM TO BE WORKING… PUNK BITCH… MAYBE IF YOU PRAY?!?!!? THE ROSARY?!?!!?
SHUT IT FUCKING DOWN!!!Fuckin Love Love Love Coincidences!!!
Jim Watkins says Q is a major psyop run by Media Matters and George Soros!
Of Course the QAnon Guy Blamed QAnon on George Soros
In sworn testimony before the Jan. 6 committee, Jim Watkins claimed QAnon was invented by George Soros and Media Matters. 04 January 2023, 11:05am
Jim Watkins, who helped facilitate the rise of QAnon to become a violent conspiracy movement that has infected large parts of the Republican Party, told the Jan. 6 committee that in fact,QAnon was invented by George Soros.
The transcript of Watkins’ June 2022 interview with the committee was published on Tuesday evening and reveals that the founder of 8kun, the platform where the anonymous leader of QAnon posted thousands of messages,
not only denied being behind QAnon but went one step further and claimed it was nothing more than a fiction created by the left to stifle independent thought.
“QAnon is manufactured by the left-wing media, and it’s probably put out mostly by a company called Media Matters, which is, I believe, funded by a man named George Soros,”
Watkins said in testimony that was given under the penalty of perjury. “It’s manufactured. It’s not anything to do with my website. I’ve used the term a couple times, and that’s before I realized what it even was.”
Watkins claimed to the committee’s investigators that Soros and Media Matters colluded to invent the QAnon movement in order to ”make it a boogeyman” because “they don’t like people thinking for themselves.”
https://www.vice.com/en/article/93a7j3/jim-watkins-george-soros-qanon
General Flynn says Q is a major psyop being run by Traitor Faggots
https://twitter.com/GenFlynn/status/1714872285482405924
UltraMJTruth@MJTruthUltra
A lot of people sent me this heated exchange between General Flynn & Dave from X22 and asked for my opinion.
I don’t see anyone else talking about this, so I will.
First, General Flynn is 100% correct:
• Our military abides by the US Constitution
• Our military acts on the…
Oct 17
General Mike Flynn@GenFlynn
Here’s my take on Q…
I believe it is a major psyop and from what I can tell, it or they or whatever or whoever is “running this op” has done a major disservice.
What I see are a bunch of people sitting and waiting for something to happen instead of doing what I have been calling for now for quite some time (LOCAL ACTION).
The nonsense about trump is still the president and the military is coming to the rescue is just that…nonsense.
I wasn’t belittling Dave (he’s a big boy), I was being brutally honest (like it or not or believe it or not).
Rome is burning Nero and the bucket brigade is getting low on water.
And like it or not (I don’t), we have a person in the WH that is there following a constitutional process…note I didn’t say fair election (which I don’t believe occurred).
Lastly, I so respect your smart statement and most definitely appreciate your support as well as Dave’s (I’m a big fan of X22).
I also appreciate the support by many of the digital soldiers who did and do support me.
Thank you will never be enough. However, I want us to face reality for what it is and it is staring us in the face currently and it is ugly.
But never ever give up and trust me, there will always be silver linings, we just have to find them and exploit them as soon and for as long as possible.
God bless
@MJTruthUltra
🦅🙏🏼🇺🇸
1:13 AM · Oct 19, 2023
https://twitter.com/GenFlynn/status/1714872285482405924
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a7c6dc No.19972407
>>19971984
Thank You Baker
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972408
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972409
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972410
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972411
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972412
>>19971999
>That hand is not real!
I see Pepes in the peppers.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972413
Prayers Answered Guise!
Flynn says One Religion!
Yes! Finally!
and since the U.S. is 42% Protestant this means Flynn is converting to Protestantism!
Prove anon wrong…
Wow! just wow! The U.S. is 42% Protestant! Anon just checked. So Flynn wouldn't want to divide by Religion by suggesting any Other Religion besides the Religion that is by far the most dominant in the US > Protestantism.
What an Amazing turn of events!
So many Catholics will finally See and follow Flynn.
This is amazing.
Imagine how many Catholics and others will now convert to Protestantism!
Praise God!
Michael Flynn tonight: “If we are going to have one nation under God, which we must, we have to have one religion. One nation under God, and one religion under God.”
https://twitter.com/RonFilipkowski/status/1459658826425249798
Michael Flynn says of the US: ‘We have to have one religion’ 13 Nov 2021
Michael Flynn, former national security adviser in the Trump administration, on Saturday said the United States should have a single religion.
“If we are going to have one nation under God, which we must, we have to have one religion,” he said while speaking on the “ReAwaken America” tour Saturday night. “One nation under God and one religion under God.”
https://thehill.com/homenews/media/581443-michael-flynn-says-of-the-us-we-have-to-have-one-religion/
Michael Flynn: US should have 'one religion under God' 14 Nov 2021
Former national security adviser Michael Flynn called for the United States to adopt more religious conformity Saturday, saying the country needs to have "one religion under God.”
The adviser to former President Donald Trump spoke at the ReAwaken America tour, which stopped in San Antonio, Texas, from Nov. 11-13.
During his time onstage, Flynn said religion is the foundation of the U.S. and that the country should have one faith.
“If we are going to have one nation under God, which we must, we have to have one religion. One nation under God, and one religion under God.”
https://www.washingtonexaminer.com/news/michael-flynn-america-have-one-religion
Trump ally Michael Flynn condemned over call for ‘one religion’ in US 15 Nov 2021
Michael Flynn, Donald Trump’s first national security adviser, was widely condemned after calling for the establishment of “one religion” in the US.
Religious freedom is enshrined in the first amendment to the US constitution, which says “Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof”.
Regardless, at a rally staged in San Antonio on Saturday by the Christian “nonprofit news media network” American Faith, Flynn said:
“If we are going to have one nation under God, which we must, we have to have one religion. One nation under God and one religion under God.”
https://www.theguardian.com/us-news/2021/nov/15/trump-ally-michael-flynn-condemned-call-one-religion
GOD WINS!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972414
https://markets.businessinsider.com/news/commodities/us-housing-market-outlook-tock-bottom-mortgage-rates-prices-redfin-2023-9
The housing market has hit 'rock bottom' and the sales slump will last a long time, Redfin CEO says
Jennifer Sor
Nov 24, 2023, 5:01 AM GMT-11
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972415
Q !UW.yye1fxo 01/22/2018 21:50:37 ID: b189f8 587
8chan/qresearch: 130667
PRAY.
PREY.
Notice the similarity?
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972416
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972417
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972418
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f51125 No.19972419
>>19972228
With new lenses Dad could see all the way to the end of the line at your Mom's house.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972420
General Flynn, Sir!
Anon requests Q & A, Sir!
Anon would like to invite You, As a verified BV personality to this board, Sir!
Management should have no problems making You a BV for this purpose, Sir!
Please General, Sir!
Show Anons, Sir!
o7
Some questions that you will likely encounter, Sir!
Why did you lie to the FBI when BOSS said that you had no reason to lie to the FBI which of course began the long and winding LEGAL road that you have been on?
Were (YOU) Freed?
Were [YOU] Flipped?
Your connections to the CIA appear to be extremely DEEP, Sir!
Would you like to explain your many connections to the CIA?
Your relationship with General Singlaub, a founding member of the CIA?
Your dual Company Creation? Which is a well known Clown technique.
Your interests in Turkey?
Your recent talk on Alex Jones Show even though Alex Jones has fully turned on POTUS over Jan 06?
Your comment about you being able to be the worst nightmare to a guy like Trump?
Anon is available ANY TIME that you wish to talk about these issues and much much more!
If this sounds like something that you would be willing to do for Anons, America and the World! Recorded in real time! Archived Offline?!
Contact Night Shift on Qresearch Research
o7
Sir!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972421
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e51f85 No.19972422
https://justthenews.com/nation/states/center-square/biden-impeachment-inquiry-builds-evidence
Biden impeachment inquiry continues to
build momentum, evidence
Just the News, by The Center Square Staff
Posted By: Ida Lou Pino, 11/24/2023 10:56:11 AM
The impeachment inquiry into President Joe Biden is gaining momentum as more evidence comes out to back allegations that the president himself financially benefited from the overseas business dealings of his son, Hunter. While Republicans will find it very difficult to get the needed supermajority to impeach Biden, the mounting evidence and media coverage would be another obstacle for Biden to overcome as he campaigns for reelection.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972424
>>19972410
if epstein was mossad was israel paying him to black mail politicians?
in unrelated news any politicians go there?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972425
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1b153d No.19972426
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972427
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972428
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972429
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ad308 No.19972430
>>19972257
You have to repeat a term as part of training the mind else it falls into into the waste bin of history. Shills do not try to diffuse violence but openly mock inviting more. Not everyone associated with any of these X are X-goofies and we need a way to separate "Identities". This is what is happening in Ireland where innocent migrants are having their homes burned and concentration camps are being setup. This applies everywhere as in Palestine and in a short while it will come to Israel in a bigger way than any of these exemplify.
I have saved more lives than anyone in the history of the world and I invite you or anyone else to challenge me on this. I wrote this last night and I stand by my principle whether you make it notable or not: A laborer works to the best of their ability regardless of how others work. That was a reference to God's Kingdom come. Amen?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aec970 No.19972431
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972432
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972433
>>19972414
>The housing market has hit 'rock bottom'
LOL, we got another month at least for that
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972434
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972435
>>19972433
LOL in the kek place
markets money the children!!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972436
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972437
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d70c06 No.19972438
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972439
>>19972438
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972440
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972441
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972442
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972443
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7e3e74 No.19972444
>>19972433
>we got another month at least for that
I'll take the over at about two years. Historically, it doesn't get bad until the Fed begins to cut after they have broke the market..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972445
>>19972424
Ask RFK Jr… He's in Epstein'$ Liddle Black Book…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972446
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972447
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972448
>>19972434
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972449
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972450
>>19972444
>>19972445
>>19972446
>>19972447
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972451
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
006dc8 No.19972452
>>19972424
might be onto something for
all that pro Israel legislation and gimme dats
but Israel shouldn't be getting the gimme dats iffn they gots the nukes
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f51125 No.19972453
>>19972432
POO
XI
IT
THE
BED
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972454
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972455
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b03b7f No.19972456
Did filterfag filter himself out? Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972457
too painful?
too soon?
:D
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972458
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bc0368 No.19972459
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972460
>>19972451
>>19972452
>>19972453
>>19972454
>>19972455
>>19972456
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c2cf59 No.19972461
>>19972204
Fuck off fagot & Musky faggot too, eat shit
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972462
>>19972347
>That man knew how to filter.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972463
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972464
>>19972430
Repost your original thesis
I will re-notable it, with this
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972465
>>19972458
gonna need you to elborate just a lil bit, Patriot!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972466
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972467
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972468
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972469
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972470
>>19972463
whats that russell?
how does Vigano make you feel?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4ad308 No.19972471
>>19972264
>GOD WILL KNOW HIS OWN!
I already know and am known. Thus my witnessing, testimony, and discourses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972472
>>19972468
whats that?
you have no feels concerning archbishop vagina?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972473
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972474
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972475
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972476
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0891dc No.19972477
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
307815 No.19972478
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972479
>>19972474
the children!!!!
*check my 401k*
the children though!
*trade a few shares*
we gotta stop these trannies!!!
*trade a few shares, talk smack about the shit I am about to short*
boycott budlight!
*check my 401k*
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972480
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972481
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972482
>>19972474
Glory to the filter!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5c25a9 No.19972483
>>19972464
Notable
New terms to quash stereotypes while still calling out the combative subgroups.
While we coined the phrase "not anti-X but pattern matching, so we can called out organized fanatical combatives logically; this phrase does not go far enough and should be used after we have defined the subgroups distinctively. Whether it is anti- :: (Semitic, Black, Muslim, LGBT, and other terms such as Homophobia, Misogyny, and other isolate terms), there is no pre-term to describe such subgroups with clarity; although we do have terms like: (ultra, intra, radical, etc…) they still leave these subgroups vaguely defined.
We need a term to describe:
a. that they are a subset and not a stereotype
b. that they converge around a mindset
c. that they have and use an excuse for their actions
d. that they will take actions that go beyond boundaries
e. that they are will to destroy in order to accomplish their agenda.
As I tried numerous combinations, I kept coming back to "gang of" to describe their sub-grouping and "organized" as in organization, whether explicit or implicit, based upon "fanatical" principles.Thus the post-term:
goofies
gang of organized fanatical indignant extremist saboteurs
and the pre-term to describe an individual
goofi
gangster of organized fanatical indignants.
Examples:
Their is a faction of Migrant-goofies
He is acting like a goofi-progressive
This way we are neither prejudice, discriminatory, biased, nor stereotyping but calling out dangerous subgroups that even the MSM cannot argue by our definition. Pattern matching at this point is not only fair and justified but undeniable.
Feel free to critique and make suggestions to better exemplify a-e.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0ff3c0 No.19972484
>>19972216
Q is Mod 8 Vector
Elon told me so
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972485
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972486
>>19972315
because they loaded a barge
full of kidnapped children
while he had the (word that rhymes with direction)
to make his collection
and he knew it was wrong
but said fuck it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972487
>>19972480
dont even fucking look at anon!
>>19972481
awahhh no feels at all!
its like the light is on but no light is coming out!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972488
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972489
>>19972465
Always Flexible…
Always…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972490
EWWW THE CHILDREN OF DARKNESS THOUGH!!!!
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972491
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6de96e No.19972492
>>19972464 Made a mistake in grammar will repost yet again.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972493
>>19972482
>Glory to the filter!
ROFL
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6ad197 No.19972494
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972495
YouTube embed. Click thumbnail to play.
>>19972480
: GOULD AS THE GOLD. [ KIM-CLEMENT-PROPHECY]
https://youtu.be/ftHfE1U0ZB8?si=nAqjb47zC0eeTOjZ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972496
OMFG AND THE CHILDREN OF LIGHT! IT IS LIKE VIGANO IS AN ANON!!!
