43ff74 No.20033334 [Last50 Posts]
Welcome to Q Research General
We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.
"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."
VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH
Q's Latest Posts
>>18284019 Nov. - Dec. 2022
Q's Private Board
>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6
Find Q drops here
Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku
Q Posts Archives
* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u
* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app
* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news
* Q Raw Text Dumps: q-clock.com/q_raw.txt
* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/
* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188
* Q Research Notables: Archive Board >>>/qnotables/
* Q Adjacent infographs and moar: https://deepstatemappingproject.com/
Q Research Board
Key Resources below; ck Dough Resource thread for more: >>17225239
New to QR?
>>17240320, >>17238117 Intro, Board Info, Offsite Bunkers, Optics
>>17238430 Suggested Follow | >>17240363 Information Tools & Services
Threads
>>17253611 Dedicated resource threads
>>17242392 Q Encyclopedia by ArchiveAnon | >>17242386 Q Video Archive by ArchiveAnon
Join Us
>>17322518 E-BAKE instructions | >>17322509 LEARN TO BAKE
>>17240554 Meme Requests | LEARN MEME WARFARE https://archive.is/2iZX1
TOR Access
TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html
TOR Banner: https://www.youtube.com/watch?v=MLCupx1UExg
____________________________
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43ff74 No.20033335
International Q Research Threads
>>19822242 ——–——– Australia #33
>>19911841 ——–——– Canada #49
>>16694358 ——–——– France #7
>>19988670 ——–——– Germany #106
>>19930440 ——–——– Japan #20
>>16694250 ——–——– Nederland #10
>>17784579 ——–——– QAJF #1
>>17352350 ——–——– Scotland #8
>>19636057 ——–——– South Africa #12
>>19804572 ——–——– UK #51
GLOBALS
Bunker = https://endchan.org/qrbunker/
>>20022853 Posting Guidelines
>>19832150, >>19957123, >>19737197 SPAM Removal
>>19892843, >>19892919, >>19893052 Jim W's response to mass deletions of off-topic posts
>>19089056 Ban lifts, video downloads, Q clock, Joe M's videos, Qagg Download
>>18024378, >>18561054 Updated PROTO Instructions
>>20017667 Reporting CP when none exists violates 8kun rules
BAKERS
>>19089065 Baking Tools & Guidelines - NEW BAKERS, PLEASE READ
>>17322509, >>17322518 How to bake/e-bake
>>17835052 Formatting Q posts
No discrimination on the basis of race or religion in notes, they will be removed
Sign out clearly even when e-baking or ghosting, use RED TEXT
NOTABLES ARE NOT ENDORSEMENTS
#24589 >>20032503
>>20032512 The President of Venezuela, Nicolás Maduro has announced tonight that the Esequiba Region of Western Guyana is now “Official” a Territory of Venezuela
>>20032549 IRS whistleblower confirms Hunter Biden received nearly $5 million from donor for personal expenses
>>20032660, >>20032826 ARCHIVING - HANNITY TOWN HALL WITH TRUMP ON THE 5TH DEC 2023 !!
>>20032703 DJT - It was great to stop by and see everyone at the Front Street Pub & Eatery in Davenport, Iowa tonight. THANK YOU---MAGA!!!
>>20032729 Joe Biden Used Fake Name To Exchange Over 50 Private Emails With Hunter Biden’s Business Associate, Docs Show
>>20032741 PF Report
>>20032846 Kelsey Grammer’s BBC interview cut short after being ‘perfectly happy’ to show support for Trump
>>20032886 Japan adds Chinese nuclear weapons lab and 35 others to WMD concern list
>>20032961 DJT Truth
>>20032985 DJT Truth - CROOKED JOE BIDEN IS A THREAT TO DEMOCRACY!!!
>>20033059 PF reports: 57-1483 KC-135 tanker over western Iraq at refueling altitude-26k Ft
>>20033083, >>20033084 Donald J. Trump speaks with Hannity at town hall event, predicts Biden won't be the Democrat nominee
>>20033094, >>20033100, >>20033102 Questioning Wray on FBI's efforts into Epstein case, Hunter laptop and more "The people need to know who was on those planes" - mp4s
>>20033170 Indications that some stock traders knew about the Hamas attack on Israel in advance and made millions on the inside
>>20033183 Kevin McKernan loses entire database of Barry Young's leaked research after NZ health service obtains an injunction to prevent sharing of leaked Covid vax health data
>>20033290 WEF planned water crisis reminder
>>20033331 #24589
#24588 >>20031703
>>20031726 Kash Patel: We're Gonna Use The Constitution To Prosecute Those Destroying The Republic.
>>20031790 Julie Kelly: "Where are these tapes on all the interviews, depositions, witness testimony of more than a 1,000 held, did they disappear?
>>20031765 Rep. Bob Good: "The two greatest threats are the snowballing debt and the border invasion"
>>20031818, >>20032132 PF Reports
>>20031832 Evidence that Special Counsel Jack Smith intends to introduce at Trump's DC trial
>>20031839 Statement from resident Joe Biden on the Death of American Service Members
>>20031852 Letter to the Speaker of the House and President of the Senate on an Agreement with the Republic of the Marshall Islands
>>20031860 Letter to the Speaker of the House and President of the Senate on an Agreement With the Federated States of Micronesia
>>20031868, >>20031881 Readout of National Security Advisor Jake Sullivan’s Meeting with Prime Minister Andrew Holness of Jamaica
>>20031876 resident Biden Transmits Compacts of Free Association-Related Agreements to U.S. Congress
>>20031898 World's First Factory for Humanoid Robots Coming
>>20031915 Statement from resident Joe Biden on Lift of Senator Tuberville’s Blockade on Military Appointments
>>20031931 Readout of National Security Advisor to the Vice President Phil Gordon’s Trip to Israel
>>20031937 Assistant Secretary of Defense Christopher P. Maier Addresses Crucial Role of Irregular Warfare at the Semi-Annual Irregular Warfare Forum
>>20031957 Here are some notes from the first J6 Video
>>20031962 DOD Awards $23.4 Million to Expand Domestic Capability to Upcycle Scrap Material into High-Grade Metal
>>20031965 Statement From Secretary Lloyd J. Austin III on the Senate's Confirmation of 425 General and Flag Officers
>>20031991 Trump Media drops Nextstar from defamation suit over 'falsely' reporting Truth Socials financials
>>20032007 Conor McGregor might be stepping into the political octagon to run for office
>>20032057 NASA Currently Tracking 20,000 Or More Near-Earth Asteroids
>>20032061 S.C. dropping Disney from state investment portfolio
>>20032111 RNC Issues Lawsuit Warning. Alleges Irregularities in Nevada’ Voter Rolls
>>20032149 Josh Hammer Joins WarRoom To Discuss COP 28 And Why It Is Being Underreported.
>>20032174 Readout of Joint Task Force Alpha Summit
>>20032300, >>20032328 A Federal Judge in DC issues ORDER in a case regarding the FBI raids.
>>20032306 Defense Secretary Warned Congress U.S. Troops Could Be Deployed If Ukraine Aid Is Not Sent
>>20032310 Moscow still ready for talks with Kiev – Kremlin (RT)
>>20032342 Putin's Saudi Visit To Talk OPEC+ Cuts & Gaza War Highlights US Failure To Isolate Russia
>>20032361 White House Sanctions Israeli Settlers For 1st Time Since Clinton Administration
>>20032484 #24588
#24587 >>20030904
>>20030918 Rep. Elise Stefanik files ethics complaint against judge in Trump’s civil fraud trial
>>20031043 Republicans in the Senate Suddenly Take Strong Stand on the Border and Illegal Immigration in Exchange for Funding Ukraine
>>20031053 Assistant AG for Civil Rights Claims Ignorance on the ‘Most Massive Attack on Free Speech in US History’ Case — Missouri v. Biden Case
>>20031120 Congresswoman Jasmine Crockett calls Texas and Florida “deplorable states”
>>20031176, >>20031190, >>20031201, >>20031204 New York State Unified Court System
>>20031240 Pelosi - California takes great pride in our ambitious status as the leading edge of high-speed rail in America.
>>20031276 Tucker Carlson Explains Why You'll Never Get an Apology for What Happened During COVID
>>20031351 @Jim_Jordan and @RepLoudermilk Launch Inquiry into Fani Willis Colluding with the January 6 Committee
>>20031373 Moody's puts China on downgrade warning as growth, property pressures mount
>>20031389 Gov. Gavin Newsom cancels the annual Christmas tree lighting in the State Capitol
>>20031441 US House Speaker issues Ukraine ultimatum to Biden (RT)
>>20031557 Secretary Blinken to Participate in a Conversation At the U.S. Global Leadership Coalition 2023 Tribute Celebration Department of State
>>20031688 #24587
#24586 >>20030094
>>20030146 EXCLUSIVE: GOP-Led States Demand Major Firms Stop Backing Efforts To ‘De-Bank’ Conservatives
>>20030200 Rise and grind! 🌤️ 💪
>>20030207 Billionaire Democratic Donor Reid Hoffman Donates to Nikki Haley
>>20030219 North Korean dictator Kim Jong-un cries as he tells women to have more babies
>>20030370 DJT Truth - Crooked Joe Biden and the Democrats, despite the lessons recently learned in Germany and numerous other places, want to shut down all U.S. COAL PLANTS
>>20030390 Growing Proportion Of Canadians Want Trudeau To Step Down
>>20030420 DJT Truth - SEE YOU TONIGHT, AT 9:00 PM EASTERN!
>>20030478 IT'S ALMOST THAT TIME!
>>20030508, >>20030729 Speaker Johnson Declares J6 Footage Faces Must Be Blurred Prior to Public Release for Security Reasons
>>20030534 Dan Scavino on 2024 Presidential Election voting intention
>>20030549 MTA tests out hard-to-jump fare gates in Queens
>>20030555 Zelensky will not attend classified briefing virtually anymore because of a “last-minute” matter,
>>20030605 PDJT: Join me in Coralville, Iowa at a “Commit to Caucus” event on Wednesday, December 13, 2023!
>>20030608 Russians Are Advancing ‘On All Sides’! Watch: Victory Banner Flies Over Maryinka
>>20030637 Pope Francis Compares Trump to Herod, Who Tried to Kill Jesus - KEK
>>20030651, >>20030668 Former Acting Speaker Patrick McHenry Retires From Congress
>>20030665, >>20030681 Israeli stocks saw short-selling spike ahead of attacks
>>20030690 PDJT: I am proud to give my Complete and Total Endorsement to U.S. Senator Rick Scott of Florida in his bid for Re-Election
>>20030701 DJT Truth - Join me in Durham, New Hampshire for a MAGA Rally on Saturday, December 16, 2023 at the Whittemore Center Arena!
>>20030704 PF Report
>>20030739 Will Saudi Prince MBS become Biden Partner in Containing Mideast conflict?
>>20030752 Dan the Man Truth - 🗣️IOWA---41 DAYS🗳️
>>20030801 DJT Truth - Judge Engoron has totally ignored a major decision on the Statute of Limitations in the New York Attorney General’s Witch Hunt Case against me.
>>20030817 DJT Truth - We have totally proven our Case against the Corrupt, Racist, New York Attorney General, Letitia “Peekaboo” James
>>20030826 Cue the Top Gun music 🎵
>>20030855 Giuliani - Why did the FBI refuse to acknowledge the fact that Hunter Biden's laptop was REAL? The corruption runs deep
>>20030878 Nearly 1000 Dutch expat votes arrived too late to be counted
>>20031118 #24586 posted in #24587
Previously Collected
>>20029161 #24584, >>20030068 #24585
>>20026494 #24581, >>20027192 #24582, >>20028297 #24583
>>20023983 #24578, >>20024766 #24579, >>20025843 #24580
Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com
Q Research Notables Archive Board >>>/qnotables/
Q Research Notables #20: Not Giving Up >>19567242
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43ff74 No.20033338
DOUGH
https://fullchan.net/?305c472ae919d559#Gh3rXPeZsaitijbWsFE28WNmRz4rrzx4R6EN8CA2wESc
baker out
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3f2cc3 No.20033354
>>20033338
ThanQ Baker!
Godspeed, anons!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033359
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033361
Telephone Phone numbers are available on each state's page or on your senator's website Senators Suite & Telephone List (PDF) A U.S. Capitol Switchboard operator can also connect you directly with the Senate office. (202) 224-3121
Tell em
stop bombin the apartment complex
stop writing checks to israel (aparteid)
stop writing checks to ukraine (nazis)
write a check to Hawaii | Maui | Lahaina (A us State)
no cbdc
no digital id
end the fed
let 702 die
no WHO treaty
close the border from invasion
Thanks bye bye
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033363
YouTube embed. Click thumbnail to play.
Anon thinks the SCOTUS case on income tax is important.
MSM is panicked, and anon sees it breaking the fed.
>Just in time to create hyperinflation before the 2024 election
Now imagine a presidential candidate with a history of going back to the old way of paying for government via tariffs.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
db560e No.20033364
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033365
>>20033361
Shhh!
Be very, very quiet:
We are saving Israel for last.
Very specific reason not mentioned a single time.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033366
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
15ebbf No.20033367
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d86cc2 No.20033369
YouTube embed. Click thumbnail to play.
Lately
Above & Beyond Group Therapy
lb
You are a Spirit
Your spirit dwells in your body/vessel
You have a soul= Mind, Will & Emotions
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
56aa06 No.20033371
YouTube embed. Click thumbnail to play.
Things on tv are getting out of hand. Sephora must think the can handle things better than Budlight and Target.
For a quick kek: https://youtu.be/N3gbk1Wd2UE?si=9qM5VM6nPpgkNeGN
Just embarassing. Sheesh.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
56aa06 No.20033373
So funny, almost as if it is a parody.
>>20033371
>Sephora must think they can handle things better than Budlight and Target.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033374
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033375
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033376
https://twitter.com/WallStreetSilv/status/1732234610199732256
Wall Street Silver
@WallStreetSilv
"New York city will be the first city in America to charge Americans just to go to work in the morning"
"Americans will have to pay $23 per day"
"Passenger vehicles will be charged $15 to enter the congestion zone"
"Trucks between $26 and $36"
"The tolls will be charged once per day"
🚨🚨🚨
0:09 / 0:41
4:04 PM · Dec 5, 2023
·
957.1K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d10ec No.20033377
final year of counters
Anons what is your PROFESSION!
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033379
>>20033368
Morning, Dude! Olga's here already thanking the baker and helping Mr. Pig into his dress whites.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ae5fc No.20033380
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d10ec No.20033381
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033382
>>20033376
what the fuck does New York Produce?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033383
https://www.newsweek.com/democrats-are-using-lawfare-against-trump-because-they-cant-beat-him-fairly-opinion-1849670
The Democrats Are Using Lawfare Against Trump Because They Can't Beat Him Fairly | Opinion
Dec 05, 2023 at 10:42 AM EST
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d10ec No.20033384
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d10ec No.20033386
>>20033382
>what the fuck does New York Produce?
conspiracies
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d10ec No.20033387
>>20033385
>Rats
release the Cats!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033388
>>20033385
>>20033386
so 28 bucks to pick up a pallet of PACE PICANTE SAUCE?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033389
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033390
https://www.thegatewaypundit.com/2023/12/sick-presidents-harvard-mit-penn-tell-congress-that/
Sick. Presidents of Harvard, MIT and Penn
Tell Congress that Calling for the Genocide
of Jews Does Not Necessarily Violate their
Campus Code of Conduct – Unless It Leads
to Actual Genocide (Video)
Gateway Pundit, by Jim Hoft
Posted By: DW626, 12/5/2023 9:16:50 PM
On Tuesday the House Education Committee invited the leaders of MIT, Harvard, and Penn to testify in front of Congress. During their testimony Rep. Elise Stefanik asked the educators if calling for the genocide of Jews violates the code of conduct on their campuses. Not one of the campus leaders could answer the question. Presidents of the University of Pennsylvania, Harvard, and MIT smilingly say that calling for genocide of Jews isn’t necessarily against their code against harassment and bullying on campus. MIT dean Liz Magill suggested it was not a violation unless it led to actual genocide. Wow! It’s open season on Jews at these American universities!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033391
>>20033382
>what the fuck does New York Produce?
Murdered detectives.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033392
https://www.americanthinker.com/articles/2023/12/institutions_have_betrayed_our_trust.html
Our Institutions Have Betrayed Our Trust
American Thinker, by Jack Gleason
Posted By: Imright, 12/5/2023 9:00:34 PM
We are witnessing a recurring pattern of events – none of which make sense in a rational world. Those we trust have told us to accept as truths things that are now turning out to be lies. On the list are government investigative committees, our Department of Justice/FBI, the National Institute of Health, the Food and Drug Administration, weather scientists, and even teachers, to name a few. But perhaps the greatest betrayal of trust comes from the news media. The journalists who bravely risked everything to investigate and report wrongdoing are no more. Instead, the vast majority of the mainstream media support the lies in unison
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d10ec No.20033393
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033394
Pace has problems.
Cambells soup owns em
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033395
>>20033361
and do you really think that they give a shit and will listen.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033396
>>20033390
free speech mother fuckers.
Violent words do not equal violence.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
56aa06 No.20033397
>>20033371
>>20033373
>>20033378
>gay Indians from India.
Hahahaha
The next target audience.
I can see an Sephora "Give Something Beautiful" Apu meme incoming.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033398
>>20033390
So you have more Free Speech at Harvard than on 8Kun or X?
Interesting.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033399
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033400
>>20033395
Anon will get more done, more sway, than getting arrested in a protest, on phone for a moment, then with whole day to do shit.
but you don't engage me because you hace concern. your a fucking piece of shit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033402
https://twitter.com/xDaily/status/1732284224525549873
X News Daily
@xDaily
NEWS: South Carolina's state investment funds will no longer invest in Disney after its 𝕏 boycott.
The state treasurer said the 𝕏 boycott is breaching $DIS fiduciary duty to shareholders.
Image
Image
7:21 PM · Dec 5, 2023
·
237.1K
Views
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033404
>>20033402
https://archive.vn/Dbb3U
Politics
South Carolina Treasurer Bars State from Disney Holdings
By Amanda Albright
December 5, 2023 at 11:07 PM UTC
Updated on December 5, 2023 at 11:31 PM UTC
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033405
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe4a9 No.20033406
[About Nasim Aghdam:
"Shooting"
Night before… Police "found" her in a Walmart parking lot. Many people can sleep in a Walmart parking lot. It would be interdasting to see a police report to see why or if they were even called.
Is there exterior YouTube HQ building footage of Nasim? Shadow banned…. Was there a missing persons report?]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033407
>>20033405
What are you reporting?
What's the crime?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
318fae No.20033408
disgustin coal burning white women are race traitors
they need their tubes cut and the mutt-blood niglet half breeds locked in a state facility where they too will be neutered so they cannot breed more mutts
half breed niggers are basically monkey tier mutants
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
318fae No.20033409
>>20033407
he is reporting pre-crime
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033410
>>20033407
>What are you reporting?
>What's the crime?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6b943 No.20033411
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033412
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033413
>>20033400
sure you will you stupid fuck. HACE CONCERN? Can you even t-t-type you fuck? Calling a politician and thinking they give a fucking shit. My god you are a dumb cunt.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033414
>>20033409
Thought Crime Prevention Task Force On Patrol
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033417
https://www.westernjournal.com/people-complied-covid-restrictions-likely-suffer-mental-health-issues-study/?
People Who Complied with COVID Restrictions More Likely to Suffer Mental Health Issues: Study
By Johnathan Jones December 4, 2023 at 9:46am
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033419
>>20033415
shame is only something stupid people experience.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033420
give anon a kiss, before filter, please, thanks
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d10ec No.20033421
don't forget to enjoy Life, Anons
its a crazy spoopy game (that is not a game)
if we play better we can insure the WIN
if we play normal then its 50/50
fake news gives fake leaders the advantage
swamp has no shame so they take gold bars from egypt and checks from china
every move swamp makes has a counter
'timing is everything'
'keep the momentum'
4AM sets the stage; counter 4AM
effort = results; monitor results
thank you Anons
i always think 'make Normies realize they are being cheated on like a cheap gf re fake news' kek
Trust that broken can't be mended
Normies breaking up w fake news is a beautiful sight kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033422
>>20033406
Did she have a therapist, Anon?
https://qalerts.net/?q=therapist
8 post(s) found containing "therapist".
The key = therapist.
Weak minds.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033423
https://www.breitbart.com/middle-east/2023/12/05/idf-chief-suggests-israel-may-flood-hamas-tunnels-with-seawater/
IDF Chief Suggests Israel May Flood Hamas
Tunnels with Seawater
Breitbart Middle East, by Joel B. Pollak
Posted By: Imright, 12/5/2023 8:15:38 PM
Israel Defense Forces (IDF) Chief of Staff Lt. Gen. Herzi Halevi suggested Tuesday that it might be a “good idea” to flood the Hamas terror tunnels in Gaza with seawater, commenting on a report in the Wall Street Journal that Israel was thinking about it. The Journal report stated: “Israel has assembled a system of large pumps it could use to flood Hamas’s vast network of tunnels under the Gaza Strip with seawater, a tactic that could destroy the tunnels and drive the fighters from their underground refuge but also threaten Gaza’s water supply, U.S. officials said.”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033425
>>20033421
that's a Catherine Heritage FORGERY.. there's NO PEN!!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b0a5d1 No.20033426
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe4a9 No.20033427
>>20033422
[She definitelynoticed]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
93ba4e No.20033428
https://truthsocial.com/@Kash/posts/111530990174934835
Avatar
Kash Patel
@Kash
Looks like NYT reporters are not thrilled by the prospect of bureaucrats and media hacks being held accountable for breaking the law
nytimes.com/2023/12/05/us/poli
A New Trump Administration Will ‘Come After’ the Media, Says Kash Patel
Donald Trump, who has already promised to use the Justice Department to “go after” his political adversaries, is expected to install Mr. Patel in a senior role if he returns to power.
The New York Times
Dec 05, 2023, 2:57 PM
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033429
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033430
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
57fb08 No.20033431
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f6d4a No.20033432
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
57fb08 No.20033433
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033434
an official Catherine Heritage is like a Banksy with no PEST CONTROL.
you can tell this is real cause it has the PEN still in there.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033435
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1e7ac No.20033436
>>20033391
RIP to those brave souls who wanted to expose the truth.
Wished they just had said, "fuck it" and did the press conference anyway. DJT still wins and boots Eric Holder's ass out of his position and voila, the justice dept threat is no more.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f6d4a No.20033437
>>20033377
Anon professes his belief in Christ our Savior.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033438
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
57fb08 No.20033439
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033441
>>20033436
if LIES can be REALITy
LOUDER TRUTHS can be REALITy
it's all about the amplifier.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1e7ac No.20033442
>>20033423
notable
I hope one day we get the story on exactly who is fighting who there. Wonder how the land issue gets resolved, thanks Rothschild
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033443
Which Anon will pay $500,000 for a real Catherine Heritage Sharpie Taped to a wooden door?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033445
>>20033423
Spoiling the Freshwater is basically Salting the Land.