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972497
>>19972379
yes, there is not "the world". many hints in wording in scripture.
Schaafe H.Erden.
angels can sort of take positions as placeholders, in a reality that not even is. well, there is that teamwork of Uriel and Gabriel, actual angels capable of actual magical angels stuff, they do check up on stuff and amongst others, make sure not everything is. that is an important task.
there might be 50 folks real and 500 angels making up a scene, that is just a for instance though. at this point, folks could enter my room by walking out of the tv, no bs. locked for now though. by me. around me. for others this is life.
bad stuff?
sometimes the talk itself seemed more important than the burden of having fake news. despite having the concept of fake news mentiones, in a subideal way due to connections to other stuff.
the oh so cruel lucifer style concept of cutting stuff refers to psalms and the way of comms to other realms in bulk data.
so, while I will not hang a nazi flag in my room I do consider that some might consider it real that nazis and jews and all the symbolism attached to it, including altering death numbers and the heavy talk about it, might indicate a "base for the nose" sort of situation where there is an excuse for folks being not seen and having them spawned out after having gotten education. education? how does one reality educate another? angels stuff.
see the thing with trust?
better bread next year.
no need to use yeast. up to you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.19972498
Martin Geddes
@martingeddes
Nov 23
If VIPs are protected by the Secret Service, are anons protected by the Unorthodox Service?
https://twitter.com/martingeddes/status/1727722941142503680
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972499
>>19972489
YOU HAVE CHOSEN PAIN!
Jun 29, 2020 6:32:10 PM EDT 4542
Q !!Hs1Jq13jV6 ID: 8e51b7 No. 9791782 [2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters.
However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes.
It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy?
Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio.
In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States.
I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò Titular Archbishop of Ulpiana Former Apostolic Nuncio to the United States of America
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972500
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8d1adc No.19972501
>>19972498
FUCK YOU FAGGOT MOTHERFUCKER!
NO REALLY MARTIN!
REALLY!
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972502
>>19972483
juwur dilluting itself
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edc6bc No.19972503
>>19972464
Notable
New terms to quash stereotypes while still calling out the combative subgroups.
While we coined the phrase "not anti-X, but pattern matching", so we can call out organized fanatical combatives logically; this phrase does not go far enough and should be used after we have defined the subgroups distinctively. Whether it is anti- :: (Semitic, Black, Muslim, LGBT, and other terms such as Homophobia, Misogyny, and other isolate terms), there is no pre-term to describe such subgroups with clarity; although we do have terms like: (ultra, intra, radical, etc…) they still leave these subgroups vaguely defined.
We need a term to describe:
a. that they are a subset and not a stereotype
b. that they converge around a mindset
c. that they have and use an excuse for their actions
d. that they will take actions that go beyond boundaries
e. that they are will to destroy in order to accomplish their agenda.
As I tried numerous combinations, I kept coming back to "gang of" to describe their sub-grouping and "organized" as in organization, whether explicit or implicit, based upon "fanatical" principles.Thus the post-term:
goofies:
gang of organized fanaticals indignant extremist saboteurs
and the pre-term to describe an individual
goofi:
gangster of organized fanatical indignants.
Examples:
Their is a faction of Migrant-goofies
He is acting like a goofi-progressive
This way we are neither prejudice, discriminatory, biased, nor stereotyping but calling out dangerous subgroups that even the MSM cannot argue by our definition. Pattern matching at this point is not only fair and justified but undeniable.
Feel free to critique and make suggestions to better exemplify a-e.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972504
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972505
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972506
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972507
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972508
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972509
>>19972492
<thought it was interesting but then you kept posting it over and over again
>Made a mistake in grammar will repost yet again.
FIGURE IT OUT BUDDY
THIS IS YOUR LAST CHANCE
OR IM STEALING YOUR IDEA
AND THEN IT WILL BE MY NOTABLE
ALL MINE, HA, AHAHAHAHAH
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972510
>>19972484
>>19972485
>>19972486
>>19972487
>>19972488
>>19972489
>>19972490
>>19972491
>>19972492
>>19972493
>>19972494
>>19972495
>>19972496
>>19972497
>>19972498
>>19972499
>>19972500
>>19972501
HEY KIDS! ANY FANS OF ARCHBISHOP MARIA VAGINA AND HIS FAITHFUL MINION TRAITOR MARSHALL?! AND DO YOU LIKE POTUS WORTHY OF BIBLICAL DEATH THREATS TOO?!? OMFG WE ARE GOING TO HAVE A GOOD TIME!
THE CHRISTMAS 2022 COORDINATED ATTACK ON POTUS BY ARCHBISHOP VIGANO, DR. TAYLOR MARSHALL AND GEORGE NEUMAYR > CATHOLIC CRUSADER DEEP CHURCH INSIDERS HERE TO HELP!
ATTACK TIMELINE NOTED 1 MINUTE FROM EXACTLY 24 HOURS > LOCK STEP JUST LIKE THE MEDIA WITH 4 a.m. TALKING POINTS
by Archbishop Vigano > Tue Dec 20, 2022 at 10:01 PM EST Vigano turns on Trump > Scandalous, Discouraging, Offending the Law of God, Trump Contaminated! Once a source of Hope! Soddom and Gamorrah Doom for America! All Trump' LGBT Fault!
by George Neumayr > Wed Dec 21, 2022 at 10:02 PM EST Trump LGBT Gala is NoMAGA! "Completely indefensible! Pull your head out of your ass, Mr. Trump! degenerates with fat wallets.Your greed is pathetic.No doubt the philosophically shallow Trump would scoff…"
by Taylor Marshall > Wed Dec 21, 2022 STREAMED LIVE "Romans, Chapter 1 says that those who are Gay, or even those who approve of the gay lifestyle, are worthy of Death" "Who will lead us Catholics?" "Ye? Desantis? Me? I want a Catholic Monarchy in America"
Archbishop Vigano https://www.lifesitenews.com/opinion/abp-vigano-trumps-lgbt-gala-shows-deep-state-has-contaminated-the-entire-political-elite/
RELATED TO THIS: Trump hosts gala for homosexual Republicans at Mar-a-Lago after Biden signs same-sex ‘marriage’ law
https://www.lifesitenews.com/blogs/trump-hosts-gala-for-homosexual-republicans-after-biden-signs-same-sex-marriage-law/
George Neumayr R.I.H [Neumayr] https://spectator.org/to-trump-your-support-for-gay-propaganda-will-not-make-america-great-again/
Taylor Marshall https://youtu.be/AglQWAntgas < Youtube Url Link NOW MARKED AS PRIVATE!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972511
>>19972394
R2D2.
I.N.R.I.
N&R (Jes.) 11.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972512
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972513
Dr. Jan Halper AGAIN confirms that Military Tribunals have been and continue to take place.
She also confirms:
✅ She holds dual UK/ US DOD Security Clearances.
✅ Because of her clearances, she has a Military contact who feeds her this information.
✅ Her contact confirmed there IS a global Military alliance being spearheaded by Space Force.
✅ The Military told the world on Jan 18, 2021 of a “Peaceful transition to Military Power” on ABC News.
✅ Navy JAG is running the Tribunals.
✅ Many “bigger moves” are being made by the Military behind the scenes.
My research and discernment tells me that Dr. Halper was absolutely tasked with bringing these messages of confirmation and hope to the Patriot community at this time.
Quite frankly, it’s common sense Psychology. Any good Military leader knows that the morale of soldiers and civilians is paramount during a war.
The military tasked truthers and Anons with helping to fight in this 5th Generation Information war.
They have known that as the end nears, people will be weary, concerned and tired.
Does it not make perfect sense that they would have someone with direct, credible Military connections deliver some confirmation to us all?
It does to me.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
307815 No.19972514
https://twitter.com/MattWallace888/status/1728243172311191575
🚨MINUTES AGO: Derek Chauvin, the Minneapolis police officer sentenced to 22 years in Prison over George Floyd’s death, was stabbed by another inmate and seriously injured at a federal prison in Arizona ⚠️
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972515
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972516
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68ce8d No.19972517
When Irish Men Riot, Everyone loses their Minds
But when Austere Doctors & Engineers do it, Nobody bats and eye
It couldn't be any more clear
The Controller desperatly want a -Race War-
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972518
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972519
you know that shit is kekaf pain
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f51125 No.19972520
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
22746b No.19972521
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7615ce No.19972522
>>19971984
Thank you Baker! o7
>>19971505
YES!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
307815 No.19972523
>>19972514
[THEY] can't have him go for appeal and win by the evidence coming to light.
Wetwork.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.19972524
>>19972498
Valentin Weber
@weberv_
Nov 21
A big thanks to @GERonCyber , Adm Rogers, Oberst Fraas, @RoderickParkes, & @a_pytlak who joined us online for this memorable evening. The transatlantic cyber relationship is strong-w minor differences in execution.
@AuswaertigesAmt , @StimsonCenter , @NSAGov , @cirbw, @dgapev
Nov 21, 2023 · 10:43 AM UTC
https://twitter.com/weberv_/status/1726914208447832338
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972525
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972526
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972527
>>19972510
Holy shit, is this a new one?
Guess I'll throw it in the bin
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972528
>>19972415
EA games, challange eeeeverything.
cha cha cha, langeeee
architects might read that as, well, all you gotta do it usethe bulk data, apply irl facts, psalm cut the info and do the trick.
what´s so hard?
:)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972529
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972530
>>19972510
and a pair of them gloves…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68ce8d No.19972531
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972532
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
59c74b No.19972533
>>19972523
Enough brainwashed black people at this point that
>Wetwork.
is just about automatically guaranteed in prison.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972534
Yiddish Niggers Killed Jesus…
Karma's (a.k.a. Holy Ghost/Spirit) a Bitch…
Time's Up!™
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.19972535
>>19972524
Divya Ganesan
@divyaganesann
Nov 22
This week with @dgapev and Former NSA Director Admiral Rogers! on #US and #Germany cyber integration. How can we follow #Ukraines model of public private partnership?? #cyber #security 🫡
Nov 22, 2023 · 5:02 PM UTC
https://twitter.com/divyaganesann/status/1727372090461061506
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972536
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
655157 No.19972537
>>19972382
54 posts.
Must be legit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41c1e8 No.19972538
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972539
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972540
>>19972480
>: GOULD AS THE GOLD. [ KIM-CLEMENT-PROPHECY]
@ ~12:00 min-mark
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972541
>>19972514
"Loose ends".
What now that it didn't quite succeed.
I bet we'll hear is is recovering then all of a sudden he'll be dead.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972542
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972543
>>19972527
Damn shame that you cannot delete entire Q drops though huh traitor? kek!
ANONS MOST RECENT Q
Q DROP #4799
Q !!Hs1Jq13jV6 09/30/2020 23:52:42 ID: 376386 4799
8kun/qresearch: 10864489
Anonymous 09/30/2020 23:43:23 ID:39774c
8kun/qresearch: 10864305
Image Name: 09302020nyt1.png
Filename: 08e41859ca2515db376999299074104a284701075e774fa4c4ab36b1ebe9d5d8.png
Rebuffed by Vatican, Pompeo Assails China and Aligns With Pope’s Critics
Pope Francis declined to see Secretary of State Mike Pompeo, who is demanding a harder Vatican line on China. The Holy See said meeting just before a U.S. election would be inappropriate.
By Jason Horowitz and Lara Jakes
Sept. 30, 2020, 7:26 p.m. ET
ROME — Secretary of State Mike Pompeo recently published a sharp letter excoriating the Vatican’s plans to renew an agreement with the Chinese government on Church operations in China. He promoted the article in a tweet, concluding, “The Vatican endangers its moral authority, should it renew the deal.”
An indignant Vatican took the article more as a calculated affront than a diplomatic gesture. The friction broke into the open on Wednesday as Mr. Pompeo arrived in Rome and met with prelates and others who are hostile to Pope Francis, while the Vatican denied him a meeting with the pontiff and rebuffed his efforts to derail the deal with China.
“Pompeo asked to meet” the pope, who turned him down because Francis had “clearly said that he does not receive political figures ahead of the elections,” Cardinal Pietro Parolin, who, as secretary of state, is the Vatican’s second-ranking official, told reporters.
But to some observers on both sides of the tensions between the Roman Catholic Church and the Trump administration, Mr. Pompeo’s visit is as much about the coming presidential election as about China policy. Mr. Pompeo dismissed that suggestion as absurd, but intended or not, his trip signals that President Trump is on the side of those conservative American Catholics who worry about the church’s direction under Francis and think he is soft on China.
Francis and Mr. Trump, who have exchanged sharp words in the past, present starkly different visions on issues ranging from the environment to immigration to the threat of populism. In appealing to the Vatican’s support for religious freedom as a reason to drop its China agreement, Mr. Pompeo seemed to seek common ground, but in a way that upset the pope’s chief allies and delighted his chief critics.
Cardinal Parolin said Mr. Pompeo’s article had caused “surprise” at the Vatican, because this visit to Rome by the secretary and the meetings with high officials at the Holy See had already been in the works and would have been a “more opportune” forum for airing grievances. He added that Mr. Pompeo’s choice to publish in First Things, a conservative Christian magazine that has called Francis a failure as Pope, also mattered.
https://www.nytimes.com/2020/09/30/world/europe/pompeo-pope-francis-china.html
>>10864305
When does a Church become a playground?
When does a Church become a business?
When does a Church become political?
When does a Church become corrupt?
When does a Church become willfully blind?
When does a Church become controlled?
Q
OH WAIT! The re up of the "Secret Vatican > China Accord" was breaking right when POTUS started yelling "CHINA CHINA CHINA FLU WUHAN FLU CHINA CHINA CHINA!".
For 2 weeks anon tried to get this into notes.