Typical Jew move
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
57fb08 No.20033447
What is Gold Juice? Adrenochrome?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033449
>>20033446
If you watch schindlers list in reverse it is a nice story about summer camp.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033450
>>20033446
I though Anne Frank was raped to death by Nazi Pedos who stole her Ball Point Pen Patent and used it to write the Book of Mormon?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033451
>>20033440
>posting that pelosi image is a federal crime!
Anon wasn't proud of stealing dat shit, but it was worth it just to burn retinas of niggas willing to click dat shit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033452
>>20033446
Merry Christ Mass Formation Psychosis.
https://rumble.com/v3zfh16-merry-christ-mass-formation-psychosis.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033453
>>20033436
>RIP to those brave souls who wanted to expose the truth.
Indeed. Remembering them is the least we can do. Godspeed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033454
>>20033447
It Porn
PREMIUM Porn…that costs money
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
318fae No.20033455
>>20033444
those digits / checked!
remember in india to poo in the loo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033457
>>20033444
>they want less ass Wipers in that country.
Join the ‘Take Poo to the Loo’ campaign and pledge your support to a poo-free nation.
https://www.unicef.org/india/campaigns/take-poo-loo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033458
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
318fae No.20033459
>>20033451
>pelosi vag cornhole
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f6d4a No.20033462
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033463
>>20033458
mafugga right tho
what i been trying to tell folk is that no matter what side of the aisle they are on, weaponizing the fed gov to go after political opponents is a bad road to go down because they could be next
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033464
>>20033456
>>20033460
What does the 'V' in 'BV' stand for, Anons?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49d146 No.20033465
Word of the day is.
MAGANOMICS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033466
YouTube embed. Click thumbnail to play.
>>20033456
>>20033460
THE MODERN CANNIBALS OF INDIA - AGHORI (GRAPHIC VIDEO 13:32)
Been reading this book about Aghori and have been interested in their practice for awhile now. Modern day cannibals of India that do it in the name of spirituality and breaking the ego!
https://www.youtube.com/watch?v=eA7aeKuBGqY
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5ae5fc No.20033467
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7d052d No.20033468
>>20033464
V for Veejayjay
BV
Board Veejayjays
>says it all really
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033470
Which animals are moar equal than the others?
They aren’t hard to find. They’re boastful.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033471
>>20033421
>don't forget to enjoy Life, Anons
Shall we enjoy some art used to traffic children? or rigged sports? or maybe read the fake news?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033472
YouTube embed. Click thumbnail to play.
>>20033461
65 million Kg every day …
Don't fear the reaper
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23841e No.20033473
>>20033406
Her father did call the police.
@ cops found her the next morning. They interviewed her and there was a body cam of her being interviewed. She seemed fine. The cops found nothing disturbing in her interview and did nothing to detain her.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033474
>>20033471
Maybe we can go outside and breathe in some chem trails?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
23841e No.20033475
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033476
>>20033466
Reza Aslan did it for CNN, thought I recall hearing about how it fucked him up mentally, and he was scared for his life if he did not do it. This was years ago now.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033477
>>20033463
anon say make new law and oath for these people who intend harm.
commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist or identity fraud
all problems World has is from them
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ffd66f No.20033478
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe4a9 No.20033479
>>20033422
[Coroners report?
Picrel.]
>[Today I learned, The em dash resembles a horizontal line (—) that is longer than both a hyphen (-) and an en dash (–). Possible stringer? ]
>>20033446
[I remember an Obama quote ... "I've got a pen and I've got a phone"]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033480
>>20033476
>how it fucked him up mentally,
Raised in a Sick World
Brain gets broken by reality
Now thinks he's sick.
Ego Death is a bitch
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f6d4a No.20033481
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033482
>>20033474
you could make a nice meal with all the wonderful GMO and MRNA infected foods or go on a trip to a big city and experience the invasion and shit problems first hand. So many great things to do. People that say touch grass should get kicked in the balls.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033484
>>20033474
Maybe pop in a fresh movie devoid of any actual substance written by a loxist who wants me dead?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033485
>>20033459
Sorry, anon.
Eye bleach, if you're still brave enough to click that shit
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033486
>>20033483
No, because I have standards.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033487
>>20033482
>you could make a nice meal with all the wonderful GMO and MRNA infected foods
Wash it down with some fluoride? Sounds fucking awesome, don't forget to enjoy life anon, enjoy your pagan holiday with all the satanic imagery!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
56ea97 No.20033488
>>20033486
>I have standards.
Finally. Somebody who doesn't add pineapple onto pizza.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033489
>>20033487
Well you could go to church and be brainwashed with deep state propaganda in the form of spirituality and whatever truth you think you are getting is just the propaganda from thousands of years ago, that they keep hidden from the population and instead tell them to pray and touch grass. Sounds great.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cb214a No.20033490
Rumble embed. Click thumbnail to play.
>>20033338
GM baker & thanks
https://rumble.com/v3zqgxg-d-hmoney-most-absent-in-class.html
Most Absent in Class
(You) have seen the truth.
Time to show the world.
Focus.
FOCUS.
Ascension.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033491
>>20033477
oh..hello
what flavor crayon is your favorite?
>>20033488
checked
amen
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8927c4 No.20033492
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033493
>>20033484
Maybe enjoy the beauty before the snaz gets whacked 50 times per second?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033494
"In God We Trust"
May your retirement check never bounce.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033495
>>20033491
>what flavor crayon is your favorite?
metallic in silica structured protein reminds me of structured atom
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033496
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0f5e63 No.20033497
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe4a9 No.20033498
>>20033476
[CNN checking on supply chain?..]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033499
>>20033493
>Maybe enjoy the beauty
We're specifically asking what the fuck you think is so fucking beautiful.
>>20033489
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033500
>>20033489
>instead tell them to pray and touch grass
Also don't forget how they told all our grandparents to take an experiment for the cold while they took all our tithes to import enough competition for the shit jobs left to the children so they can barely scrape, touch grass though.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033502
>>20033493
>he snaz gets whacked 50 times per second?
That's a bit slow for our oldfag community. Got anything electric? They got Japanese ones over at The Villages.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a58f72 No.20033503
12-7-23 FALSE FLAG HAPPENNING - PEARL HARBOR DAY
GET THE FUCK IN HERE, JAMES YOO TRIES TO EXPOSE 12-7-23 FALSE FLAG(SAME DATE AS PEARL HARBOR!!!)
HAPPENNING
HAPPENNING
HAPPENNING!!!!
ALMOST ALL DATA ON JAMES YOO (former CFIUS agent (responsible for stopping spies) WIPED FROM INTERNET. HE SAYS ISRAEL HAS BACKDOORS TO EVERY AMERICAN AND AMERICANS ARE ISRAELI PUPPETS.
Also on his YouTube channel he was still commenting and warning people of 12-7-23 while police were dragging “his” body from his house!
GET IN HERE! GLOWIES WILL TRY TO DERAIL MAJOR NEWS OF FALSE FLAG-PEARL HARBOR HAPPENNING!!
SPREAD WORD OF FALSE FLAG!!!!!!!!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0f5e63 No.20033504
Shortest Fn Line…
$200 less to go through Canada…
Secret Chinese Hotel Exposed - MILITARY AGED US-BOUND CHINESE STAGING AT COLOMBIAN HOTEL, CHINESE POLICE IN AMERICA
In Pasto, Colombia, Muckraker found a hotel packed to the brim with military-aged Chinese nationals who were headed to the United States.
During our stay at the Cabańas Rio Mayo Hotel, we were the only non-Chinese visitors. All of the signs posted around the hotel come with a Chinese translation, indicating that this is a common meeting place for people of Chinese origin.
There are so many Chinese nationals headed to the US, that they have established dedicated hubs along their migration route such as this hotel.
From this point, the Chinese will either cross the Darién Gap and trek up to the United States or will fly directly into Mexico if they have a visa.
We spoke to one of the Chinese men at the hotel. What he told us was terrifying.
https://twitter.com/realmuckraker/status/1731861221794599123
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
55276d No.20033505
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033506
>>20033499
who is we?
>>20033500
well you could go to a place called college, where you can learn lots of important things to get you ready to get a high paying job, that will ensure that you have a great life and find a great girl who is totally well adjusted because she has no daddy issues, and never ever be cheated on because women ever have a hypergamous mind set. Be swell.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033507
Thanks, Santa.
The grass is touching anon all over.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0f5e63 No.20033508
>>20033503
Calm down FED.. we get it, you have no sauce for us to spread…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6f533 No.20033509
>>20033504
notable
What in the fuck is going on these days. Maybe the Chinese are doing white hat ops?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3b9f1a No.20033510
>>20031726 pb notable
>We have to figure out what they are planning
X22 was talking about a "cyber attack" so close to election day that they would have to postpone.. ITfag here, that's a crock of shit. CISA directives require systems to have a contingency plan to obtain an Authority To Operate. Well , you'd think that each state's critical infrastructure election systems would follow this standard. The obvious contingency plan should be paper ballots, same day voting. I am going to ask my county/state what their plan is. In a state where it is known that sec of state is corrupt...just saying
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe4a9 No.20033512
>>20033503
[2003 is an important year]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0f5e63 No.20033513
>>20033509
Never saw Xi smiling with President Trump…
Putin was having fun though…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033514
>>20033510
>CISA directives require systems to have a contingency plan to obtain an Authority To Operate.
Primaries coming in a few months.
Good opportunity to "Shake Down" those Contingency Plans?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033515
>>20033503
>(SAME DATE AS PEARL HARBOR!!!)
That was 12/7/1941, Anon.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
43ff74 No.20033516
>>20033513
>Never saw Xi smiling with President Trump…
he tried that one time
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033517
>>20033506
>well you could go to a place called college, where you can learn lots of important things to get you ready to get a high paying job, that will ensure that you have a great life and find a great girl who is totally well adjusted because she has no daddy issues, and never ever be cheated on because women ever have a hypergamous mind set. Be swell.
Now what faggot? I'm sitting in the home I own, with spawn and loyal pussy. What the fuck do I do now about the fact I can't take my child outside and show her the moon without talking about how my faggot government faked landing on that shit?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033518
>>20033432
Where there is a righteous will God makes a way. Absent Him there is a clear connection to insanity. Escape Unscathed? Enjoy the show! God is watching us from a distance of about 3 square inches. The Father, Son and Holy Ghost. There will be love and with it will come justice, NCSWIC.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
55276d No.20033519
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe4a9 No.20033520
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033521
>>20033506
>who is we?
Back in the day it was French literature.
Spelled “Oui”.
I sceent it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033522
Would it be too much to ask to have Florida wear some underwear?
People shouldn't be forced to look at America's huge, naked, uncircumcised cock when using Google Maps to get to Disneyland.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0cab72 No.20033523
RIP Pat Benatar -what a fucking loss
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f6d4a No.20033524
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033525
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033526
>>20033517
Shit, got me on that one. Moon, kek.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6f533 No.20033528
>20033517
>Now what faggot? I'm sitting in the home I own, with spawn and loyal pussy. What the fuck do I do now about the fact I can't take my child outside and show her the moon without talking about how my faggot government faked landing on that shit?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6f533 No.20033531
>>20033516
kek oh yes that was a keeper
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033532
>>20033503
12/7/23 IS Anthony Blinking’s fission freedom day. Imagine that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033533
>>20033437
Jesus is Lord and we are not alone.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033534
YouTube embed. Click thumbnail to play.
>>20033523
>RIP Pat Benatar
It's amazing how many of them died of sudden brain issues just as they were ready to spill the beans..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033535
>>20033527
its a video about crime and killing people, seems very representative. Not sure what your problem is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033536
>>20033528
Have you fags found that hard drive yet or are you going to level Gaza?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fe242a No.20033537
>>20033527
play'n grand theft auto agin?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fe242a No.20033538
>>20033511
this a beautiful day
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6f533 No.20033540
>>20033527
>>20033535
>its a video about crime and killing people, seems very representative. Not sure what your problem is.
Sadly, this is where we're at in 2023. It took a mugshot of POTUS for men in that demographic to relate more to him. Hopefully we can fix the fuckery and rebuild the country
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033541
>>20033503
true if goliath
put me in the screencap
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e208a3 No.20033543
>>20033537
the new gta is released in 2025
it has gone fully pc
diversity gay rainbow nignog lesbian lbgtxyzabc etc
main character is female
woke, hope the franchise goes broke
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3e931d No.20033544
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033545
>>20033543
so nothing can change between now and almost 2 years, omg the main character is female. OMG OMG OMG did you never play Metroid you stupid cunt? Fucking Tomb Raider?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f8fa03 No.20033546
https://thepoliticsbrief.com/44-ex-capitol-police-officer-promises-to-blow-the-lid-off-the-jan-6-cover-up/
x-Capitol Police Officer Promises to Blow the Lid Off the Jan. 6 ‘Cover-Up’
By
thepoliticsbrief -
December 3, 2023
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0cab72 No.20033547
>>20033527
hey fedbois - your feeble attempt to throw shade here will not work.
no one is a racist here except you and your boys
btw good call ditching the khakis
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033548
Imagine, knowing who was "mandated" to take the shots?
Who, created the shots?
Who controls the Data?
Remember the Utah Nurse who was arrested for "Not Following Police (mormon) Orders?
University of Utah, School of Medicine in SLC, where she worked, probably has the details on the targeted assassination of "problematic" Religious Zealots?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033549
>>20033543
>main character is female
I bet you think she should vote too.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4f6d4a No.20033550
>>20033537
it actually is GTA
KEK
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58cc88 No.20033551
>>20033550
the game maker
their stock price is falling already
kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033552
>>20033548
There (U) R.
(You) is [U]niversity of [You]tah
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58cc88 No.20033553
>>20033549
women should never have been given the vote
never!
the downfall of western society can be attributed directly to this
prove me wrong….you can't
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6f533 No.20033554
>>20033551
>their stock price is falling already
>
>kek
Guess it's because 2025 is too far out. Who the fuck knows what'll happen next year. Hell, Trump mentioned once how some of these games are too violent so there may be a ban on it, assuming he's back in office officially.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0cab72 No.20033555
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58cc88 No.20033556
>>20033547
>no one is a racist here
speak for yourself,nigger
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033557
>>20033553
>the downfall of western society can be attributed directly to this
>prove me wrong….you can't
I raise you Greco-Judeo religious syncretism
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033558
>>20033553
What about trannys? Do they get to vote? Only pre-Ops still with penis?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033559
>>20033552
"Y" family = Young, Brigham
"Follow the Y Family around the world"
Brigham Young (June 1, 1801 – August 29, 1877) was an American leader in the Latter Day Saint movement and a settler of the Western United States. He was the President of the Church of Jesus Christ of Latter-day Saints (LDS Church) from 1847 until his death in 1877. He founded Salt Lake City and he served as the first governor of the Utah Territory. Young also led the foundings of the precursors to the University of Utah and Brigham Young University.
Young was a polygamist, marrying a total of 55 wives, 54 of them after he converted to Mormonism.[1] The policy was difficult for many in the church. Young stated that upon being taught about plural marriage, "It was the first time in my life that I desired the grave."[2] By the time of his death, Young had 56 children by 16 of his wives; 46 of his children reached adulthood.[3]
In 1902, 25 years after Young's death, The New York Times established that Young's direct descendants numbered more than 1,000.[4]
In 2016 Young was estimated to have around 30,000 descendants.
https://en.wikipedia.org/wiki/Descendants_of_Brigham_Young
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0cab72 No.20033560
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033561
>>20033558
Do they own land?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
58cc88 No.20033562
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033563
>>20033547
>no one is a racist here
Anon is offended by that.
Jews clearly have bigger noses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
56ea97 No.20033564
>>20033562
>>20033558
TOOTS OR GET THE FUCK OUT!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033565
>>20033559
>He founded Salt Lake City and he served as the first governor of the Utah Territory.
Governor's are Crown Positions
>Young was a polygamist, marrying a total of 55 wives, 54 of them after he converted to Mormonism.
55 huh?
54 men had to die to free up 54 women
"You're just like your Father…"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6ebee No.20033566
>>20033545
kek muchly
you:bigly triggered metrosexual tranny
thx for the keks!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d6ebee No.20033567
>>20033564
Toots is dead,sadly
RIP TOOTS
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b17961 No.20033569
TY Bakers
For Incoming Baker @205
NOTABLES ARE NOT ENDORSEMENTS
#24590 >>20033338
>>20033371 Sephora - woke as Budlight and Target
>>20033376 NYC will charge workers a toll to go to work
>>20033390 Harvard, MIT and Penn testify that Calling for the Genocide of Jews Does Not Necessarily Violate their Campus Code of Conduct
>>20033392 American Thinker: Our Institutions Have Betrayed Our Trust
>>20033402, >>20033404 SC's state investment funds will no longer invest in Disney after its 𝕏 boycott
>>20033417 Study: People Who Complied with COVID Restrictions More Likely to Suffer Mental Health Issues
>>20033423 IDF Chief Suggests Israel May Flood Hamas tunnels with Seawater
>>20033504 @realmuckraker: Military aged US-bound Chinese staging area found at Colombian Hotel
#24590
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e85636 No.20033570
>>20033567
>Toots is dead,sadly
That's a debunked conspiracy theory.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033571
>>20033518
Trinity of lies
https://kjbhistory.com/the-not-so-exact-king-james-bible/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0a4bb6 No.20033572
>>20033535
self absorbed cucklet
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033573
It’s difficult for me to give a shit about anything now that I’m rich. I don’t care what happens to this country because having money makes me right.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033574
It’s difficult for me to give a shit about anything now that I’m rich. I don’t care what happens to this country because having money makes me right.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033575
If Elon has MPD, then is there anyway to "25th Amendment" his control of Twitter by declaring him mentally unfit?
Then the State of Texas could appoint a Conservator over his assets and control his Puppets?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3c32d3 No.20033576
https://www.dailymail.co.uk/news/article-12829957/massie-accused-antisemitism-drake-meme-zionism.html
Republican Rep. Thomas Massie is accused of anti-Semitism for sharing Drake meme suggesting Zionism controls Congress: Chuck Schumer calls it 'disgusting' and White House demands GOP leadership condemn him
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
07f79d No.20033577
>>20033422
you do know that she was a he right?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033578
>>20033562
>>20033554
If you wanna see tranny tits talk to Anime
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0a4bb6 No.20033579
>>20033574
you rich bastard!
how dare you!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033580
>>20033575
MPD is fake.
He has demons.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0a4bb6 No.20033582
>>20033578
Anime usuall posts its dic pics
never seen its tits
>don't want to!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033583
>>20033566
who is triggered you sensitive fag.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033584
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033585
>>20033575
>then is there anyway to "25th Amendment" his control of Twitter
Probably going to have to set up a pretty significant blackmail network to replace the one Epstein set up in the government you're pretending can function in a manner representative of you the voter.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033586
>>20033572
oh I am sorry did your faggot ass have an opinion.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033587
>>20033579
He ain’t rich.
He found a Franklin in his winter coat from last year.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
07f79d No.20033588
>>20033516
trump looks at everything like he owns it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033589
A witness like Flynn, could hold a position of strength having the goods on them even while the whole fabricated and “fake” Russia, Russia, Russia thing was ongoing, Having the goods on them. And what of Julian, why would not the FBI have checked with him on the source of those leaks given to WL,, by Seth Rich? Could there have been an ongoing investigation that Muller was running that was less public on the entire topic of “America for sale” and “Cheatin Obama”?
Might account for a dog day in AZ. You have more than you know, being armed and protected.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033590
>>20033580
The courts don't acknowledge "demons" in the Table of Authorities.
"Mental Health Diagnoses" are the "Gold Standard" of Legally Admissible "evidence" in this fucked up crap system.
But, to use it to "take out a Tyrant" who helped build "the system" and profited from the Western Medicine Legal System, would be Cosmic Justice?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033591
>>20033562
>>20033554
If you wanna see tranny tits talk to Anime
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033592
>>20033390
>Sick. Presidents of Harvard, MIT and Penn
>Tell Congress that Calling for the Genocide
>of Jews Does Not Necessarily Violate their
>Campus Code of Conduct – Unless It Leads to Actual Genocide (Video)
Unreported Foreign Donations to Universities Foment Anti-SemitismOpinion
Nov 13, 2020 at 6:00 AM EST
Officials at the U.S. Department of Education last month released findings in their investigation into Georgetown University, Texas A&M, Cornell, Yale,Harvard,Rutgers and other universities over billions of dollars inunreported funding from the oil-rich Gulf kingdom of Qatar.Much of the known Qatari funding has gone to Texas A&M, Georgetown, Cornell, Carnegie Mellon, Northwestern and Virginia Commonwealth, all of which maintain campuses subsidized by the royal family-linked Qatar Foundation.
Between 1986 and 2018, Middle Eastern countries donated more than $6.6 billion to U.S. universities, but reported less than $3.6 billion to the federal government as required by law. Of the roughly $5 billion donated by Qatar to various institutions, less than $2 billion was reported properly, according to federal records and seven years of research by experts and investigative accountants at the Institute for the Study of Global Antisemitism and Policy (ISGAP).
According to these findings, some of which were presented at a summit on contemporary anti-Semitism hosted by the Department of Justice in July 2019—which in part spurred the Department of Education investigation—inadequate federal oversight procedures failed to keep track of funding coming into the United States from abroad, anduniversities failed to report more than $3 billion given by Qatar and the Gulf States.
The bulk of Middle Eastern donations coming into the United States emanates from Qatari donors (75 percent), while the Qatar Foundation accounts for virtually all of the donations from Qatar. These funds have a significant impact on universities, especially with regard to attitudes toward Israel. ISGAP's research identified a direct correlation between the funding of universities by Qatar and the Gulf States and the active presence at those universities of groups such as Students for Justice in Palestine (SJP), which foster an aggressive anti-Semitic atmosphere on campus. In addition, the ISGAP project assessment found a correlation between funding and the ideological bent of scholarship, including anti-Israel and anti-Zionist sentiment, at departments and institutes at some of America's leading universities, publishing houses and academic professional associations. There is also a disturbing connection between this funding and the silencing of institutes and publications by scholars that are critical of the prevailing ideology.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
07f79d No.20033593
>>20033537
Bonny and Clyde this time around
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ea871e No.20033594
>>20033576
Who's got the clip of Tater saying he's really a zionist?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033595
>>20033585
Anon is NOT suggesting that it Be Done.
Anon is suggesting that if it's a plausible lane of attack, against ANY "powerful" (oligarch/billionaire/whatever) then expect someone somewhere to attempt to exploit it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033596
>>20033595
>Anon is suggesting that if it's a plausible lane of attack
I'm suggesting it's delusional as fuck
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033597
>>20033574
>>20033573
Now you know what a lie Trump is.
He still wants more.
Anons believe HRC continues to stay out of prison because she wants more power and is evil, same applies to Apollo centric Trump.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033598
>>20033592
Anti-Semitism has been on the rise at North American universities in recent years. As a result of traditional forms of anti-Jewish sentiment on the political Right and more modern anti-Zionism promoted by progressives on the Left, who seek to delegitimize the Jewish people's right to self-determination by advocating a wide-ranging boycott of the state of Israel, Jewish students have been made to feel increasingly unwelcome at institutions of higher learning. This perspective is becoming pervasive within academia.