POTUS just screaming Wuhan China!
No BAKER would note it.
None… Except maybe Gerb! Love you Punk! No Homo!
Understand?
and right when anon is whooping the piss out of a fucking blatant Neo Nazi allowed not only to bake but BV HERE!
Q drops down and Q's Anon…
OSS was fucking livid…
It was GloriousAF and still is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df9110 No.19972544
Elon found Q.
Anons found God.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b821b No.19972545
>>19972514
who cares,
If this worthless scum wasn't in jail for a crime he didn't commit, he would literally be bashing grandma for not wearing a face mask.
Do you think he stops to think of the hundreds he sent to jail for crimes they didn't commit?
Hope he dies.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c5e405 No.19972546
>>19971981
>THERE'S A HAMAS COMMAND CENTER UNDER THE IRS BUILDING
Oh man, I like that one a bit too much. Call our greatest ally!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972547
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
68ce8d No.19972548
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972549
>>19972527
IKR they sending all their faggots to the front lines at once today.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972550
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972551
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972552
>>19972527
shame that ya cannot filter for the NEW EYES either huh?
This one goes out to all the "QANON" influencers, grifters, paytriots, truth analysts, Q Guru's and other pieces of shit that were simply "not smart enough" to put the following pieces together.
Some were smart enough but for some odd reason they didn't tell you or say anything really.
So Smart and so Patriotic of [them].
https://qalerts.app/
https://qalerts.app/?q=EYE+OF+PROVIDENCE
https://qalerts.app/?q=GODFATHER+III
https://qalerts.app/?q=OUR+FATHER
https://qalerts.app/?q=TRUST+MOST
https://qalerts.app/?q=BIBLICAL
https://qalerts.app/?q=VATICAN
https://qalerts.app/?q=SOROS
https://qalerts.app/?q=SATAN
https://qalerts.app/?q=POPE
https://qalerts.app/?q=NAZI
https://qalerts.app/?q=9-11
https://qalerts.app/?q=[GS]
https://qalerts.app/?q=[Y]
By drop #95 you knew…
By drop #133 you knew…
By drops #154, 306, 307 & 308 you knew…
By drops #997, 998 & 999 you knew…
By drop #1413 you knew…
By drop #1941 you knew…
By drops #1763 & 1879 you knew…
By drops #1950 & 1951 you knew…
By drop #3565 you knew…
By drop #4799 you knew…
DEFINE: Knowingly
Top 10 List"Decodes and Drops"
1: The "Eye of Providence" decode. Q drop #133.
2: The "Satan does not exist" drop. Q drop #133.
3: The "Alien" drops. Q drop #376, 2222, 2225 and 4966.
4: The "OWL/Y Head" decode. Q drop #192, 135, 136, 137 and 138.
5: The "Purge" drops. Godfather III Sig. Q drop #87 , 88, 95 and 3565.
6: The "Our Father, Who financed 9-11?" decode. Q drop #154, 306, 307 and 308.
7: The "Saviors" drop list from the "Nothing" drops. Q drop #111, 114 and 2442.
8: The "Nothing is going to stop what is coming" drops. Q drop #111, 114, 2442, 4845, 4874, 4944 and 4950.
9: The "Nazi > C_A > Vatican" Crazy Coincidences Collection. Q drop #851, 936, 938, 944, 1941, 1954 and 4654.
10: The "Free Thought = The Great Awakening" drops. Q drop #1926, 2171, 3038, 3613, 3721, 3858, 3905, 3906, 4491, 4535, 4553, 4602 and the "Precipice" at 4408.
Top 10 List"Friend or Foe?"
1: Alex Jones
2: General Flynn
3: Steve Bannon
4: Roger Stone
5: REDACTED FOR YOUR PROTECTION
6: Tucker Carlson
7: Elon Musk
8: Roman Catholic Archbishop Carlo Maria Vigano and minion Taylor Marshall
9: Jack Posobiec
10: [you] unless you repent
Disclaimer: Being on the above list does not mean that this player is a [Foe].
Being on the above list means that these players have made moves on the stage which make them appear and seem like Foes at least in the eyes of some Anons and/or Q per the drops.
If a player on the above list is actually a ]Friend[ attempting to appear as a [Foe], or is an actual [Foe], it is in the Interest of the Plan to highlight their actions either way.
Only Concernfags are concerned about Friendly Fire from Anons. Just like the MSM was terribly concerned about Patriots having "crazy theories" concerning 9-11.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23650a No.19972553
>>19972513
But where's the actual proof? Otherwise, it reeks of strategic disinfo and hopium bias.
Do she also sell books?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
97dc5d No.19972554
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972555
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2acd89 No.19972556
>>19972509
Part of the problem is copying from a post to a message box is not a 1:1 correlation and you have to remove spaces and page breaks. Plus the boxes do their own scaling and snap to corners making it difficult for the visually impaired.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972557
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41c1e8 No.19972558
>>19972534
No one took His life, HE gave it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0ff3c0 No.19972559
>>19972513
>The Military told the world on Jan 18, 2021 of a “Peaceful transition to Military Power” on ABC News.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972560
>>19972534
>Yiddish Niggers Killed Jesus…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972561
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972562
>>19972527
not being able to fight the data means that you are going to have a real fucking bad time here, Pretendanon/Shill
They want you divided.
Divided by religion.whoa! whoa! hang… hang on!
Divided by sex.free speech board
Divided by political affiliation.free speech board
Divided by class.free speech board
Timeline - 2018 to 2021 - the first 3 years of Q research from 4chan > 8kun
Former Board Owner Fast Jack is a Neo Nazi
Former Board Volunteer and Baker OSS is a Neo Nazi
Former Baker and OSS acolyte Animefagbaker is a Neo Nazi
OSS and Animefag were open about their Nazi tendencies yet one had to lurk into admin boards to find Fast Jack expressing his Nazi hatred of The Jewish Race via muh joo "kike, fucking kikes, all kikes should die" etc etc.
Neither Jim nor Codefaggot Ron ever expressed having any Problems or Concerns with this Fact. In fact, Laughter was the common response.
Notable: Little shill bitches just love to pretend that their muh joo shilling is why SPAM now… kek
FYI:
Neo Nazi's tend to be Catholic and/or Christian. Hitler was a confirmed Catholic yet this fact is hidden in History.
Neo Nazi's see themselves as "Defenders of the Faith" so any appeals to Logic and Reason versus Dogma are seen as personal attacks.
Neo Nazi's are not here to help or otherwise promote Q or Anons. They see Q as simply a vehicle where they will inject their ideology, grift and attempt to steer the flow of information.
Neo Nazi's wish to appear very PRO CHILDREN, ANTI ABORTION & PRO RELIGION yet many have been found to be quite the opposite and simply hiding behind Religion in order to spread their Hate, Evil.
Neo Nazi's are fond of Catholicism because Catholicism, like Christianity, has Racism built in. See: Good Friday Prayer for the Faithless Jews.
Neo Nazi's are attracted to POTUS because they believe POTUS is a racist, albeit secretly, and will thus promote policies which they agree with.
Neo Nazi's strive to get into command and control positions CCP as they believe that their influence can alter the outcome of the Plan!
Neo Nazi's have a powerful foothold in former Axis Power Japan.
Neo Nazi's from /pol/ make up the bulk of the Neo Nazis on Kun.
Neo Nazi's, like Law Enforcement, like to use the symbolism of St. Michael.
Neo Nazi's are funded by Soros. Soros, of course, takes orders from the "Eye of Providence" drop #133.
MORE FYI:
MUH JOO bots ran on 50-75 posts per bread.
MUH JOO shill team 6 ran the Kitchen most of the time.
MUH JOO bakers loved P = Payseur, Inthematrixxx > MG SHOW > Karli Bonne > Steve Bannon > Alex Jones > Jack Posobiec > Flynn et al.
MUH JOO bakers would let anything ANTI POPE FRANCIS in notes but they would fight fiercly to keep out any true criticism of the Vatican/Roman Catholic Church. Francis must be the Fall Guy.
MUH JOO bakers had to be pinned down in order for them to note the Vatican atrocities that were being exposed daily.
Q had to step in and Q these hard articles as these "Bakers" would flatly refuse. Split the bread, delete notes et al. they did everything in their power to stop the flow of Information.
Q Drop #4799 is one of these Drops. Read it. Anon was fighting with OSS late one night when Q Q'ed anon. MJ Fakers refused to note Pompeo's trip to the Vatican. Q saw it. Q knows…
Right when POTUS was blaming "CHINA WUHAN" daily for the Virus, these clowns were trying to hide and obscure the Fact that the Vatican had and was renewing a Condordat with China.
What does MUH JOO mean?
A MUH JOO shill is someone who believes or pretends to believe that the Jewish race and/or religion is responsible for most if not all atrocities ever committed.
A MUH JOO shill believes Hitler was a pretty cool dude.
A MUH JOO shill believes Palestine is the good guy in the Israel - Palestine conflict.
A MUH JOO shill does not like to consider radical islam > Iran as the potential main agitator in the Israel - Palestine conflict.
A MUH JOO shill desires to believe that no matter all the power in Europe that the Bauer > Rothschild family (Knights of Malta) subdued Europe via Banking. No really.
A MUH JOO shill believes that it was easy to see that it was the JOO this whole time and that does not bother them at all… that it was "easy to see".
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972563
>>19972553
Dream readings $120. Happy endings extra.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972564
>>19972553
One of these days you're going to have to have faith and believe BEFORE you see if you want your prayers answered.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972565
up your game, shilly!
Remember when Q prayed the Roman Catholic Version of the "Our Father" or Pater Noster with anons in a drop about who financed 9-11?
Remember when Q posted drop #306 and asked "Why was the Lord's prayer posted? Which version? Why is this relevant? What just came out re: the Lord's prayer? What can be connected? & Do you believe in coincidences?
Remember when Q asked anons to "Re-review the map post relevant news drops." and "GODFATHERIII"?
Good! Because the following is what that looks like…
PATER noster, qui es in cœlis; sanctificetur nomen tuum: Adveniat regnum tuum; fiat voluntas tua, sicut in cœlo, et in terra.
Panem nostrum cotidianum da nobis hodie: Et dimitte nobis debita nostra, sicut et nos dimittimus debitoribus nostris: et ne nos inducas in tentationem: sed libera nos a malo.
Q !ITPb.qbhqo 11/14/2017 21:25:29 ID: wmN+33xv #154
4chan/pol: 149467690
Who financed 9-11?
Who was Bin Laden’s handler?
Why was the Clowns In America tasked to hunt/kill/capture UBL?
Why not MI?
If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?
Why wouldn’t we want to capture UBL alive and extract other possible T-level events?
Perhaps someday people will understand ‘they’ had a plan to conduct ‘another’ mass extinction event.
WWI & II - orchestrated and planned by select families?
Fantasy land.
Remember, the more people there are, the more power the people have.
Why do D’s push for gun control ‘directly’ after every tragic incident?
Why is this so very important to their agenda?
We, the people, are who they are afraid of.
We, the people, are who they fear will one day awake.
Our Father who art in heaven,
Hallowed be thy name.
Thy kingdom come.
Thy will be done
on earth as it is in heaven.
Give us this day our daily bread,
and forgive us ourtrespasses,
as we forgive those whotrespassagainst us,
and lead us not into temptation,
but deliver us from evil.
Q
Q !ITPb.qbhqo 12/09/2017 13:12:19 ID: 571cae#306
8chan/cbts: 60141
News unlocks map.
Future proves past.
Why was the Lord's prayer posted?
Which version?
Why is this relevant?
What just came out re: the Lord's prayer?
What can be connected?
Do you believe in coincidences?
Re-review the map post relevant news drops.
Godfather III.
Q
Dec 09, 2017 1:16:56 PM EST#307
Q !ITPb.qbhqo ID: 571cae No. 60172
Dec 09, 2017 1:13:29 PM EST
Anonymous ID: e60938 No. 60150
Dec 09, 2017 1:12:19 PM EST
Q !ITPb.qbhqo ID: 571cae No. 60141
News unlocks map.
Future proves past.
Why was the Lord's PRAYER posted?
Which version?
Why is this relevant?
What just came out re: the Lord's PRAYER?
What can be connected?
Do you believe in coincidences?
Re-review the map post relevant news drops.
Godfather III.
Q
>>60141
Tues Nov 4th,
Who financed 9-11?
Who was Bin Laden's handler?
Why was the Clowns In America tasked to hunt/kill/capture UBL?
Why not MI?
If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?
Why wouldn't we want to capture UBL alive and extract other possible T-level events?
Perhaps someday people will understand ‘they' had a plan to conduct ‘another' mass extinction event.
WWI & II - orchestrated and planned by select families?
Fantasy land.
Remember, the more people there are, the more power the people have.
Why do D's push for gun control ‘directly' after every tragic incident?
Why is this so very important to their agenda?
We, the people, are who they are afraid of.
We, the people, are who they fear will one day awake.
Our Father who art in heaven,
Hallowed be thy name.
Thy kingdom come.
Thy will be done
on earth as it is in heaven.
Give us this day our daily bread,
and forgive us our trespasses,
as we forgive those who trespass against us,
and lead us not into temptation,
but deliver us from evil.
Q
>>60150
The "marker."
Learn to read the map.
News unlocks the map.
Q
Dec 09, 2017 1:21:38 PM EST#308
Q !ITPb.qbhqo ID: 571cae No. 60201
Tangent.
Expand your thinking.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
600a4c No.19972566
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972567
>>19972375
Afternoon?
Dude, where you at?
Hawaii?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b6906 No.19972568
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
655157 No.19972569
Tonight has been a shit popcorn Friday. Just sayin'.
Bunch of spammers and two Elon Tweets.
Get the board back in shape.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972570
>>19972538
For the [pre]fix [pro]= NO.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972571
>>19972556
>visually impaired.