Qatar is not unique and neither are those universities. Based on its "Follow the Money" report, ISGAP found that a number of autocratic Middle Eastern regimes funneled billions of dollars of unreported funding to U.S. universities in order to promote an atmosphere sympathetic to their efforts to demonize Israel on campus.
Qatar has long been an important source of funds for the Palestinian terror organization Hamas and has forged relationships with Islamist groups ranging fromthe Muslim Brotherhood to the Taliban.
Qatar is not unique and neither are those universities. Based on its "Follow the Money" report, ISGAP found that a number of autocratic Middle Eastern regimes funneled billions of dollars of unreported funding to U.S. universities in order to promote an atmosphere sympathetic to their efforts to demonize Israel on campus.
Qatar has long been an important source of funds for the Palestinian terror organization Hamas and has forged relationships with Islamist groups ranging from the Muslim Brotherhood to the Taliban.
Qatar's $3 billion in unaccounted funds is the tip of an iceberg. Foreign funds are coming into the United States to promote certain ideologies now infiltrating into universities and permeating the most precious institution in our democracy: our education system.
ISGAP's findings on the paucity of appropriate university compliance with legally mandated disclosure of foreign funds have been echoed by DOE officials. Testifying before Congress earlier this year, Deputy Secretary of Education Mitchell Zais explained "All degree-granting domestic institutions of higher education are covered under section 117 [of the Higher Education Act]. There are approximately 3,700 such eligible institutions in the United States but, based on recent reports the Department has received, fewer than 3 percent reported receiving foreign gifts or contracts."
That is why last month's release of preliminary findings in the Department of Education's investigation into foreign funding of American universities is a critical first step in stopping the manipulation of American universities and the students they teach.
Charles Asher Small is the founder and executive director of the Institute for the Study of Global Antisemitism and Policy (ISGAP) and a Research Scholar, St. Antony's College, Oxford University.
The views expressed in this article are the writer's own.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
07f79d No.20033599
>>20033554
Its the financial year ending 2025
It could release anytime after march 2024
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
194523 No.20033600
>>20033574
Nice not to have the stressors and kept in a debtors prison or tax caste huh?
Now you get to watch out for those who just want to take from you,
More so than before
This anons experience as going from 'owning' a home, nice job, to rob Ed and living paycheck to paycheck with the reality a car repair would take months to save for. Guess rice and beans is too much
Keep working and grinding though, tons of ideas, 2nd jobs, 3rd jobs… Humble faith
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033601
Today is a beautiful day. Sun is shining. Beautiful view from the office window. Oh and destroying Q Research shills, that's bigly guud.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033602
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bf8336 No.20033603
>>20033597
>Anons believe HRC continues to stay out of prison
I believe her body double showed up at that funeral and no one here said shit.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033604
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
07f79d No.20033605
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d86cc2 No.20033606
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033607
Triggering the echo chamber shills here gives me a reason to wake up every morning. Thank you for that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
194523 No.20033608
>>20033603
Think they will ever admit to body doubles for heads of state? Or just give us footage
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033609
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033610
>>20033596
"How do you capture a very dangerous animal?"
With a DART gun
If you offer good bait, even the most dangerous might mask themselves up, walk in, and sit right down and voluntarily let themselves be injected.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033611
>>20033590
The courts don’t acknowledge demons “so far…”
https://journals.sagepub.com/doi/pdf/10.1177/070674371105600407
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033612
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033613
Jesus is not the father
If you believe this lie
you need to go back
you don't have the tools to discern anything
America burns because of your false idols
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b17961 No.20033614
>>20033592
https://www.newsweek.com/unreported-foreign-donations-universities-foment-anti-semitism-opinion-1546139
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033615
>>20033611
> “so far…”
Anymore.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033616
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033618
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033619
>>20033462
▶ Anonymous 12/06/23 (Wed) 07:20:03eb9178 (18) No.20033590
>>20033580
GM. It is a beautiful morning to let the sun shine in to awakening.
Did you know?
"Mental Health Diagnoses" are the "Gold Standard" of Legally Admissible "evidence" in this fucked up crap system."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eae5cc No.20033621
>>20033525
Mornin' el-Ralphio… I was wondeding what an Anon had to do to get a cup of Covfefe around this place this morning.
Sorry, no speaka de language good.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033622
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033623
>>20033611
They make you swear on a bible but will not accept the devil made me do it as an excuse.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
fdd041 No.20033624
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eae5cc No.20033625
>>20033558
>What about trannys? Do they get to vote? Only pre-Ops still with penis?
Always has to make some kind of homo reference.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033626
>>20033615
Revisit action of historical facts are in order regarding treatment of witches and demon-possessed.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033627
>>20033390
>>20033592
>Unreported Foreign Donations to Universities Foment Anti-SemitismOpinion
>>20033598
>>20033605
Joel Kotkin, Marshall Toplansky
Moolah from Mullahs
Arab countries are bankrolling American colleges and universities.
/ Eye on the News / Public Safety, Education, Politics and law, The Social Order
Oct 31 2023
For decades, China and Middle Eastern autocracies have been pouring billions of dollars into American and other foreign universities. Such funds support students from their countries but can also support academic programs that propagate these countries’ world views.
China’s so-calledConfucius Institutes,for instance, which push the Chinese Communist Party’s agenda on college campuses and seek access to U.S. technological prowess, have garnered much international attention. Including these institutes and other efforts, China contributed $1.2 billion to American colleges between 2014 and 2020. It has spent roughly another $1 billion since 2020.
Middle Eastern countries’ donations draw much less attention.Between 2014 and 2020, Muslim-majority countries together donated $4.86 billion to American higher-educational institutions, representing 29 percent of all foreign donations.
Qatar and Saudi Arabiawere responsible for much of this largesse. The two countries together invested $3.7 billion in American higher education and were cumulatively responsible for 2,303 grants, gifts, and contracts, of which 422 exceeded $1 million and 17 exceeded $50 million in value. Most of the largest gifts came from Qatar to Cornell and Carnegie Mellon.
Qatar’s role is particularly troubling, since the country is often an ally to both Iran and Hamas. The country also backs other terrorist groups, including the Muslim Brotherhood, and is home to the most important Middle Eastern media outfit, Al Jazeera. Along with Saudi Arabia, Qatar is among the largest donors to Palestinian organizations and causes.
It’s too early to make direct connection between a school’s anti-Israel agitation and its donations from Middle Eastern countries, but the biggest recipients, such as Cornell, NYU, Georgetown, and Harvard tend to have large pro-Hamas elements. Student groups on each of those campuses have embraced the Hamas cause, most prominently at Harvard, where more than 30 student groups initially signed pro-Hamas statements, though some have since sought to dissociate themselves.
Israel’s donations to American colleges and universities have proved somewhat ironic. Between 2014 and 2020, Israel made 373 gifts to U.S. colleges and universities, together worth $124.1 million. Twenty-nine of those gifts totaled more than $1 million. Surprisingly, Yeshiva University was not among the recipients. Israel’s largest nine donations, totaling $36 million, went to Brigham Young University. Yale was the tenth-largest recipient, with a gift of $2.4 million. Harvard’s five gifts from Israel totaled $3.1 million. Medical schools such as Johns Hopkins and Albert Einstein College of Medicine were also major recipients of Israeli dollars.
Some of the Muslim-majority Middle Eastern countries’ donations may be used to stoke anti-Israel and anti-Jewish attitudes. The past decade has seen a surge of Muslim students, including large numbers whose tuitions are paid by Arab governments. These students, though a small portion of all enrollees, have often led the pro-Hamas activity on college campuses. They are frequently joined by Middle Eastern studies faculty, many of whom hold anti-Israel and anti-American views, and whose departments often receive funding from Saudi Arabia and other Gulf countries. While Americans rightfully worry about Chinese influence in our universities, we seem to think less about attracting anti-Israel and often anti-American students to our shores.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033628
>>20033623
Kek.
They make you swear on a book that clearly says to take no oaths. Hilarious!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4fe4a9 No.20033629
>>20033604
[Yessss please to a haka]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033630
>>20033627
>Moolah from Mullahs
As was the case with the Confucius Institutes, it is hard to know how foreign donations influence college presidents and their publicists. Some, such as Florida’s Ben Sasse, have unequivocally denounced Hamas. Others have been less forceful, while some seem at best “evenhanded” in their assessments of mass murder. Among the most mealymouthed presidents include those of big-recipient schools such as Cornell,
Northwestern, and Harvard.
Pushback will need to come from donors. Several prominent donors, including former ambassador to China Jon Huntsman, have cut ties with the University of Pennsylvania over its Israel stance. Harvard, too, is hemorrhaging some big donors, such as Les Wexner, Idan Ofer, and Mark Rowan, while hedge-fund manager Bill Ackman says that he will not hire students engaged in pro-Hamas activities.
Ultimately, this controversy reflects the changing nature of the university. The campus reaction to Hamas’s attack suggests that many universities no longer have the will or the desire to embrace the most basic human values. As they cash in their petrodollars, the people running academia may be giving their autocratic backers exactly what they want.
https://www.city-journal.org/article/arab-countries-bankroll-u-s-universities
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033631
Epstein Island - Unredacted flight logs
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033632
>>20033309 (lb)
Interesting! Thank you for posting!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3c9214 No.20033633
>>20033611
Demon possessed scientists
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033634
All 501c3's promote the trinity and the earthly person a one true god that is not 1 but 3.
After they have you here, they can convince you of anything, like say Hollywood union crystal meth and gun supplier Reagan who flooded us with our first horde of illegal infiltrators, is your appointed hero and a good Christian.
Similar to uniform men who worship the government that trespasses it's families and destroys their children's future.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033635
>>20033624
Weird.
If they hadn't convinced The General Public that the cheaper synthetic motor oil "Oleo" product was "just as good" as the more expensive Vitamin Rich Butter during the Great Depression and WWII, then there would not have been the heart attack epidemic that killed anon's grandpa, to necessitate the development of the entire field of Cardiology and their stupid vaccine induced myocarditis. .
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033636
>>20033633
Haha.
Psychiatrists aren’t scientists.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033637
>>20033621
>Mornin' el-Ralphio… I was wondeding what an Anon had to do to get a cup of Covfefe around this place this morning.
>Sorry, no speaka de language good.
Es took a couple dias, pero yo found el EXTRA dark Roasta covfefe. Es "especial".
Enjoy amigo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033638
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033639
>>20033481
Hoo-hoo that smell?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eae5cc No.20033640
>>20033637
>>Mornin' el-Ralphio… I was wondeding what an Anon had to do to get a cup of Covfefe around this place this morning.
>>Sorry, no speaka de language good.
>Es took a couple dias, pero yo found el EXTRA dark Roasta covfefe. Es "especial".
>Enjoy amigo
I was tolda de past el-Presidenta likeas de morning covfefe too
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033641
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033642
Christmas Present Ideas
New From DonCo
🎅🤶🎄Flight Logs by Bill & Jeff 🎄🤶🎅
Includes the hits:
Sweet 16
Lolitas
Young Girl
Fiddle About
Candyman
And
We’re all in GITMO Now.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033643
The only thing that ever happens is a headline that leads to nothing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20033644
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033645
>>20033638
If they are migrating you out it’s because they are moving in.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
055cfa No.20033646
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033647
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2b92f No.20033648
If your local supermarket doesn't have Dutch Barn Vodka, or you're too fat and lazy to walk thereor you've got an ankle tag and you're not allowed to leave the housethen remember you can always just order it directly from our website
https://twitter.com/rickygervais/status/1732379346818547792
Ricky giving another middle finger to the cult.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ee93b6 No.20033649
Black African negroid women in any kind of leadership role in America is a Blazing Saddles comedy show all on its own.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033650
>>20033648
>or you're too fat and lazy
Hourglass Ideals kill civilizations
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033652
>>20033643
>The only thing that ever happens is a headline that leads to nothing.