Is that why you keep selecting a new VPN for each post?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972572
Why worry, Shilly? Anon is certian that any new eyes who see our exachanges is going to believe your whining over the Data…
Dig and decode on the Eye of Providence - Q drop #133 version 7.0 "Many governments of the world feed the ‘Eye’. The Eye of Providence."
https://en.wikipedia.org/wiki/Eye_of_Providence
https://symbolsage.com/eye-of-providence-meaning/
https://commons.wikimedia.org/wiki/Eye_of_Providence
https://www.catholic.com/qa/gods-all-seeing-eye-isnt-masonic
https://www.catholicbridge.com/catholic/all-seeing-eye-churches.php
https://www.unexpectedtraveller.com/illuminati-symbols-catholic-churches/
https://www.catholic-saints.info/catholic-symbols/eye-christian-symbol.htm
https://www.catholictriparish.org/uploads/8/9/4/5/89454746/signs___symbols.pdf
https://www.ancient-origins.net/human-origins-religions/eye-providence-0013057
https://www.reddit.com/r/Catholicism/comments/zpvrsw/is_this_a_catholic_symbol_specifically_the_eye/
https://www.christianforums.com/threads/why-so-some-many-catholic-churches-have-the-eye-of-providence-in-them-the-same-symbo.7858026/
U.S. Conference of Catholic Bishops@USCCBThe all-seeing eye is not a Masonic symbol but represents God's omnipresence. When surrounded by a triangle, it symbolizes the Trinity. 11:02 AM · Dec 18, 2019 https://twitter.com/USCCB/status/1207330423484928006
Nov 11, 2017 11:29:35 PM EST DROP #133 Q !ITPb.qbhqo ID: gO/UntOB No. 149063235
Hard to swallow.
Important to progress.
Who are the puppet masters?If Saud, Roths and Soros are the Puppet Masters, why does Q repeat this Question again below?
House of Saud (6+++) - $4 Trillion+
Rothschild (6++) - $2 Trillion+
Soros (6+) - $1 Trillion+
Focus on above(3).
Public wealth disclosures – False.
Many governments of the world feed the‘Eye’.
Think slush funds (feeder).
Think war (feeder).
Think environmental pacts (feeder).
Triangle has(3)sides.
Eye of Providence.The EYE OF PROVIDENCE is an ancient symbol most commonly associated with Christianity, Catholicism > Holy Trinity. The Eye of God is in the Middle of the Triangle.
Follow the bloodlines.
What is the keystone?SATAN is the keystone? Double meanings exist? (keystone)
Does Satan exist?No.
Does the ‘thought’ of Satan exist?Yes and it is the Thought that Counts.
Who worships Satan?All Religions which require a Satan, Devil, Negative archetype > excuse for evil to exist.
What is a cult?Noun: cult; plural noun: cults a system of religious veneration and devotion directed toward a particular figure or object.
Epstein island.
What is a temple?Church, Cathedral, building dedicated to a figure or object.
What occurs in a temple?Worship and sacrifice.
Worship?
Why is the temple on top of a mountain?Represents the Mouth of the Diety
How many levels might exist below?Many, arranged like a body
What is the significance of the colors, design and symbol above the dome?Symbology of the Puppet Masters
Why is this relevant?
Who are the puppet masters?Why is Q asking this question again? This means that the above 3 are not the Puppet Masters but the Puppets.
Have the puppet masters traveled to this island?
When? How often? Why?
“Vladimir Putin: The New World Order Worships Satan”
Q
Here are the 3 Keys to the 3 Lock Box that is the Eye of Providence Decode
6+++ Saudi Arabia removed via Purge described in Drops #87, #88 and #95 https://www.newyorker.com/news/news-desk/the-saudi-royal-purge-with-trumps-consent
6++ Roths removed in too many drops to list here https://www.cnn.com/style/rothschild-family-collection-auction-sold-tan/index.html
6+ Soros removed in too many drops to list here https://www.bloomberg.com/news/articles/2023-10-12/soros-shutters-offices-across-25-billion-philanthropy-empire
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf943d No.19972573
YouTube embed. Click thumbnail to play.
https://www.youtube.com/watch?v=4kWauPUac3Y
26 minutes
How hospitals became ‘fair game’ in Gaza | The Listening Post
Al Jazeera English
578K views 6 days ago
The evidence provided by Israeli forces to justify their attacks on Gaza's hospitals has come up short - and so has the news coverage
see how propaganda is done… badly
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c1c89f No.19972574
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972575
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.19972576
YouTube embed. Click thumbnail to play.
>>19972524
>>19972535
This week with @dgapev and Former NSA Director Admiral Rogers! on #US and #Germany cyber integration.
Admiral Rogers 3 days ago.
14:15
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972577
>>19972567
Somewhere southwest of there, fren.
WRWY WW
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bdef93 No.19972578
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
41c1e8 No.19972579
>>19972568
You're trying to credit the Jews with what Jesus did.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2c2ac7 No.19972580
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972581
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972582
QRESEARCH ADMIN DID NOT WANT ANONS TO READ THE ARTICLE CONCERNING THE ISRAEL SITUATION THAT POTUS RETRUTHED YESTERDAY?
Don't you wonder why though?
Hinkle’s business model?“Subscribe to my X Premium for $3 to help me DEFEAT THE ZIONIST LIES.”
>>19970344
>>19970375
>>19970378
BAKER SAYSAfter reading about industrial nitrogen synthesis and what it's done to the atmosphere in the last 100 years, the most logical explanation for chemtrails and why their still up despite 'le Plan' etc…
Is that it's literally necessary to maintain the atmosphere and produce rainfall.
>t. the industrial revolution and its consequences have left our planet on life support
TIPPY TOP KEK!
>>19970285
>>19970385
>>19970387
>>19970390
>>19970391
>>19970393
Really though, Baker... Don't you think it is odd that an article which POTUS truthed and says so much about the current ISRAEL situation would NOT be notable?
Some of the local shills would say that this is "Fascinating" really...
>>19969977
>>19969978
>>19969979
>>19969980
>>19969981
>>19969984
>>19969988
>>19969756
>>19969765
>>19969765
>>19969771
>>19969784
>>19969785
>>19969732
For some odd reason, a whole series of POTUS posts from yesterday 11 23 2023 were simply listed as 'POTUS SHITPOSTING', with only the most recent post capped.
The notable was titled "POTUS SHITPOSTING".
One of the articles POTUS "shitposted" wasThe Israel Op
>>19967599
>>19967595
>>19967592
>>19967589
THE ISRAEL OP BUN
POTUS re truthed this article on 11 23 2023 and it was not noted at all.
>>19969690
>>19969691
>>19969695
>>19969696
>>19969697
>>19969707
>>19969712
Donald J. Trump@realDonaldTrump
tabletmag.com/sections/news/ar
The Israel Op
An information warfare campaign tries to flip demoralized portions of the right into supporting Hamas and Obama’s Iran deal
www.tabletmag.com
Nov 23, 2023, 3:43 PM
https://truthsocial.com/@realDonaldTrump/posts/111461807192737407
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972583
>>19972469
the office, EggSaladSandWich in an airplane.
EW is the "move" I and others tend to make (see what I did there) when something is not ideal.
this might indicate a spider "move" (this would be an actual move, e.g mother nature making sure fire gets invented by providing different stones, bad example, I know, anyway.)
this can be observed by white without having black. lurk mode. and careful checking, bc maybe I do not want a jacket that slips easy from a chair (or do I?) but rather a jacket that is warm and in lack of a rooftop on my balkony rainprotective. nah, no worries, this can be a pick up, not that bad. he is. :)
77.
stuff like that in tv, no rush though, also I myself, being almighty God and all that, sometimes only see stuff that then appears pretty basic when watching something I enjoy for the 20th time.
the office, silent Rob, Ex is ok for SmallerScale.
Child leaping in the womb infact. the black eyes is the same.
rumbling? all fine, hidaling forst episode, pastor talks about crowd and indicates rumblig movement.
secret? not exactly, as many others lurk who would be much comforted if you were to relate to it in a positive way, yes to it, if that is your honest opinion.
sesamestreet educating sweet aliens with basics of shapeshifting? yeah sure…. :)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972584
>>19972559
Is that General Walker, the one who provided nana pelosi's comms when she planned J6, so that when FBI investigated, nothing would lead back to her bc was done via military?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972585
QRESEARCH ADMIN DID NOT WANT ANONS TO READ THE ARTICLE CONCERNING THE ISRAEL SITUATION THAT POTUS RETRUTHED YESTERDAY?
Don't you wonder why though?
Hinkle’s business model?“Subscribe to my X Premium for $3 to help me DEFEAT THE ZIONIST LIES.”
>>19970344
>>19970375
>>19970378
BAKER SAYSAfter reading about industrial nitrogen synthesis and what it's done to the atmosphere in the last 100 years, the most logical explanation for chemtrails and why their still up despite 'le Plan' etc…
Is that it's literally necessary to maintain the atmosphere and produce rainfall.
>t. the industrial revolution and its consequences have left our planet on life support
TIPPY TOP KEK!
>>19970285
>>19970385
>>19970387
>>19970390
>>19970391
>>19970393
Really though, Baker... Don't you think it is odd that an article which POTUS truthed and says so much about the current ISRAEL situation would NOT be notable?
Some of the local shills would say that this is "Fascinating" really...
>>19969977
>>19969978
>>19969979
>>19969980
>>19969981
>>19969984
>>19969988
>>19969756
>>19969765
>>19969765
>>19969771
>>19969784
>>19969785
>>19969732
For some odd reason, a whole series of POTUS posts from yesterday 11 23 2023 were simply listed as 'POTUS SHITPOSTING', with only the most recent post capped.
The notable was titled "POTUS SHITPOSTING".
One of the articles POTUS "shitposted" wasThe Israel Op
>>19967599
>>19967595
>>19967592
>>19967589
THE ISRAEL OP BUN
POTUS re truthed this article on 11 23 2023 and it was not noted at all.
>>19969690
>>19969691
>>19969695
>>19969696
>>19969697
>>19969707
>>19969712
Donald J. Trump@realDonaldTrump
tabletmag.com/sections/news/ar
The Israel Op
An information warfare campaign tries to flip demoralized portions of the right into supporting Hamas and Obama’s Iran deal
www.tabletmag.com
Nov 23, 2023, 3:43 PM
https://truthsocial.com/@realDonaldTrump/posts/111461807192737407
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972586
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972587
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972588
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972589
QRESEARCH ADMIN DID NOT WANT ANONS TO READ THE ARTICLE CONCERNING THE ISRAEL SITUATION THAT POTUS RETRUTHED YESTERDAY?
Don't you wonder why though?
Hinkle’s business model?“Subscribe to my X Premium for $3 to help me DEFEAT THE ZIONIST LIES.”
>>19970344
>>19970375
>>19970378
BAKER SAYSAfter reading about industrial nitrogen synthesis and what it's done to the atmosphere in the last 100 years, the most logical explanation for chemtrails and why their still up despite 'le Plan' etc…
Is that it's literally necessary to maintain the atmosphere and produce rainfall.
>t. the industrial revolution and its consequences have left our planet on life support
TIPPY TOP KEK!
>>19970285
>>19970385
>>19970387
>>19970390
>>19970391
>>19970393
Really though, Baker... Don't you think it is odd that an article which POTUS truthed and says so much about the current ISRAEL situation would NOT be notable?
Some of the local shills would say that this is "Fascinating" really...
>>19969977
>>19969978
>>19969979
>>19969980
>>19969981
>>19969984
>>19969988
>>19969756
>>19969765
>>19969765
>>19969771
>>19969784
>>19969785
>>19969732
For some odd reason, a whole series of POTUS posts from yesterday 11 23 2023 were simply listed as 'POTUS SHITPOSTING', with only the most recent post capped.
The notable was titled "POTUS SHITPOSTING".
One of the articles POTUS "shitposted" wasThe Israel Op
>>19967599
>>19967595
>>19967592
>>19967589
THE ISRAEL OP BUN
POTUS re truthed this article on 11 23 2023 and it was not noted at all.
>>19969690
>>19969691
>>19969695
>>19969696
>>19969697
>>19969707
>>19969712
Donald J. Trump@realDonaldTrump
tabletmag.com/sections/news/ar
The Israel Op
An information warfare campaign tries to flip demoralized portions of the right into supporting Hamas and Obama’s Iran deal
www.tabletmag.com
Nov 23, 2023, 3:43 PM
https://truthsocial.com/@realDonaldTrump/posts/111461807192737407
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972590
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7e3e74 No.19972591
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.19972592
A mature faith has the capacity to appreciate where God ultimately cannot be “understood” or “comprehended.”
God will never let us down, anons. He can overcome all. The physical is a test of our willingness to surrender to Him. You are not only undergoing to largest, most expansive psyop of all time; you are more importantly undergoing one of the most intense litmus tests of true, mature faith possibly ever seen on this planet.
How stubbornly do you stand in your faith? We all have the duty to uphold each other in our faith and trust in God. Love your neighbor as yourself - the Golden Rule.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972593
>>19972586
ANON UNDERSTANDS YOUR SHILL FRUSTRATIONS
QRESEARCH ADMIN DID NOT WANT ANONS TO READ THE ARTICLE CONCERNING THE ISRAEL SITUATION THAT POTUS RETRUTHED YESTERDAY?
Don't you wonder why though?
Hinkle’s business model?“Subscribe to my X Premium for $3 to help me DEFEAT THE ZIONIST LIES.”
>>19970344
>>19970375
>>19970378
BAKER SAYSAfter reading about industrial nitrogen synthesis and what it's done to the atmosphere in the last 100 years, the most logical explanation for chemtrails and why their still up despite 'le Plan' etc…
Is that it's literally necessary to maintain the atmosphere and produce rainfall.
>t. the industrial revolution and its consequences have left our planet on life support
TIPPY TOP KEK!
>>19970285
>>19970385
>>19970387
>>19970390
>>19970391
>>19970393
Really though, Baker... Don't you think it is odd that an article which POTUS truthed and says so much about the current ISRAEL situation would NOT be notable?
Some of the local shills would say that this is "Fascinating" really...
>>19969977
>>19969978
>>19969979
>>19969980
>>19969981
>>19969984
>>19969988
>>19969756
>>19969765
>>19969765
>>19969771
>>19969784
>>19969785
>>19969732
For some odd reason, a whole series of POTUS posts from yesterday 11 23 2023 were simply listed as 'POTUS SHITPOSTING', with only the most recent post capped.
The notable was titled "POTUS SHITPOSTING".
One of the articles POTUS "shitposted" wasThe Israel Op
>>19967599
>>19967595
>>19967592
>>19967589
THE ISRAEL OP BUN
POTUS re truthed this article on 11 23 2023 and it was not noted at all.
>>19969690
>>19969691
>>19969695
>>19969696
>>19969697
>>19969707
>>19969712
Donald J. Trump@realDonaldTrump
tabletmag.com/sections/news/ar
The Israel Op
An information warfare campaign tries to flip demoralized portions of the right into supporting Hamas and Obama’s Iran deal
www.tabletmag.com
Nov 23, 2023, 3:43 PM
https://truthsocial.com/@realDonaldTrump/posts/111461807192737407
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ccbbdf No.19972594
>>19972050
Fucking thieves need to die. Painfully. This is not painful enough. It's got to be a 100% deterrent.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972595
>>19972513
she poasted this on her Truth social
https://truthsocial.com/@RealDrJan/111433385869456898
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972596
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b7fc63 No.19972597
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972598
>>19972595
"national debt"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972599
>>19972592
A MATURE FAITH DOES NOT BEG FOR VALIDATION LIKE A LIL BITCH IN FRONT OF THE WORLD IN A WAR ZONE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972600
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972601
YouTube embed. Click thumbnail to play.
>>19972570
>>19972538
>For the [pre]fix [pro]= NO.
—
: WORD-SPELL: Russell-Jay: Gould. : PLEASE-SHARE.
https://youtu.be/w7Ej3nDwhQ4?si=f5ZyhmyWcWVLFEV3
—
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
600a4c No.19972602
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972603
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a862c9 No.19972604
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b7fc63 No.19972605
>>19972595
How many people continue to listen to this?
It's another distraction of hopium
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972606
LETS USE THIS OPPORTUNITY TO TRY TO LURE PEOPLE TO OUR MENTAL ENSLAVEMENT DURING THEIR PERIOD OF WEAKNESS AND CALL OURSELVES "HOLY"
Q !!mG7VJxZNCI 03/12/2019 14:55:14 ID: 4fe510 3038
8chan/qresearch: 5643022
>Decide for yourself (be free from outside opinion).
>Decide for yourself (be objective in your conclusions).
>Decide for yourself (be true in your own beliefs).
>Decide for yourself (be open to following the facts).
>Decide for yourself (be strong in defending your beliefs).
>Decide for yourself (be resistant to blindly accepting fact-less statements).
>Decide for yourself (be free)
Those who attack you.
Those who mock you.
Those who cull you.
Those who control you.
Those who label you.
Do they represent you?
Or, do they represent themselves (in some form)?
Mental Enslavement.
The Great Awakening ('Freedom of Thought’), was designed and created not only as a backchannel to the public (away from the longstanding ‘mind’ control of the corrupt & heavily biased media)
to endure future events through transparency and regeneration of individual thought (breaking the chains of ‘group-think’), but, more importantly, aid in the construction of a vehicle (a ‘ship’)
that provides the scattered (‘free thinkers’) with a ‘starter’ new social-networking platform which allows for freedom of thought, expression, and patriotism or national pride
(the feeling of love, devotion and sense of attachment to a homeland and alliance with other citizens who share the same sentiment).
When ‘non-dogmatic’ information becomes FREE & TRANSPARENT it becomes a threat to those who attempt to control the narrative and/or the stable.
When you are awake, you stand on the outside of the stable (‘group-think’ collective), and have ‘free thought’.
"Free thought" is a philosophical viewpoint which holds that positions regarding truth should be formed on the basis of logic, reason, and empiricism, rather thanauthority, tradition, revelation, or dogma.
When you are awake, you are able to clearly see.
The choice is yours, and yours alone.
Trust and put faith in yourself.
You are not alone and you are not in the minority.
Difficult truths will soon see the light of day.
WWG1WGA!!!
Q
dogma noun
dog·ma | ˈdȯg-mə , ˈdäg-
plural dogmas also dogmata ˈdȯg-mə-tə , ˈdäg-
Definition of dogma
1a: something held as an established opinion
especially : a definite authoritative tenet
b: a code of such tenets
pedagogical dogma
c: a point of view or tenet put forth as authoritative without adequate grounds
2: a doctrine or body of doctrines concerning faith or morals formally stated and authoritatively proclaimed by a church
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972607
I gave EVERYONE a chance.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972608
>>19972597
And there i was stealing memes on the kun
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972609
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2acd89 No.19972610
>>19972571
Some are protecting me, some are playing pickle ball with me.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
82b0e3 No.19972611
>>19972463
when will anons realize
there isno timeline
there is a sequence of events
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7fa781 No.19972612
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972613
>>19972600
STFU YA BIG PUSSY
MAKE PAIN OR STAY A TRAITOR
Q !!mG7VJxZNCI 03/12/2019 14:55:14 ID: 4fe510 3038
8chan/qresearch: 5643022
>Decide for yourself (be free from outside opinion).
>Decide for yourself (be objective in your conclusions).
>Decide for yourself (be true in your own beliefs).
>Decide for yourself (be open to following the facts).
>Decide for yourself (be strong in defending your beliefs).
>Decide for yourself (be resistant to blindly accepting fact-less statements).
>Decide for yourself (be free)
Those who attack you.
Those who mock you.
Those who cull you.
Those who control you.
Those who label you.
Do they represent you?
Or, do they represent themselves (in some form)?
Mental Enslavement.
The Great Awakening ('Freedom of Thought’), was designed and created not only as a backchannel to the public (away from the longstanding ‘mind’ control of the corrupt & heavily biased media)
to endure future events through transparency and regeneration of individual thought (breaking the chains of ‘group-think’), but, more importantly, aid in the construction of a vehicle (a ‘ship’)
that provides the scattered (‘free thinkers’) with a ‘starter’ new social-networking platform which allows for freedom of thought, expression, and patriotism or national pride
(the feeling of love, devotion and sense of attachment to a homeland and alliance with other citizens who share the same sentiment).
When ‘non-dogmatic’ information becomes FREE & TRANSPARENT it becomes a threat to those who attempt to control the narrative and/or the stable.
When you are awake, you stand on the outside of the stable (‘group-think’ collective), and have ‘free thought’.
"Free thought" is a philosophical viewpoint which holds that positions regarding truth should be formed on the basis of logic, reason, and empiricism, rather thanauthority, tradition, revelation, or dogma.
When you are awake, you are able to clearly see.
The choice is yours, and yours alone.
Trust and put faith in yourself.
You are not alone and you are not in the minority.
Difficult truths will soon see the light of day.
WWG1WGA!!!
Q
The Great Awakening is not Blind Faith.
The Great Awakening is Freedom of Thought.
dogma noun
dog·ma | ˈdȯg-mə , ˈdäg-
plural dogmas also dogmata ˈdȯg-mə-tə , ˈdäg-
Definition of dogma
1a: something held as an established opinion
especially : a definite authoritative tenet
b: a code of such tenets
pedagogical dogma
c: a point of view or tenet put forth as authoritative without adequate grounds
2: a doctrine or body of doctrines concerning faith or morals formally stated and authoritatively proclaimed by a church
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972614
>>19972592
Well, my neighbors are real pieces of shit and I don't have stockholm syndrome. I'll love them when they deserve it. One shot a chihuahua 3x for no reason and abuses her dogs n hangs them by the collar and the other one keeps calling the cops on me and lying to them but last time, I came here and asked for prayer and then he ended up blowing his cover and he got caught lying. His sister even called the cops and said I had slashed his tires and dumped trash in his yard. Sheriff didn't believe him n neither did the po so nobody came out. I can now go slash the fuckers tires and nobody will believe him if he calls. I hope they fucking die.
And yes, God STILL adores me.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7615ce No.19972615
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0ff3c0 No.19972616
>>19972584
>nothing would lead back to her bc was done via military?
perhaps you don't understand what 'transition to military power' means?
why would you want evidence flowing through the corrupt FBI/DOJ when we all know that's a black hole?
I can only assume you are trying to improve the argument the Anon I was replying to was trying to make.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972617
ANON REALLY DOES NOT CARE WHICH YOU CHOOSE YET STOP PRETENDING
dogma noun
dog·ma | ˈdȯg-mə , ˈdäg-
plural dogmas also dogmata ˈdȯg-mə-tə , ˈdäg-
Definition of dogma
1a: something held as an established opinion
especially : a definite authoritative tenet
b: a code of such tenets
pedagogical dogma
c: a point of view or tenet put forth as authoritative without adequate grounds
2: a doctrine or body of doctrines concerning faith or morals formally stated and authoritatively proclaimed by a church
3613
Nov 21, 2019 5:00:19 PM EST 3613
Q !!mG7VJxZNCI ID: 000000 No. 7359247
What happens when 90% of the media is controlled/owned by (6) corporations?
What happens when those same corporations are operated and controlled by a political ideology?
What happens when the news is no longer free from bias?
What happens when the news is no longer reliable and independent?
What happens when the news is no longer trustworthy?
What happens when the news simply becomes an extension/arm of a political party?
Fact becomes fiction?
Fiction becomes fact?
When does news become propaganda?
Identity creation?
How does the average person, who is under constant financial stress (by design), find time to research and discern fact v fiction?
Majority of people more prone to believe someone in power sitting behind a big brand ‘news’ name?
Do people [human psyche] tend to follow the ‘majority/mainstream viewpoint’ in fear of being isolated and/or shunned?
‘Mainstream’ is used for a reason [dominate trend in opinion].
[If majority of people believe ‘x’ then ‘x’ must be validated / true]
Why do ‘mainstream’ media heads, within different orgs, always use the same keywords and/or catch phrases?
Coordinated? By who? Outside entity providing instructions?
Do they count on the fact that people [human psyche] are more prone to believe something if heard over-and-over again by different ‘trusted’ sources?
Do ‘echo chamber’ tactics provide validation / credibility to the topic/point being discussed?
Threat to intellectual freedom?
Would control over[of] these institutions/organizations allow for the mass control of a populations viewpoint re: a desired topic?
Read again – digest.
Would control over[of] these institutions/organizations allow for the mass control of a populations viewpoint re: a desired topic?
Logical thinking.
Why, after the election of 2016, did [D]’s and media corps jumpstart a [coordinated & planned] divisive blitz intended to create falsehoods re: illegitimacy of election, character assassination of POTUS through sexism, racism, every other ‘ism’?
Pre/post 2016 election?
Why were violent [masked] terror orgs such as Antifa immediately created/funded?
Why were these orgs tasked w/ immediate intimidation/shut down of any pro-POTUS rally[s] and/or events?
Why were marches immediately organized to counter and silence pro-POTUS rally[s] and/or events?
Why were marches immediately organized which divided people into sex/gender, race, [ism]?
When you control the levers of news dissemination, you control the narrative.
Control of the narrative = power
When you are blind, what do you see?
They want you divided.
Divided by religion.
Divided by sex.
Divided by political affiliation.
Divided by class.
When you are divided, and angry, and controlled, you target those ‘different’ from you, not those responsible [controllers].
Divided you are weak.
Divided you pose no threat to their control.
When ‘non-DOGMAtic’ information becomes FREE & TRANSPARENT it becomes a threat to those who attempt to control the narrative and/or stable [livestock kept – sheep].
When you are awake, you stand on the outside of the stable (‘group-think’ collective), and have ‘free thought’.
"Free thought" is a philosophical viewpoint which holds that positions regarding truth should be formed on the basis of logic, reason, and empiricism, rather than authority, tradition, revelation, or DOGMA.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df9110 No.19972618
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972619
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972620
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972621
>>19972583
I love gay folks and would never get involved in whom you choose as a partner.
as this is obvious, you prolly want my opinion on another thing I said.
while I am sure gay folks find a respectul way to do it and I am more than fine for them doing it this way it, in general I do not appreciate anal sex between man and woman as this has a dominating and imho also disrespectful component to it.
should you get repressions when assfucking?
nah. is there a way, throughout time, curling approach, that there was a way to spam bulk data on a chakra/color/horse/force without bad stuff happening?
irl and symbolism got mixed up. tropfsteinhöhle means getting to know the heavens in a way. starting with the fact that there indeed is a rather strong perception of time when being a human and limited to a body.
the "hey, over here, 2 years back and 5 corners to the right, you had more money and did not loose your house?" approach is not applicable to single folks it seems.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bcc9f5 No.19972622
YouTube embed. Click thumbnail to play.
See you faggots later.
When I get back the gaylord shills need to be hanging from ropes.