AHhh your learning grasshopper
Operation Placation
Just buying time building consent for your prison planet
All they have left is to draw us into violence because we will not remove the evil seed.
God killed almost all and failed to remove, so man will fail also.
How much they have to destroy and kill before they build back better is up to our conformity.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033654
>>20033639
The only good board personality shill is a dead board personality shill.
Amen
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033655
>>20033653
Hello Anon
Anon welcomes your Freedom of Press
Not because of what you post
But because of WHY you post it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
cdbb32 No.20033656
>>20033653
Pedophile I thought you was tracked down and fed to the pigs.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033657
>>20033652
Glad I’m rich. Being rich allows me not to care. More money I have the more right I am.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033658
>>20033640
>I was tolda de past el-Presidenta likeas de morning covfefe too
Ah Bueno. he would likeas de 'Especial' mucho
El Covfefe de Patriots
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033659
>>20033550
Sensitive compartmented information facility functionality to hold a private chat with at least two witnesses? Not sure what you mean. That brings the stock price down? Think you might be better off just using Ham radios to circumvent public office scrutiny.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
57fb08 No.20033660
I thought this was funny, kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
38f5e3 No.20033661
>>20033411
>Good morning, anon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033662
400 million guns
a land supposedly full of patriots
cannot raise one effective patriot
A military that owns controls and experiments on zero will conformers
Cannot remove one horrible leader, but they will use the cover of military to kill a good president and create terms because the people are so upset that creating a phrase was enough to shut up truth warriors.
These people are stupid and sick, Q was talking about the brainwashed American people of sheep status, ready for slaughter.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9f2444 No.20033663
>>20033660
Nigga What you talking about?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
510296 No.20033664
>>20033635
Connections
Of course it is 'those you trust the most', the ones close to God and honest living
>Allegedly
When does a Church become a PLAYGROUND?
>>10864305 (pompeo, pope, francis, china)
When does a Church become aPLAYGROUND?
When does a Church become a business?
When does a Church become political?
When does a Church become corrupt?
When does a Church become willfully blind?
When does a Church become controlled?
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033665
>>20033660
Is there something funny about niggers with big Brian's to you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033666
>>20033659
>Sensitive compartmented information facility functionality to hold a private chat with at least two witnesses?
HH
The Holy of Holies or Holiest of Holies is a room in the Salt Lake Temple of the Church of Jesus Christ of Latter-day Saints (LDS Church), wherein the church's president — acting as the Presiding High Priest of the church — enters to act as High Priest of Israel in direct relationship with God, in accordance with the LDS interpretation of the Book of Exodus.[1]
The First President, and 2 Servant Counselors constitute the Quorum allowed to "recieve the oracles for the whole church," according to [Joseph Smith]
https://en.wikipedia.org/wiki/Holy_of_Holies_(LDS_Church)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
57fb08 No.20033667
>>20033665
Not the brains, the fire alarm, the way he is intensely studying the battery,like how the fuck does this work!? Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033668
>>20033662
So you are waiting for someone to go guns blazing and start shooting? Or are you waiting for some citizen army to gather together?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
57fb08 No.20033669
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e208a3 No.20033670
People, listen up, winter is coming and so is Covid, the new strains.
You MUST get your Covid booster shots, it is imperative.
I had a small reaction to my first shot.
Nothing much just a little bit of pain in my arm and my chest, some heart palpitations, the normal.
I was lucky I got vaxed, because two days later I got covid for the first time. It was awful. Way worse than the small side effects from the vax I had.
After I knew how bad covid was, I was first in line for my second shot. I was prepared for the side effects again, I knew it was worth it. Yeah, that second shot was a doozy. It put me out for three days. I couldn't walk tremors all in my legs. I forgot my cat's name. It was rough. But, I got the second shot just in time, because four days later I got the worst covid ever. I can't imagine how bad it would have been if I weren't vaxed.
After all of that, I was worried about getting the booster shot. I knew I needed it, but I know all vaccines have side effects. I sucked it up and got the booster anyway. The third one was rough. I lost feeling in half my face, my hair came out in clumps, my gums were bleeding, and I could hear the voice of satan in my bathroom. But, I'm so grateful I got the booster. The next day I got covid again.
My left testicle doubled in size and I lost control of my bowels and motor functions, I just constantly flail and piss myself. Turns out I have long covid. It's a nightmare.
Get vaccinated people, covid is no joke.
GET YOUR BOOSTERS!
Do it, just do it, please.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033671
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033672
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033673
>>20033664
>When does a Church…
As soon as the bills are paid.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3bf575 No.20033674
>>20033670
You're glowing brighter than the smoker and BVs
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033675
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
717838 No.20033676
America is not the greatest country in the world in fact America is a toilet full of shit people.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033677
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033678
>>20033668
citizens to gather at the community level
do not let good people fall through the cracks
every man women who serve the government are your enemies, kick them from the community, and never let the traitors to mankind back in.
As a community you have your guns for only when the government and your family members who refused community come to force you you then act on self defense and preservation of life.
If good men quit serving the government, it would fail, but they insist on propping it up for special boy status and trinkets.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033679
>>20033676
Whoa. Speak for yourself. I’m not.
I have money. Money makes me right.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
927fa7 No.20033680
Doctors spot mysterious 'fentanyl exposure syndrome' in BABIES that causes deformed heads, conjoined toes and 'rocker bottom feet' and fingers
Gene testing ruled out known syndromes and maternal fentanyl use was the link
Fentanyl found to cause distinctive facial features, small head, and short stature
READ MORE: Fentanyl deaths have spiked 280% since 2016, CDC report reveals
Doctors have described a constellation of birth defects, including conjoined toes and bent feet, as consequences of expectant mothers using fentanyl while pregnant.
The Delaware-based pediatricians have identified 10 babies with the defects in their state, as well as in California, Boston, and Rhode Island believed to be suffering from fetal fentanyl syndrome.
Their report is the first to uncover a link between the deadly street drug fentanyl currently tearing its way across the country and these birth defects, possibly due to the fact that patients often withhold their history of drug use.
In addition to causing conjoined digits and bent ‘rocker bottom feet’ – named for the way bent feet resemble the legs of a rocking chair – fetal fentanyl syndrome can lead to cleft palate, an unusually small head, and neurological and behavioral issues lasting into adolescence.
Fentanyl has affected millions of lives, and pregnant women are no exception. Deaths caused by the drug, which is 50 times stronger than heroin, more than tripled from 2016 to 2021, rising from 5.7 per 100,000 persons in 2016 to 21.6 in 2021.
Further evidence is needed to prove without a doubt that fentanyl is the cause of these birth defects, which is not yet settled scientific fact. The National Institutes of Health, for instance, said just two years ago that, ‘Based on the studies reviewed, exposure to fentanyl is not expected to increase the chance for birth defects above the background risk.’
But researchers from Nemours Children’s Hospital in Delaware who authored the latest study believed that their ‘striking’ discovery of a common thread between all 10 babies was compelling.
They said: ‘No common genetic or genomic abnormality was identified, but prenatal fentanyl exposure was shared among the pregnancies.
‘Although fentanyl’s effect on cholesterol metabolism has not been directly tested, based on indirect evidence it is biologically plausible that it affects cholesterol metabolism in the developing fetus.’
They posited that when a mother uses fentanyl during pregnancy, the drug disrupts the processes by which the body produces, uses, and eliminates cholesterol, a fat molecule that is essential for building membranes around cells as well as producing hormones and vitamin D.
more at: https://www.dailymail.co.uk/health/article-12827945/mysterious-condition-newborns-conjoined-toes-rocker-bottom-feet.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21240d No.20033682
What no
Golden gavel given graciously gratuitously
From schmuck to kamel
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033683
>>20033662
Your enemy is shooting you with vaccine needles and you're screeching about AR-15s.
Maybe stop being a target instead?
Use your First Amendment right to say, "No thank you."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033684
>>20033670
Do cats really give any shits what humans call them?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033685
>>20033678
So you want towns or whatever to come together?
I’m just trying to understand what you are wanting.
If you want Americans to band together, that’s wishful thinking.
Saying they are losers because they sont want to isn’t fair.
I don’t trust anyone. I’m not joining any group.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b17961 No.20033686
For Incoming Baker @ 295ish
NOTABLES ARE NOT ENDORSEMENTS
#24590 >>20033338
>>20033371 Sephora - woke as Budlight and Target
>>20033376 NYC will charge workers a toll to go to work
>>20033390 Harvard, MIT and Penn testify that Calling for the Genocide of Jews Does Not Necessarily Violate their Campus Code of Conduct
>>20033392 American Thinker: Our Institutions Have Betrayed Our Trust
>>20033402, >>20033404 SC's state investment funds will no longer invest in Disney after its 𝕏 boycott
>>20033417 Study: People Who Complied with COVID Restrictions More Likely to Suffer Mental Health Issues
>>20033423 IDF Chief Suggests Israel May Flood Hamas tunnels with Seawater
>>20033504 @realmuckraker: Military aged US-bound Chinese staging area found at Colombian Hotel
>>20033576 Rep. Thomas Massie(R) accused of anti-Semitism for sharing Drake meme
>>20033592, >>20033598, >>20033627, >>20033630 Campus Anti-Semitism is not new: 2020 Newsweek OP Ed cites DoJ 2019 study, Qatar
>>20033680 Doctors spot mysterious 'fentanyl exposure syndrome' in BABIES
#24590
Collector OUT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033687
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033688
If titties are weapons in a war on malnutrition then women have the right to keep and bare their titties.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033689
>>20033683
You can say anything you want. Except Trump Won. Hahaha. Feels good man
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d1919 No.20033690
>>20033679
>>20033679
I'm doing really well myself but that's not the point I'm talking about Democrats and Rino's destroying America….. Ok!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c85300 No.20033691
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033692
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033694
>>20033524
A witness like Flynn, could hold a position of strength having the goods on them even while the whole fabricated and “fake” Russia, Russia, Russia thing was ongoing, Having the goods on them. And what of Julian, why would not the FBI have checked with him on the source of those leaks given to WL,, by Seth Rich? Could there have been an ongoing investigation that Muller was running that was less public on the entire topic of “America for sale” and “Cheatin Obama”?
Might account for a dog day in AZ. You have more than you know, being will protected.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033695
>>20033683
>Use your First Amendment right to say, "No thank you."
I did
tell the military joiners who follow orders
I was talking about community
ar-15 is just but a tool of defense to a good man, a smart man knows when a uniform comes you are nothing to them, so kill or be killed.
I will not lay down my freedom or unalienable rights just because you did as a cucked pussy looking for peace and security through a uniform and a gun of power.
Fed faggots love to equate standing as killing
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033696
>>20033690
It doesn’t matter what they destroy. We will always be rich and that makes us right. No matter what view we have. We can look out on 10 acres and see our trucks and a tractor and a side by side and all our stuff and just laugh at these poor Americans trying to survive.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0a4bb6 No.20033697
>>20033677
comfy as fuck!
this time line is a great larp
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8bfae0 No.20033698
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033699
>>20033688
“What are assets?”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
121bae No.20033700
>>20033383
Interdasting.