I'll being moar filter.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972623
>>drivespeopleawayfromqdata19972617
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df9110 No.19972624
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972625
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972626
>>19972623
is [your] faggot opinion
maybe those people need to gtfo?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e7a78c No.19972627
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ead37d No.19972628
>>19972583
>"Wein auf" - Bier - das rat ich dir.
beer. monks. bread. crumbs. David. Daniel. white. planes. autists. Luke.
if there is bread letting you know the wine is bad you give info on new wine. (Mark 2 22)
>"Bier auf Wein" - das lass sein.
never good to mix things, even when architects talk, or rather communicate (those that
build worlds by talk and share building plans are not needing bad shit, only super symbolic
talk in babylon bee.
the mixng that you think to be doing is bulk date bc of comms as well as sharing the
architectursal (not irl) concept of having stuff connected and disconnected again. not for
actual irl folks to do.
another thing, also not to be done, but as a comforting explanation to understand those
capable folks who want to help.
imagine you having a painting in your appartment. when you walk by in the morning, you have
a thought, a feel (bread and wine, thoughts can be winy as well though), when being there
again in the afternoon, you maybe pick up on that thought or feel (unknowingly).
this is you being connected through time and, depending on if you were to carefully check
the appartment from a holyday loction what you might have taken a pic of and put it in your
appartment, in realms. was there this kind of tree?
many such things, not exactly a burden, may change. that is a blue sort of wushie thing.
you did do homework back in school, but what exactly it was on what day is not only hard to
say, but not relevant to anything in your life, in most cases.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972629
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
855d1a No.19972630
>>19972614
your life sucks
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ccbb1f No.19972631
>>19972623
How he intends to own the boards. Why he hates (Well, mostly just really jealous) BO.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
600a4c No.19972632
>>19972204
actually legit notable.
Elon Musk
@elonmusk
Guys I found Q*
https://x.com/elonmusk/status/1728228308331249673?s=20
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.19972633
In the name of Jesus Christ, I cast out all demons who exist in this place.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972634
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972635
no no
let's make this the fucking normie place and accomodate normies…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
82b0e3 No.19972636
>>19972595
bullshit
someone filled in 17 trillion on a military compensation form from the intenet of DOJ website for veterans claiming damages from the military
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972637
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972638
>>19972633
yet if BO and BV's leave… who will steer the ship!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ccbb1f No.19972639
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2c2ac7 No.19972640
>>19972104
It was the only method to use just one bike.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972641
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972642
so you gonna hide the drops?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cafe23 No.19972643
>>19972614
> I hope they fucking die.
>
>And yes, God STILL adores me.
I thought God asks that you love your neighbor like yourself? You're prolly in line for a flogging.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972644
deny board history?
They want you divided.
Divided by religion.whoa! whoa! hang… hang on!
Divided by sex.free speech board
Divided by political affiliation.free speech board
Divided by class.free speech board
Timeline - 2018 to 2021 - the first 3 years of Q research from 4chan > 8kun
Former Board Owner Fast Jack is a Neo Nazi
Former Board Volunteer and Baker OSS is a Neo Nazi
Former Baker and OSS acolyte Animefagbaker is a Neo Nazi
OSS and Animefag were open about their Nazi tendencies yet one had to lurk into admin boards to find Fast Jack expressing his Nazi hatred of The Jewish Race via muh joo "kike, fucking kikes, all kikes should die" etc etc.
Neither Jim nor Codefaggot Ron ever expressed having any Problems or Concerns with this Fact. In fact, Laughter was the common response.
Notable: Little shill bitches just love to pretend that their muh joo shilling is why SPAM now… kek
FYI:
Neo Nazi's tend to be Catholic and/or Christian. Hitler was a confirmed Catholic yet this fact is hidden in History.
Neo Nazi's see themselves as "Defenders of the Faith" so any appeals to Logic and Reason versus Dogma are seen as personal attacks.
Neo Nazi's are not here to help or otherwise promote Q or Anons. They see Q as simply a vehicle where they will inject their ideology, grift and attempt to steer the flow of information.
Neo Nazi's wish to appear very PRO CHILDREN, ANTI ABORTION & PRO RELIGION yet many have been found to be quite the opposite and simply hiding behind Religion in order to spread their Hate, Evil.
Neo Nazi's are fond of Catholicism because Catholicism, like Christianity, has Racism built in. See: Good Friday Prayer for the Faithless Jews.
Neo Nazi's are attracted to POTUS because they believe POTUS is a racist, albeit secretly, and will thus promote policies which they agree with.
Neo Nazi's strive to get into command and control positions CCP as they believe that their influence can alter the outcome of the Plan!
Neo Nazi's have a powerful foothold in former Axis Power Japan.
Neo Nazi's from /pol/ make up the bulk of the Neo Nazis on Kun.
Neo Nazi's, like Law Enforcement, like to use the symbolism of St. Michael.
Neo Nazi's are funded by Soros. Soros, of course, takes orders from the "Eye of Providence" drop #133.
MORE FYI:
MUH JOO bots ran on 50-75 posts per bread.
MUH JOO shill team 6 ran the Kitchen most of the time.
MUH JOO bakers loved P = Payseur, Inthematrixxx > MG SHOW > Karli Bonne > Steve Bannon > Alex Jones > Jack Posobiec > Flynn et al.
MUH JOO bakers would let anything ANTI POPE FRANCIS in notes but they would fight fiercly to keep out any true criticism of the Vatican/Roman Catholic Church. Francis must be the Fall Guy.
MUH JOO bakers had to be pinned down in order for them to note the Vatican atrocities that were being exposed daily.
Q had to step in and Q these hard articles as these "Bakers" would flatly refuse. Split the bread, delete notes et al. they did everything in their power to stop the flow of Information.
Q Drop #4799 is one of these Drops. Read it. Anon was fighting with OSS late one night when Q Q'ed anon. MJ Fakers refused to note Pompeo's trip to the Vatican. Q saw it. Q knows…
Right when POTUS was blaming "CHINA WUHAN" daily for the Virus, these clowns were trying to hide and obscure the Fact that the Vatican had and was renewing a Condordat with China.
What does MUH JOO mean?
A MUH JOO shill is someone who believes or pretends to believe that the Jewish race and/or religion is responsible for most if not all atrocities ever committed.
A MUH JOO shill believes Hitler was a pretty cool dude.
A MUH JOO shill believes Palestine is the good guy in the Israel - Palestine conflict.
A MUH JOO shill does not like to consider radical islam > Iran as the potential main agitator in the Israel - Palestine conflict.
A MUH JOO shill desires to believe that no matter all the power in Europe that the Bauer > Rothschild family (Knights of Malta) subdued Europe via Banking. No really.
A MUH JOO shill believes that it was easy to see that it was the JOO this whole time and that does not bother them at all… that it was "easy to see".
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972645
heh
all of the đæmœns live on
тне enđ.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ccbb1f No.19972646
>>19972638
Yes, you need to lube up those squeaky wheels!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972647
lie to them in order to red pill them?
Remember when Q prayed the Roman Catholic Version of the "Our Father" or Pater Noster with anons in a drop about who financed 9-11?
Remember when Q posted drop #306 and asked "Why was the Lord's prayer posted? Which version? Why is this relevant? What just came out re: the Lord's prayer? What can be connected? & Do you believe in coincidences?
Remember when Q asked anons to "Re-review the map post relevant news drops." and "GODFATHERIII"?
Good! Because the following is what that looks like…
PATER noster, qui es in cœlis; sanctificetur nomen tuum: Adveniat regnum tuum; fiat voluntas tua, sicut in cœlo, et in terra.
Panem nostrum cotidianum da nobis hodie: Et dimitte nobis debita nostra, sicut et nos dimittimus debitoribus nostris: et ne nos inducas in tentationem: sed libera nos a malo.
Q !ITPb.qbhqo 11/14/2017 21:25:29 ID: wmN+33xv #154
4chan/pol: 149467690
Who financed 9-11?
Who was Bin Laden’s handler?
Why was the Clowns In America tasked to hunt/kill/capture UBL?
Why not MI?
If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?
Why wouldn’t we want to capture UBL alive and extract other possible T-level events?
Perhaps someday people will understand ‘they’ had a plan to conduct ‘another’ mass extinction event.
WWI & II - orchestrated and planned by select families?
Fantasy land.
Remember, the more people there are, the more power the people have.
Why do D’s push for gun control ‘directly’ after every tragic incident?
Why is this so very important to their agenda?
We, the people, are who they are afraid of.
We, the people, are who they fear will one day awake.
Our Father who art in heaven,
Hallowed be thy name.
Thy kingdom come.
Thy will be done
on earth as it is in heaven.
Give us this day our daily bread,
and forgive us ourtrespasses,
as we forgive those whotrespassagainst us,
and lead us not into temptation,
but deliver us from evil.
Q
Q !ITPb.qbhqo 12/09/2017 13:12:19 ID: 571cae#306
8chan/cbts: 60141
News unlocks map.
Future proves past.
Why was the Lord's prayer posted?
Which version?
Why is this relevant?
What just came out re: the Lord's prayer?
What can be connected?
Do you believe in coincidences?
Re-review the map post relevant news drops.
Godfather III.
Q
Dec 09, 2017 1:16:56 PM EST#307
Q !ITPb.qbhqo ID: 571cae No. 60172
Dec 09, 2017 1:13:29 PM EST
Anonymous ID: e60938 No. 60150
Dec 09, 2017 1:12:19 PM EST
Q !ITPb.qbhqo ID: 571cae No. 60141
News unlocks map.
Future proves past.
Why was the Lord's PRAYER posted?
Which version?
Why is this relevant?
What just came out re: the Lord's PRAYER?
What can be connected?
Do you believe in coincidences?
Re-review the map post relevant news drops.
Godfather III.
Q
>>60141
Tues Nov 4th,
Who financed 9-11?
Who was Bin Laden's handler?
Why was the Clowns In America tasked to hunt/kill/capture UBL?
Why not MI?
If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?
Why wouldn't we want to capture UBL alive and extract other possible T-level events?
Perhaps someday people will understand ‘they' had a plan to conduct ‘another' mass extinction event.
WWI & II - orchestrated and planned by select families?
Fantasy land.
Remember, the more people there are, the more power the people have.
Why do D's push for gun control ‘directly' after every tragic incident?
Why is this so very important to their agenda?
We, the people, are who they are afraid of.
We, the people, are who they fear will one day awake.
Our Father who art in heaven,
Hallowed be thy name.
Thy kingdom come.
Thy will be done
on earth as it is in heaven.
Give us this day our daily bread,
and forgive us our trespasses,
as we forgive those who trespass against us,
and lead us not into temptation,
but deliver us from evil.
Q
>>60150
The "marker."
Learn to read the map.
News unlocks the map.
Q
Dec 09, 2017 1:21:38 PM EST#308
Q !ITPb.qbhqo ID: 571cae No. 60201
Tangent.
Expand your thinking.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6b8c79 No.19972648
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
307815 No.19972649
>>19972595
>Grandma Hopium
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972650
YouTube embed. Click thumbnail to play.
Time is on my side.
I don't need to do shit but wait.
Qtaro
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
600a4c No.19972651
>>19972237
11/23/2023
2/23/2023
???????
profit
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972652
>>19972616
No. I was just mentioning what general walker did for nancy and had not realized that was him. I have that vid saved also. Never realized it was him til just seen't walker on his uniform. Not saying anything against transition to military power.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972653
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972654
the drops are available to all
in the same place you get them
ad nauseum
you are just a shithead
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972655
YouTube embed. Click thumbnail to play.
Track 01 "Bye Bye Babylon" - Album "Freedom" - Artist "White Heart"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
09c2f0 No.19972656
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972657
And when the time is right, I'm gonna fuck you motherfuckers up.
HISTORIC ASS WHOOPIN BACK ON THE MENU.
ENJOY YOUR SPOILS.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4289ab No.19972658
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972659
how does your expert method of saving the world work again? Q team sure didn't water down shit… glad you are smarter than Q team
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
03727f No.19972660
>>19971994
It's not the horse
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ccbb1f No.19972661
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972662
GLAD YOU ARE SMARTER THAN Q TEAM
This next piece is an old classic called "Holy fucking shit, what!?!".
What happened in SA will happen here, Asia, and EU.
Nov 05, 2017 1:12:48 AM EDT 87
Anonymous ID: v3eCc2tY No. 148022342
My signatures all reference upcoming events about to drop if this hasn't been caught on.
Snow White
GODFATHER III
Q
Nov 05, 2017 1:31:00 AM EDT 88
Anonymous ID: v3eCc2tY No. 148023976
Ten days.
Darkness.
Scare tactics (MSM).
D's falling.
R's walk-away/removed.
SA > US > Asia → EU
Disinformation is real.
Distractions are necessary.
Focus was US today while real happening in SA under same context (military control, martial law, missile strike (rogue) etc).
Necessary.
POTUS' Twitter attack (see above).
Important.
Why is this relevant?
What was the last Tweet by POTUS prior to SA?
Why is this relevant?
SA (1), US (2), Asia (3), EU (4).
Where is POTUS?
Why is this relevant?
Military operations.
Operators in US.
Snow White
The Great Awakening
GODFATHER III
Q
Nov 05, 2017 2:17:24 AM EST 95
Anonymous ID: cS8cMPVQ No. 148033178
What happened in SA will happen here, Asia, and EU.
Keep digging and keep organizing the info into graphics (critical).
God bless.
Hillary & Saudi Arabia
Snow White
GODFATHER III
Q
Q Links to Pope's Tweet on Human Trafficking
Q !!mG7VJxZNCI 30 Jul 2019 - 8:23:13 PM 3565
https://twitter.com/Pontifex/status/1156165039545606144
Godfather III
It's going to be BIBLICAL.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7615ce No.19972663
>>19972633
So let it be written. So let it be done.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972664
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df9110 No.19972665
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972666
>>19972657
Says the dumb ass that worships a creation, not the Creator, and admits it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972667
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972668
HEY DANIEL, WHY DUZ YUR TEMPLE DIED OF SINS HAVE BYG FURNACE
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ccbb1f No.19972669
>>19972659
Squeaky stuttering!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972670
SO BASICALLY YOU CAN SHOVE YOUR SOFT TRAITOR LIES UP YOUR HARD TRAITOR ASSES… YES YOU CAN, KAREN!!!
POTUS recently stated that he has learned a lot fromBad Past Advisors
The following information is this Anon's current opinion based upon the Personal History of these individuals and what the Drops seems to indicate.
RetruthsJack Posobiec
Posobiec appears to have been Flipped yet his History will not be forgotten.
There are multiple Q posts specifically about the "at that time, apparent" Traitor Jack Posobiec…
RetruthsSteve Bannon
Sloppy Begs Bad Steve Bannon cried like a dog when POTUS fired him < POTUS own words.
Steve Bannon says that "Alex Jones is the greatest political thinker of this century".
There are Multiple Q posts concerning the Traitor Alex Jones.
Steve Bannon was pardoned by POTUS after stealing money from Patriots via a "Build the Wall" fundraiser.
Bannon appears to have been Flipped yet his History will not be forgotten.
RetruthsGeneral Flynn
Alex Jones and Flynn spent an entire show putting POTUS down for his actions on Jan 06. "RECKLESS".
Flynn ended the show with "I could be the worst nightmare to a guy like Trump".
Alex Jones has stated several times that POTUS must be one of the most evil people on the planet for allowing the Vax and pushing Warp Speed.
Flynn called for One Religion in the United States which is without a doubt, division by Religion.
There are multiple Q posts warning Anons specifically about Alex Jones and Associates.
Retruths/retweetsTaylor MarshallandArchbishop Vigano
Both Vigano and Taylor Marshall turned on POTUS over POTUS' LGBTQ party at Mar a Lago. December 22 2022.
Vigano, Taylor Marshall and George Neumayr simultaneously attacked POTUS over his stance on LGBTQ which they knew about years ago.
Taylor Marshall went so far as to suggest Romans Chapter 1 says that anyone who condones the LGBTQ lifestyle is Worthy of Death.
Taylor went on to suggest that a Catholic Monarchy in the United States is the only way to solve the U.S. political problems.
RetruthsKarli Bonneof Inthematrixxx > P = Payseur and Midnight Rider fame.
There are multiple Q posts concerning P and [P] and none of them seem to suggest anything other than the Pope/Papacy/Pontifex.
There are multiple Q posts concerning and condemning those who Profit off of this movement.
There are multiple Q posts warning Anons to be "Careful who you follow."
There are multiple Q posts warning Anons specifically about Alex Jones and Associates.
YetJeffy Pederson > Karli Bonne > INTHEMATRIXXX > The MG Showclaim to fame was the story told by the Alex Jones Associate Fritz Springmeier aka Viktor Schoof > P = Payseur.
Also of note is the FACT that David Icke, another long time friend and Associate of Alex Jones, also mentions the Payseur tale.
Search the drops for the name Payseur and it becomes quite obvious that Q acknowledged the Question yet never followed up on it again and Q has never said Payseur… no more clues, hints nothing…
Oddly enough, in a drop concerning the Guardians of the Pope, Q named the Owl Image "Guardian_P". Isn't that an amazing coincidence?
Of special note is the FACT that it took Alex Jones 13-14 years to finally "investigate" the Vatican and when he did, he went to Italy to join a Guide.
This guide told Alex about some of the lesser Vatican crimes to which Alex was always "shocked" and "surprised" concerning as if Alex knew nearly nothing about the Vatican previously.
Maybe Alex Jones does "work" for more than Mossad? as per the drops.
One thing Anons may learn is that many of these "pro maga" and "pro Q" people, really do not seem to like the drops.
But wait! There is so much more!
Other notable Luminaries on "Our Side" include:
Tucker Carlson - Good friends with Hunter Biden who wrote Tucker's son Buckley a letter trying to help Buckley gain admission into the Catholic Jesuit Georgetown University.
Rush Limbaugh - Neo Con (Rino) piece of shit is what Rush was. Rush backed the Neocon Bush Regime 100%.
Roger Stone - Pffffffft!
Sebastion Gorka - There are Drops concerning Sebastion and his Wife. "Q is garbage!".
Ted Cruz - Just stop it!
Fox News in general because POTUS twatted and retruthed Fox much more than any other MSM - Do you think Rupert Murdoch is Jewish and thats the end of the story? Papal Knight? Hires 90%+ "Catholics"?
Steven Miller - bwahahahahahahahahaah!
Dinesh - muahahahahahahahahahahahah!
POTUS MOST KEK ENDORSEMENTS
Ron Desanctimonious
Lindsey Graham
Mitch McConnell
Update:
Dan Scavino recently posted "P" in the context of "President".
Maybe Dan should read Drop #1413, 1950 and 1951?
Let an Anon know if you need those drops decoded!
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972671
OH YES YOU CAN TRAITOR
Remember when Q prayed the Roman Catholic Version of the "Our Father" or Pater Noster with anons in a drop about who financed 9-11?
Remember when Q posted drop #306 and asked "Why was the Lord's prayer posted? Which version? Why is this relevant? What just came out re: the Lord's prayer? What can be connected? & Do you believe in coincidences?
Remember when Q asked anons to "Re-review the map post relevant news drops." and "GODFATHERIII"?
Good! Because the following is what that looks like…
PATER noster, qui es in cœlis; sanctificetur nomen tuum: Adveniat regnum tuum; fiat voluntas tua, sicut in cœlo, et in terra.
Panem nostrum cotidianum da nobis hodie: Et dimitte nobis debita nostra, sicut et nos dimittimus debitoribus nostris: et ne nos inducas in tentationem: sed libera nos a malo.
Q !ITPb.qbhqo 11/14/2017 21:25:29 ID: wmN+33xv #154
4chan/pol: 149467690
Who financed 9-11?
Who was Bin Laden’s handler?
Why was the Clowns In America tasked to hunt/kill/capture UBL?
Why not MI?
If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?
Why wouldn’t we want to capture UBL alive and extract other possible T-level events?
Perhaps someday people will understand ‘they’ had a plan to conduct ‘another’ mass extinction event.
WWI & II - orchestrated and planned by select families?
Fantasy land.
Remember, the more people there are, the more power the people have.
Why do D’s push for gun control ‘directly’ after every tragic incident?
Why is this so very important to their agenda?
We, the people, are who they are afraid of.
We, the people, are who they fear will one day awake.
Our Father who art in heaven,
Hallowed be thy name.
Thy kingdom come.
Thy will be done
on earth as it is in heaven.
Give us this day our daily bread,
and forgive us ourtrespasses,
as we forgive those whotrespassagainst us,
and lead us not into temptation,
but deliver us from evil.
Q
Q !ITPb.qbhqo 12/09/2017 13:12:19 ID: 571cae#306
8chan/cbts: 60141
News unlocks map.
Future proves past.
Why was the Lord's prayer posted?
Which version?
Why is this relevant?
What just came out re: the Lord's prayer?
What can be connected?
Do you believe in coincidences?
Re-review the map post relevant news drops.
Godfather III.
Q
Dec 09, 2017 1:16:56 PM EST#307
Q !ITPb.qbhqo ID: 571cae No. 60172
Dec 09, 2017 1:13:29 PM EST
Anonymous ID: e60938 No. 60150
Dec 09, 2017 1:12:19 PM EST
Q !ITPb.qbhqo ID: 571cae No. 60141
News unlocks map.
Future proves past.
Why was the Lord's PRAYER posted?
Which version?
Why is this relevant?
What just came out re: the Lord's PRAYER?
What can be connected?
Do you believe in coincidences?
Re-review the map post relevant news drops.
Godfather III.
Q
>>60141
Tues Nov 4th,
Who financed 9-11?
Who was Bin Laden's handler?
Why was the Clowns In America tasked to hunt/kill/capture UBL?
Why not MI?
If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?
Why wouldn't we want to capture UBL alive and extract other possible T-level events?
Perhaps someday people will understand ‘they' had a plan to conduct ‘another' mass extinction event.
WWI & II - orchestrated and planned by select families?
Fantasy land.
Remember, the more people there are, the more power the people have.
Why do D's push for gun control ‘directly' after every tragic incident?
Why is this so very important to their agenda?
We, the people, are who they are afraid of.
We, the people, are who they fear will one day awake.
Our Father who art in heaven,
Hallowed be thy name.
Thy kingdom come.
Thy will be done
on earth as it is in heaven.
Give us this day our daily bread,
and forgive us our trespasses,
as we forgive those who trespass against us,
and lead us not into temptation,
but deliver us from evil.
Q
>>60150
The "marker."
Learn to read the map.
News unlocks the map.
Q
Dec 09, 2017 1:21:38 PM EST#308
Q !ITPb.qbhqo ID: 571cae No. 60201
Tangent.
Expand your thinking.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cc6557 No.19972672
>>19972574
"no es su cuerpo"
brilliant!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972673
IF YOU COULD ONLY DELETE THE DROPS THOUGH HUH BIG PATRIOT?
ANONS MOST RECENT Q
Q DROP #4799
Q !!Hs1Jq13jV6 09/30/2020 23:52:42 ID: 376386 4799
8kun/qresearch: 10864489
Anonymous 09/30/2020 23:43:23 ID:39774c
8kun/qresearch: 10864305
Image Name: 09302020nyt1.png
Filename: 08e41859ca2515db376999299074104a284701075e774fa4c4ab36b1ebe9d5d8.png
Rebuffed by Vatican, Pompeo Assails China and Aligns With Pope’s Critics
Pope Francis declined to see Secretary of State Mike Pompeo, who is demanding a harder Vatican line on China. The Holy See said meeting just before a U.S. election would be inappropriate.
By Jason Horowitz and Lara Jakes
Sept. 30, 2020, 7:26 p.m. ET
ROME — Secretary of State Mike Pompeo recently published a sharp letter excoriating the Vatican’s plans to renew an agreement with the Chinese government on Church operations in China. He promoted the article in a tweet, concluding, “The Vatican endangers its moral authority, should it renew the deal.”
An indignant Vatican took the article more as a calculated affront than a diplomatic gesture. The friction broke into the open on Wednesday as Mr. Pompeo arrived in Rome and met with prelates and others who are hostile to Pope Francis, while the Vatican denied him a meeting with the pontiff and rebuffed his efforts to derail the deal with China.
“Pompeo asked to meet” the pope, who turned him down because Francis had “clearly said that he does not receive political figures ahead of the elections,” Cardinal Pietro Parolin, who, as secretary of state, is the Vatican’s second-ranking official, told reporters.
But to some observers on both sides of the tensions between the Roman Catholic Church and the Trump administration, Mr. Pompeo’s visit is as much about the coming presidential election as about China policy. Mr. Pompeo dismissed that suggestion as absurd, but intended or not, his trip signals that President Trump is on the side of those conservative American Catholics who worry about the church’s direction under Francis and think he is soft on China.
Francis and Mr. Trump, who have exchanged sharp words in the past, present starkly different visions on issues ranging from the environment to immigration to the threat of populism. In appealing to the Vatican’s support for religious freedom as a reason to drop its China agreement, Mr. Pompeo seemed to seek common ground, but in a way that upset the pope’s chief allies and delighted his chief critics.
Cardinal Parolin said Mr. Pompeo’s article had caused “surprise” at the Vatican, because this visit to Rome by the secretary and the meetings with high officials at the Holy See had already been in the works and would have been a “more opportune” forum for airing grievances. He added that Mr. Pompeo’s choice to publish in First Things, a conservative Christian magazine that has called Francis a failure as Pope, also mattered.
https://www.nytimes.com/2020/09/30/world/europe/pompeo-pope-francis-china.html
>>10864305
When does a Church become a playground?
When does a Church become a business?
When does a Church become political?
When does a Church become corrupt?
When does a Church become willfully blind?
When does a Church become controlled?
Q
OH WAIT! The re up of the "Secret Vatican > China Accord" was breaking right when POTUS started yelling "CHINA CHINA CHINA FLU WUHAN FLU CHINA CHINA CHINA!".
For 2 weeks anon tried to get this into notes.
POTUS just screaming Wuhan China!
No BAKER would note it.
None… Except maybe Gerb! Love you Punk! No Homo!
Understand?
and right when anon is whooping the piss out of a fucking blatant Neo Nazi allowed not only to bake but BV HERE!
Q drops down and Q's Anon…
OSS was fucking livid…
It was GloriousAF and still is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972674
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972675
BIG PATRIOT
Timeline Spring/Summer 2018
The Honeymoon and any major doubts behind the validity of the Q op was over. Free Souls came in droves.
As well as useful idiots like moths to a flame.
The enemy took note and sent their best as well.
Little did anyone know that the final resting place for Qresearch would be a board owned by a Neo Nazi yet they would soon find the fuck out.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a98f91 No.19972676
>>19972333
Kamala doing wieners…cooking w gas.
She's got gas stoves inside and out.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972677
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7615ce No.19972678
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972679
YouTube embed. Click thumbnail to play.
TIME.
I CAN WAIT IT OUT.
YOU CAN'T.
YOU WILL PANIC
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972680
>>19972669
IMAGINE… THEIR BEST THOUGH
armed to the teeth with the most excellent memes and come backs!
kek!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972681
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
600a4c No.19972682
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972683
>>19972676
beggin for a w_dgie
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.19972684
Chuck Callesto
@ChuckCallesto
1h
JUST IN: Newly elected Argentinian President Javier Milei meets with producer of The Sound of Freedom Eduardo Verástegui who is RUNNING FOR PRESIDENT OF MEXICO.
The two just signed an agreement to work together to ERADICATE child sex trafficking.
Eduardo Verástegui
Nov 25, 2023 · 1:37 AM UTC
https://twitter.com/ChuckCallesto/status/1728226481619476864
>>19972569
>>19972574
NCSWIC.