Even Newsweek can't avoid the truth
The Democrats Are Using Lawfare Against Trump Because They Can't Beat Him Fairly | Opinion
Less than one year away from the 2024 presidential election, poll after poll shows President Joe Biden's chances of reelection diminishing. The panicked response of Democrats has ranged from anonymously leaking statements imploring President Biden not to run again to head-in-the-sand denials about his chances of winning. But by far the most dangerous and un-American tool in the Left's political arsenal is their unprecedented lawfare targeting Joe Biden's leading political opponent: President Donald J. Trump.
The Left has chosen lawfare because winning in the marketplace of ideas at the ballot box clearly isn't suitable for today's Democratic Party, which seems to support limitless illegal immigration, inflationary tax and spend policies, and the unconstitutional silencing of opposing voices.
The egregious and norm-shattering lawfare weaponized by the Left against President Trump is unprecedented. Just over the last year, the FBI raided Trump's main residence. He has faced indictments in two separate federal jurisdictions from the Biden administration and received indictments in two local jurisdictions from Democrat District Attorneys. Additionally, the Democrat New York Attorney General, who specifically campaigned with a focus on targeting Trump, filed a civil lawsuit against him.
Democrats have opened up a dangerous Pandora's box by breaking legal and political norms to try to imprison President Biden's chief political rival for 2024. It is irreparably harmful to the fabric of America to normalize the reigning political party using its power to lock up its main challenger.
And make no mistake about it: It's no surprise that the culmination of this legal assault comes amid nonstop polling showing that Americans are angry with Joe Biden's poor performance and supportive of a second Trump administration.
Full article
https://www.newsweek.com/democrats-are-using-lawfare-against-trump-because-they-cant-beat-him-fairly-opinion-1849670
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033701
>>20033695
>I was talking about community
That's communism and anon doesn't care what you have to say about Communism.
You survived and didn't get shot.
Good for you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
0a4bb6 No.20033702
>>20033694
>soon
two moar weeks should do it
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033703
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033704
>>20033692
Damnit Jim, I am a doctor, not a scientist.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20033705
https://twitter.com/DiedSuddenly_/status/1731425646184738924
DiedSuddenly
@DiedSuddenly_
Did you know: There was an actual plan for global population reduction?
One of the main themes of the Died Suddenly series is uncovering the orchestrated effort to depopulate the Earth.
Right now, miscarriages, fetal deaths, and infertility are at the highest rates in history. Before you call us “crazy conspiracy theorists” have a look at the global elites’ own words:
Images of the "instructions to destroy birth rates" documents that are covered:
1. Population Planning by United Nations’ World Bank (1972)
2. Implications of Worldwide Population Growth (‘The Kissinger Report’) by US National Security Council (includes CIA, military, etc.) (1974)
3. Activities Relevant to the Study of Population Policy for the U.S (‘The Jaffe Memo’) by Planned Parenthood on behalf of John D. Rockefeller’s Population Council (1969)
4.) In 2021-2022: We watched as they marketed the experimental Covid Vaccine to pregnant women as “safe and effective” and recommended 3 mRNA shots for babies as young as 6 months old.
It’s not a conspiracy- it’s an extermination.
3:30 PM · Dec 3, 2023
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b2e8b4 No.20033706
Trump won and he's still winning.
>>20033689
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033707
>>20033685
another idiot
you are a loser because you refuse to see or are working against humanity.
You don't trust because those you did lied to you, for the very result you produce, stay stupid, stay stubborn, stay vulnerable.
what a useful idiot.
Are you fat and lazy, afraid of real work, is this why you have given up?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
121bae No.20033708
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033709
>>20033707
so are you a chink or a poo?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d58b82 No.20033711
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033712
>>20033701
Homesteading is how our country use to exist you fucking idiot
I knew that was your tactic, you serve the beast and are enemy of the people.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033713
>>20033707
No. I’m rich and I don’t care. Money makes you right. Sorry sucker. Good luck in your war. I don’t take sides.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20033714
YouTube embed. Click thumbnail to play.
ARCHIVING - BORIS JOHNSON TESTIFYING AT THE U.K COVID INQUIRY 6TH DEC 2023!!
Note: The morning session has been completed, rewind to watch from the beginning and forward through the breaks. anon will write notes later.
==========
UK Covid-19 Inquiry Live Stream
https://youtu.be/YOkKmziko6o
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
81d56c No.20033715
Rumble embed. Click thumbnail to play.
I asked DeSantis if he wears heels! He said No! I asked him how tall he is? He said 5’11”, well he’s been, at most 5’8” all his life, his wife is 5’6” or 5’7”, he’s almost the same height; you don’t grow after the age of 21. BOOOM!!!😂😂😂
2:43
https://rumble.com/embed/v3x0ac1/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033716
>>20033710
Just my opinion but, the more time passes the less effective memes are.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033717
>>20033713
you obviously take the cock though faggot/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033719
>>20033715
He said she said. Worst type of interview
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033720
How many military pussies are here?
>>20033713
The security team thinks they are going to kill you and take the money when the opportunity is presented.
keep it if you can
you head, money comes and goes.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033721
>>20033705
Vaccines are Pesticides
Ethylmercury bromide
Last updated: 13/09/2023
(Also known as: ethylmercuric bromide)
An obsolete organomercury fungicide that was used as a seed dressing on cereals
General human health issues Highly toxic
Published studies confirm the substances carcinogenicity.
https://sitem.herts.ac.uk/aeru/ppdb/en/Reports/2892.htm
Thimerosal and Vaccines
Questions and Concerns
Thimerosal is a mercury-based preservative that has been used for decades in the United States in multi-dose vials (vials containing more than one dose) of medicines and vaccines. There is no evidence of harm caused by the low doses of thimerosal in vaccines, except for minor reactions like redness and swelling at the injection site. However, in July 1999, the Public Health Service agencies, the American Academy of Pediatrics, and vaccine manufacturers agreed that thimerosal should be reduced or eliminated in vaccines as a precautionary measure.
Thimerosal contains ethylmercury
https://www.cdc.gov/vaccinesafety/concerns/thimerosal/index.html
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033722
>>20033717
Don’t care what you think. I got money. I don’t work. I got land. I don’t care. Seethe.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8927c4 No.20033723
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033724
Hubble Still dead. I want my fake CGI space photos
back.https://spacetelescopelive.org/latest
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033726
>>20033720
Yawn. It’s been 27 years. Haven’t seen you yet.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033727
>>20033725
Kek. Seen those.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3b429 No.20033728
Jew news agencies pushing masks…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033729
>>20033722
who cares. It is usually chinks with their beady slanted eyes that care about that shit like it matters, are you a fucking yellow nigger or just the regular variety.?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dddb39 No.20033730
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2c212 No.20033731
fake politicos stealing
Brightline West is a proposed privately run high-speed rail route in the United States linking the Las Vegas Valley and Rancho Cucamonga in the Greater Los Angeles area through the California high desert. The line will connect with existing rail at Rancho Cucamonga station of Metrolink's San Bernardino Line, a commuter rail line in Southern California. The project is intended to provide an alternative to air and automobile travel between Southern California and Las Vegas, a popular leisure destination. Construction on the route is expected to begin in 2023 pending result from a $3.75 billion in grant application from Infrastructure Investment and Jobs Act, which is expected to be announced in October 2023, and revenue service is planned to begin in 2027.-
Read More
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033733
>>20033729
I’m white. Scottish blood. Made money in stocks. Don’t be mad because you didn’t. Be happy for me. I have an awesome country home on 12 acres. Sits back off a rural road. I have an old farm truck. An f150 too. A side by side Polaris and I have a little Buick I take to the store. I don’t have to work because it’s all paid off! I do a little trade here and there.
Sorry dude.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033734
It's going to be a good day today.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033735
Mourning anon.
Tis mourning.
Who mourns the rise of the Sun?
Those whose inescapable destiny is to bake under it?
Sucks to suck, Day Shift.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033736
>>20033733
Suck if some government came and took all that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033737
>>20033733
Pay your property taxes to the king and he will keep letting you use it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
5e0f19 No.20033739
why won't people talk about what is really happening?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033740
>>20033733
still don't care, once you are dead none of it will matter. Sorry dude, that you care so much about gay shit. Also being Scottish is a gay, look at those fucking faggot dresses you wear.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033741
>>20033726
you won't
I don't hunt humans
live by the sword die by the sword
sorry your preference is to murder
your horrors will be visited upon you and your offspring
so you fit right in with the elite, [YOU] fucked your children, good soldier boy, now go do as your told, you fucking slave.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
dddb39 No.20033742
>>20033732
#savethechildrenworldwide
#itendsnow
Is it time to expose Rosenstein/Barsoom? Think on it…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033743
>>20033739
I spent the whole morning talking about the college games last weekend. We are talking.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033744
>>20033739
Censorship and ignorance, but mostly censorship.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033745
What We Know About Elon Musk's Political Views
Story by Maxine Page •
1h
https://www.msn.com/en-us/autos/news/what-we-know-about-elon-musk-s-political-views/ar-AA1l5dCQ?ocid=msedgntp&pc=HCTS&cvid=e696ac5ce6324147af151feda0a44f91&ei=12
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1ecc73 No.20033746
>>20033391
Falls under category what you see on a laptop can be more lethal than the Pfizer vaccine?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033747
>>20033745
"In April 2020, Musk ranted against COVID-19 lockdown measures, claiming they were fascist and unconstitutional. "I would call it forcibly imprisoning people in their homes against all their constitutional rights," Musk told Tesla investors (via NPR). He played down the effects of the virus and persistently called for lockdown to be lifted. "Free America now," Musk posted."
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f1d93 No.20033748
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3b429 No.20033749
>>20033733
Boomers always brag about muh money
Your life is a mirage because you stole your children and grandchildren’s future
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4df127 No.20033750
>>20030637 pb
>>20030637
>>>20030606
>
>Pope Francis Compares Trump to Herod, Who Tried to Kill Jesus
Trump’s Jesus Court Sketch Is Somehow Way Worse Than It Looks
The X (formerly Twitter) account where the post originated belongs to Dominick McGee, a right-wing influencer and QAnon conspiracy theorist who made headlines in July when his account was quickly reinstated after he posted child sex-abuse imagery. The notorious image was made by Peter Gerard Scully, an Australian who was sentenced to life in prison plus 129 years last year for rape, human trafficking, and the sexual abuse of children as young as 18 months. After some of McGee’s more than half a million followers complained that he was banned over his politics, X owner Elon Musk stepped in to reinstate him. As the Washington Post reported, Musk claimed that only X’s content moderators had seen the material, though that doesn’t appear to be the case:
https://nymag.com/intelligencer/2023/10/trumps-jesus-court-sketch-is-even-worse-than-it-looks.html
[DS] is panicking? Patriots over the target?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033751
>>20033747
"He said he was interested in Republican candidate Vivek Ramaswamy, praising him for his libertarian stance"
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033752
>>20033712
>>20033701
>Homesteading is how our country use to exist you fucking idiot
That is what I thought you fucking fed piece of shit, tell jeff to do a fly over today with his fbi heli to see if he can fear me some more?
Or he could just come fight, fucking pussy JTTF bitch boy.
>I knew that was your tactic, you serve the beast and are enemy of the people.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
81d56c No.20033753
YouTube embed. Click thumbnail to play.
Sen. John Kennedy To FBI Director Wray:Who Made The Decision To Raid Mar-a-Lago For Documents?
It seems the Senator is trying to loosen up Wray to answer his real question. Wray seemingly never answers a direct question
I'm not saying there aren't some in – in the Washington office. But the problems we've had with the FBI over the past decade, you've alluded to them, have come primarily out of the Washington office.
I listened carefully to your recitation of your efforts to clean that up. But I think most fair-minded Americans still wonder if there has been real accountability in all cases, and that is the spirit in which I'm going to ask you these questions.