Nothing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972685
>>19972545
niggas probably out celebrating
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972686
>>19972636
>>19972605
>>19972598
Trump took the gold from the Vatican, so IDK. Honestly, I didn't listen to it, kmao.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bdef93 No.19972687
>>19972632
Opus One Winery
Winery located in California
Opus One Winery is a winery in Oakville, California, United States. The wine was called napamedoc until 1982 when it was named Opus One. The winery was founded as a joint venture between Baron Philippe de Rothschild of Château Mouton Rothschild and Robert Mondavi to create a single Bordeaux style blend based upon Napa Valley Cabernet Sauvignon. It is located across State Route 29 from the Robert Mondavi Winery. The creation of this winery venture in 1980 was big news in the wine industry; de Rothschild's involvement added an air of respectability to the burgeoning Napa wine region. The first vintage, 1979 was released in 1984 at the same time as the 1980 vintage. For a while it was the most expensive Californian wine, and to date still ranks among the most expensive red wines produced in the Napa Valley, with the 2014 vintage retailing for $325 per bottle. In 1989 a new winery was built just down the road, the first vintage from the new winery was from 1991 and was released in 1994.
Since 1993, they have produced a second wine, Overture.
More from Wikipedia
Wikipedia text under CC-BY-SA license
$395.00
Opus One Napa Valley 2004 750ml
Add to Wishlist
Current Stock: 3
SKU: 5390
Variety: Cabernet Sauvignon
Vintage: 2004
Size: 750ml
WA: 96
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9b4433 No.19972688
>>19972681
>>19972682
big patriots! the children though!!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b08836 No.19972689
>>19972333
Gas comma - source of anti-sementism
Firing up the holocaust
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972690
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86bb0a No.19972691
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972692
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972693
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df9110 No.19972694
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972695
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
600a4c No.19972696
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0ff3c0 No.19972697
>>19972652
>Not saying anything against transition to military power.
Here's a head scratchier for me.
My sister was battling cancer in 1999, undergoing chemo. She also took the jabs and boosties.
She's in perfect health today.
I don't personally know anyone that was gravely affected by COnVID 19. I still can't tell if the entire thing was completely fabricated. I've only had peopple online tell me things and people I know in public loosely attributing occurrences to the clot shots. The whole thing seems fucky wucky to me.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
86bb0a No.19972698
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972699
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972700
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972701
YouTube embed. Click thumbnail to play.
drive thru juw pork face job communism
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972702
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972703
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f51125 No.19972704
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972705
YouTube embed. Click thumbnail to play.
creepypasta fachionista gaggin on own drive thru pork face job
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972706
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972707
A deeper dive into Lucius trust. Who is Alice Bailey and what is the connection to the UN?
https://rumble.com/v3wzoo7-black-magic-and-the-nwo-the-courtenay-turner-radio-hour.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cc6557 No.19972708
>>19972684
wow, what he said about El Papa!
He said it out loud, and clear as a bell, what most Catholics know and are just biding their time till the guy is no longer pope . . .
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972709
Notables
#24519 >>19971984
>>19972684 Newly elected Argentinian President Javier Milei meets with producer of The Sound of Freedom Eduardo Verástegui who is RUNNING FOR PRESIDENT OF MEXICO.
>>19972573 RE: GENEVA 'SUGGESTIONS' FOR ISRAEL: How hospitals became ‘fair game’ in Gaza | The Listening Post
>>19971999 @thejimwatkins Wouldn't you like to be a pepper too.
>>19972216 @elonmusk Guys I found Q*
>>19972206 Study Reveals More than Half of COVID-19 Vaccinated Feel Sick a Year Later - Naveen Athrapully
>>19972147 Nevada judicial corruption: Washoe County, and the stunning disregard shown by the judge (Russell).
>>19972199 Tennessee: 10 men charged after 2-day undercover human trafficking investigation
>>19972220 PF: FORTE10 USAF RQ-4 Global Hawk 10-2045
>>19972258 The EU could be facing another departure from the bloc, as the new President of the Netherlands is eyeing plans to leave the bloc.
>>19972287 Analysis of Pinal County’s 2022 Election, ‘Deliberate Malfeasance,’ Concludes Election Should Not Have Been Certified
>>19972318 ON THE LOTUS EATERS, GROK, ELON MUSKS NEW A.I PLUS ITS CONNECTIONS THE U.N AND THE W.E.F
>>19972381 Irish Lives Matter
>>19972414 The housing market has hit 'rock bottom' and the sales slump will last a long time, Redfin CEO says
>>19972422 Biden impeachment inquiry continues to build momentum
>>19972430, >>19972483 CHALLENGE: Terminology to quash stereotypes while still calling out the combative subgroups.
@650
sorry for only two drops this bread…
baker had a lot on his mind
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972710
it is observation
not opinion
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7615ce No.19972711
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
588a11 No.19972712
>>19972708
99% of catholics dont know
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
600a4c No.19972713
>>19972562
thank you for posting so much from 1 IP. I can make the bread much cleaner just by filtering you .
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972714
YouTube embed. Click thumbnail to play.
inked soy goy prepares for two in the cake hole all DRUK AF
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df9110 No.19972715
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972716
https://annas-archive.org/search?q=alice+bailey
Ho Hum…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
02c912 No.19972717
>>19972048
Sure the tunnels under the hospital are for Hospital operations, a dank, dark and dirty, just like a hospital. Why did you really build the tunnels Israel? Are you actually Hamas? not that you ever lie about who you are, white, Khazar, Little girl writing in her diary, holocaust victim, artist in the twin towers using free space, not dancing on 911. Shall we play this game?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972718
YouTube embed. Click thumbnail to play.
>>19972714
>inked soy goy prepares for two in the cake hole all DRUK AF
nigggahy lurnd it frum watchin soy goy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972719
Dear Dr. Jan Halper-Hayes.
The Anons would appreciate it if you sauce all your claims, bc you sound like a conspiracy theorist Qanoner to them. Thank you.
(Not me, I believe you … unfortunately or not, but the Anons are reeeeeally smart.)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972720
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ac8c27 No.19972721
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972722
YouTube embed. Click thumbnail to play.
seasonal exotic juw pork handjobs mystery persists
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972723
>>19972715
Noice
Still trying to get this one to come out right….
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972724
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
90ddca No.19972725
>>19972717
shut the fuck up.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
057c9b No.19972726
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972727
Use your personalized bread banner for more fame-fag effect.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972728
Run some more psyops you stupid Fucks.
I'll take the punch and get stronger just like I have EVERY SINGLE TIME.
YOUR TIME IS JUST ABOUT UP.
SCREAM YOUR WAY OUT PUSSY ASS MOTHERFUCKIN LOSERS.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0aa9d2 No.19972729
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972730
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
195d50 No.19972731
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972732
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972733
I'll spend the rest of my life lmao at how retarded you were.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972734
>>19972712
Unfortunately,
Catholicism is a cult.
Albeit, some Catholics actually manage to be Christians.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ed527 No.19972735
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972736
YouTube embed. Click thumbnail to play.
bizarr fayk juw ritual ceremony in plain sight
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
02c912 No.19972737
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
90ddca No.19972738
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7615ce No.19972739
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
057c9b No.19972740
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972741
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
be8ed1 No.19972742
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972743
Notables
#24519 >>19971984
>>19972684, >>19972574 Newly elected Argentinian President Javier Milei meets with producer of The Sound of Freedom Eduardo Verástegui who is RUNNING FOR PRESIDENT OF MEXICO.
>>19972573 RE: GENEVA 'SUGGESTIONS' FOR ISRAEL: How hospitals became ‘fair game’ in Gaza | The Listening Post
>>19971999 @thejimwatkins Wouldn't you like to be a pepper too.
>>19972216 @elonmusk Guys I found Q*
>>19972206 Study Reveals More than Half of COVID-19 Vaccinated Feel Sick a Year Later - Naveen Athrapully
>>19972147 Nevada judicial corruption: Washoe County, and the stunning disregard shown by the judge (Russell).
>>19972199 Tennessee: 10 men charged after 2-day undercover human trafficking investigation
>>19972220 PF: FORTE10 USAF RQ-4 Global Hawk 10-2045
>>19972258 The EU could be facing another departure from the bloc, as the new President of the Netherlands is eyeing plans to leave the bloc.
>>19972287 Analysis of Pinal County’s 2022 Election, ‘Deliberate Malfeasance,’ Concludes Election Should Not Have Been Certified
>>19972318 ON THE LOTUS EATERS, GROK, ELON MUSKS NEW A.I PLUS ITS CONNECTIONS THE U.N AND THE W.E.F
>>19972381 Irish Lives Matter
>>19972414 The housing market has hit 'rock bottom' and the sales slump will last a long time, Redfin CEO says
>>19972422 Biden impeachment inquiry continues to build momentum
>>19972430, >>19972483 CHALLENGE: Terminology to quash stereotypes while still calling out the combative subgroups.
>>19972707, >>19972716, >>19972692 A deeper dive into Lucius trust. Who is Alice Bailey and what is the connection to the UN?
@680
last call if mist
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972744
YouTube embed. Click thumbnail to play.
really horny niggfags seen praying to CIA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
02c912 No.19972745
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df9110 No.19972746
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972747
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972748
ABSOLUTELY NO ONE GIVES A FUCK ABOUT YOUR FAKE ASS REALITY.
HAHAHAHAHHAHAHAHAHA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972749
>>19972728
Real Osiris would never say such things in such a way.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a63074 No.19972750
YouTube embed. Click thumbnail to play.
https://youtu.be/wiurT26nBsM
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f5eca6 No.19972751
Rumble embed. Click thumbnail to play. ==(Scotty Mar10) Cliff Edwards - It's Only a Paper Moon=
6:43
https://rumble.com/embed/v3v1unm/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972752
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972753
>>19972631
looks pretty owned.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972754
Fake bakers are fake anons
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972755
>>19972734
>some Catholics actually manage to be Christians.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972756
>>19972749
THEN YOU SHOULD ASK YOURSELF WHO THE FUCK I AM THEN.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972757
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cc6557 No.19972758
>>19972748
> 77392d
got some anger issues do you?
when some of us don't hate you and prayed for you and . . .
anyway I still love you anjel.
if you were really magic why didn't you ever fly outside my window at 3AM and send some lightning bolts and wake me up and take me for a flight off into the hither-roo?
I kept thinking you would.
but you didn't. I was very disappointed.
end of ridiculous message to guy who will be deleted from the bread
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972759
>>19972756
I've met Osiris. And i know Jesus. You are neither. But we can find out all the same.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
258ed2 No.19972760
>>19972290
That’s terrible news.
He’s an innocent man.
Maybe (((they’ll))) move him to a safer facility?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
057c9b No.19972761
>>19972740
Let's see how many IPs you'll use use defending your gay as fuck famefagging.
No one is buying your faggotry.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
77392d No.19972762
You're gonna wish I was motherfucker.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
108deb No.19972763
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972764
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ab9fed No.19972765
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d43c1 No.19972766
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972767
You'll just have a bad night…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
02c912 No.19972768
>>19972747
stupid meme no sauce.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f5eca6 No.19972769
https://x.com/gregg_re/status/1728240297233314030?s=20
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972770
In the PENDTAGON DOD NURSERY OVERSIGHT OFFICE THERE"S A HAMAS TUNNEL UNDERNEATH LOOK WHAT WAS FOUND IN A CHILDRENS NURSERY BEFORE IT BLEW ITSELF UP!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d9dd55 No.19972771
>>19972206
I know two people now who've been vaxxed who out of the blue got a case of hives.
Is that a reaction from getting the vax?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972772
Potentially real bad.. depending on the next move.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b08836 No.19972773
>>19972574
>>19972573
Murder murder murder
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7615ce No.19972774
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972775
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d43c1 No.19972776
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972777
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
057c9b No.19972778
>>19972760
>He’s an innocent man.
Ya reckon?
Anon reckons he's an actor in a media kayfabe.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
108deb No.19972779
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972780
Board owner is a mentally a juvenile.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32cead No.19972781
>>19972719
Also, Dr. Jan, could what Anons call
>hopium
be cognitive dissonance? I'm really asking bc I feel like that's what it is with me, but I'm not skird to believe, so I tell myself my disbelief is cognitive dissonance and I run with the hopium, with is the substance of things prayed for, the evicthe evidence of things not seen. (Book of Kek/ Chapter: Spiritual Battle 11:1-6)
ThanQ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
02c912 No.19972782
>>19972768
makes notables
meme
>>19971543 THERE'S A HAMAS COMMAND CENTER UNDER THE IRS BUILDING!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972783
>>19972768
LOOK!
you can see the HAMAS TUNNEL ENTRANCE and the HAMAS FLAGS! right there in the photo.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e40bb1 No.19972784
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d43c1 No.19972785
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972786
>>19972756
dude
get yur faggot asshole to theRAPEy
an get pills
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0021dd No.19972787
19972670
why
19972671
so
19972673
needy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972788
>>19972784
Is that the guy from American Psycho? If so, not taking that advice.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2c2ac7 No.19972790
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0aa9d2 No.19972791
>>19972729
BV will delete this
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972792
Down with fame fag fake anons.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
108deb No.19972794
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972795
All Board Admins are comped soul-selling fakes.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d43c1 No.19972796
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
908b96 No.19972797
Anons who need fame are not anons Banner Fakes ETC.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
108deb No.19972798
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c0e585 No.19972799
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ec8e2 No.19972800
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
051b92 No.19972801
LOOK RED TERROR HAMAS HAS JOINED TUNNELS UNDERNEATH STARBUCKS DEI HEADQUARTERS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d314fd No.19972803
i don't
'covet neighbors'
@ken
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
108deb No.19972804
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
90ddca No.19972805
>>19972131
slanty eyes and yellow hands made this.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d43c1 No.19972806
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5b1da0 No.19972807
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
108deb No.19972808
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
057c9b No.19972809
>>19972775
This your main IP. When do you launch the defensive rest?
Or are you going to pretend you only run one this bread?
Obvious faggot is obvious.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cc6557 No.19972810
>>19972756
we know who you are
don't be a jerk and stop putting your name as 'Christ', can you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d43c1 No.19972811
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
108deb No.19972812
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