Who made the decision at the FBI to raid Mar-a-Lago for documents?
FBI DIRECTOR CHRISTOPHER WRAY: I'm not sure there's a specific person that made the decision. There was the investigative team that was on that investigation, working with the prosecutors on the case.
SEN, JOHN KENNEDY: Why didn't you just do a consent to search and avoid all the drama? Whoever made the decision?
FBI DIRECTO WRAY: Well, let me try it this way because obviously, we are talking now about not just an ongoing investigation, that is not just an ongoing investigation that is being led by a special counsel, but an ongoing investigation being led by a special counsel that is in front of a court with likely very strong views about what I can say publicly, which gets at some of your gracious comments about public commentary about cases.
But I think, in that particular instance, if you look at the affidavit in support of the search warrant, and more importantly the pleadings that were filed by the prosecutors in the case, they lay out in a very detailed way all the efforts that were made to ensure compliance, short of proceeding to a search. As well as, as now has been charged, actual obstruction of justice. My experience, now speaking more generally now, as a line prosecutor and now FBI director, when it comes to obtaining classified information, retreiving it, we pursue the least intrusive means possible. And if those don't work, certainly if there is obstruction of justice, which in this case has found by a probable cause standard by the judge, it is pretty typical to resort to a search warrant.
Dec 5, 2023
https://youtu.be/4MLZ9zLxneQ
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033754
>>20033745
Based on actual interactions or electronic comms which maybe be from an unauthenticated source?
If Elon doesn't have MPD, then perhaps he has more than one Voice speaking for him depending on the platform or messaging partner?
Is Elon using AI to auto-respond to emails?
It the AI saying something different that Elon is saying?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d62952 No.20033755
>>20033739
then they have to acknowledge that it's real and if they do that, then it's scary because individually they have very little power.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3f92dd No.20033756
>>20033749
what a joke. boomer's kids grew up to be the most spoiled generation in ages and have no one to blame but themselves. spoiled fuckin rotten. so? fuck off
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033757
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a2c212 No.20033758
>>20033731
M Rmoney stressed out
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033759
>>20033749
KEK. Your entitlement makes you weak, and thus blame everything on others instead of your own shortcomings and lack of motivation.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4df127 No.20033760
>>20033750
anon is pretty certain it was Dan the Man who did the Jesus retruth not 45
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
049e83 No.20033761
white wymminns cannot compete with this gorgeous gal
black is the future
once you taste black you can't go back
admit it whitey!
you want it bad
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033762
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033763
>>20033751
“Could we tolerate a national system in which certain people on the basis of a biomarker are segregated?”
https://threadreaderapp.com/thread/1729913580466626893.html
VIVEK
In April 2020, as the U.S. went into lockdown, Ramaswamy said he would be open to that kind of system to determine who could “go back to normal life.” He described it as an “inequity,” but concluded that “everyone stands to benefit from it.” Ramaswamy made the comments during an episode of Rockefeller Client Insights, the podcast of Rockefeller Capital Management.
A concept like that is sharply at odds with the image of the civil libertarian he has cultivated during the primary. It also raises questions about his anti-establishment bona fides.
During the podcast, Ramaswamy talked about different aspects of the coronavirus outbreak with Gregory J. Fleming, the president and CEO of Rockefeller Capital Management. Fleming asked him what a “path to normalcy” might look like, given what he described as a “potentially extended timeline” for the rollout of vaccines and treatments. The country was then more than 15 days into “15 days to slow the spread.”
“One path to normalcy and a path that I’d like to see further progress made on is broad rollout of our antibody tests,” Ramaswamy said. He corrected himself and continued:
“It’s not our company; I’m saying, as a society, rolling out the antibody tests such that we actually get our arms around what portion of the population is already immune through exposures that they may not have even known that they had. It might be 10 percent, it might be 20 percent, we might discover that it is some higher number. Those people are gonna be able to get back to work pretty quickly, get back to normal life because effectively they have the immunity badge, they have a badge in the form of their antibodies that protect them best we know from reinfection.
On the flip side, you then have the people who don’t have immunity, and the question is those who are negative on the antibody tests, what happens with them? Now, this has been—I’ve had discussions in the last few days with policymakers, a couple of people in Congress, one U.S. Senator, and I think this is not lost on folks. But I think one early topic that’s come up is, could we tolerate a national system in which certain people on the basis of a biomarker are segregated? To say you can’t go back to normal life, where certain people get a head start. Is that an inequity we would tolerate? I personally think that it is better than the status quo if we can send 10 or 20 percent of the people back on the basis of having immunity that’s proven on the basis of a lab-based result that’s now available. That’s a good thing, and everyone stands to benefit from it.”
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033764
>>20033757
This isn’t legend. He’s a commercial. If it is t Disney it’s some other company. Elon talks like a stuttering douche.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033766
>>20033761
I bet her grocery bill is large.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3b429 No.20033767
>>20033759
Fuck you Jew…..I worked for my life, your entitlement makes you a POS
The truth hurts boomer feelz
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d8e7f No.20033768
>>20033592, >>20033598, >>20033627, >>20033630 Campus Anti-Semitism is not new: 2020 Newsweek OP Ed cites DoJ 2019 study, Qatar
Found an interdasting lecture while digging on the Muslim Brotherhood/CCP funding universities.
Lecture was in 2011
Infiltration instead of Invasion
>“This can be achieved by infiltrating the American media outlets, universities, and research centers, by working with Islamic political organizations and the sympathetic ones.”
Within the Muslim community, the group vowed to maintain its support for Hamas by collecting funds, hence the formation of the charity the Holy Land Foundation. Yet, at the same time, they sought to spread hatred of Israel and Jews among the American-Muslim community. And one participant was intercepted as saying, “We don’t want the children of the American-Muslim community, who are raised here in our Islamic schools, to grow up surrendering to the issue of peace with the Jews.” Participants discussed how to camouflage such views to the American public and influence policies and opinions. As one attendee argued,“This can be achieved by infiltrating the American media outlets, universities, and research centers, by working with Islamic political organizations and the sympathetic ones.”One participant agreed that hiding the group’s real aims when dealing with the American public was a necessary tactic. “I swear by Allah that war is deception. Deceive, camouflage, pretend that you’re leaving while you’re walking that way.” Another stressed the importance of tailoring the discourse to the American sensitivity. He said, “Let’s not hoist a large Islamic flag.” And he argued that organizations should have nice sounding names, like Holy Land Foundation.
> https://www.fpri.org/docs/media/201112.vidino.muslimbrotherhood.pdf
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033769
>>20033749
>Your life is a mirage because you stole your children and grandchildren’s future
Except they have the military to ensure that it stays the same.
Fucking ignorant sheep
and you pay your taxes and work your days away for evil overlords.
American Idiots
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d34210 No.20033770
Arab sheikhs greet Putin on a Russian scale.
Shooting guns, fireworks, smoke, airplanes, horsemen and camels.
https://t.me/wartimedia/60436
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033771
>>20033764
Haha.
Don’t care.
Not my concern. Not following stars. Funny meme is funny tho.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
589980 No.20033772
>>20033749
I do my best not to fall into the “muh boomers are self centered asshole pawns who fucked it all up”. Then I come home to visit family and watch them continue passing their dysfunctions down the line to the younger generations and I have to start the forgiveness process all over again. Every. Single. Fucking. Time. There is no generation alive who is more unwilling to take responsibility for their actions than theirs. None.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033773
>>20033749
I’m not bragging. I’m saying I’m right because I have money. More money more right. Sorry you disagree but that is because you are poor and wrong.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033774
>>20033769
The Military is funded by fiat, not taxes
Income taxes barely pay the interest on the Fiat.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033775
Psa 118:24
This is the day which the LORD hath made; we will rejoice and be glad in it.
Col 3:15
And let the peace of God rule in your hearts
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033776
>>20033767
Oh, you're that retard that calls everyone a Jew even when they're not because they disagree with you. Not even a boomer, you fucking imbecile. If you're going to display that kind of stupidity this early in the morning then there's no need to see your sorry ass for the rest of the bread. Buh-bye.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033778
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d58b82 No.20033779
>>20033761
i am really tired of sunburning so easy
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033780
>>20033774
does it change slave status?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
558887 No.20033781
>>20033761
goddam she is hot!
I want me some dark meaty poontang
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033782
USSH: All enlisted soldiers and sailors are required to contribute 50 cents each month to the Armed Forces Retirement Homes. https://www.afrh.gov/
Anon ever known anyone to benefit from this mandatory contribution?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3f92dd No.20033783
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9211d1 No.20033784
>>20033553
Many societies have risen and fallen where women weren't voting for anything.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b70561 No.20033785
Elon and Vivek are rich walking hypocrites.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4afff No.20033786
Rare Syndrome After COVID Vaccines Described
— "Long vax" events often include neurologic symptoms
by Judy George, Deputy Managing Editor, MedPage Today December 1, 2023
People who experienced rare long-term adverse events after COVID-19 vaccination often had neurologic symptoms, survey data showed.
Among 241 people who self-reported a post-vaccination syndrome (PVS), the five most common symptoms were exercise intolerance (71%), excessive fatigue (69%), numbness (63%), brain fog (63%), and neuropathy (63%), reported Harlan Krumholz, MD, of Yale School of Medicine in New Haven, Connecticut, and co-authors in a paper posted on the preprint server medRxivopens in a new tab or window. The paper has not been peer-reviewed.
https://www.medpagetoday.com/neurology/generalneurology/107644
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f9a75d No.20033787
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033788
Lam 2:16
All thine enemies have opened their mouth against thee: they hiss and gnash the teeth: they say, We have swallowed her up: certainly this is the day that we looked for; we have found, we have seen it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f3b429 No.20033789
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033790
Who thinks they are the wealthiest anon on this board this morning?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033792
>>20033789
Disagree those sneakers are fresh. And comfy. You are just hating. You will be older one day too.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
558887 No.20033793
>>20033776
Khan wished to create a Master Race
Ih how ironic you use his fictitious image to serve your own purpose,when in reality he would crush you under his boot as unter mensch sub human dross
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033794
Jer 46:10
For this is the day of the Lord GOD of hosts, a day of vengeance, that he may avenge him of his adversaries: and the sword shall devour, and it shall be satiate and made drunk with their blood: for the Lord GOD of hosts hath a sacrifice in the north country by the river Euphrates.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033795
>>20033756
so gen x is the most spoiled generation. Get your fucking chink face out of here you stupid fuck. Better yet just kill yourself you fucking mong.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033796
So great our soldiers are going to follow orders and be oversees while the invaders they allowed in fuck rape steal and kill their families here at home, all for loyalty to lies a beast and trinkets.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4df127 No.20033797
>>20033750
>The notorious image was made by Peter Gerard Scully, an Australian who was sentenced to life in prison plus 129 years last year for rape, human trafficking, and the sexual abuse of children as young as 18 months.
As the New York Post pointed out, this picture was drawn by an Australian man named Peter Gerard Scully, who is currently serving life plus 129 years for rape, human trafficking, and the sexual abusing children as young as 18 months.
https://abovethelaw.com/2023/10/trump-gagged-harder/
well it's possible that there is some sort of confusion … did the world's worst pedo draw the Trump with Jesus pic …
this could be misinfo based on bad reading comprehension, possibly the pedo tweeted pedo stuff retweeted by the QAnon adherent/influencer
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1a5afb No.20033798
>>20033790
I am. More money more right. American way. No one listens to some wagie in a discussion. They only complain.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20033799
>>20033761
bet she does not like nigga's
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033800
>>20033794
blood demon worshiper.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3f771f No.20033801
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033803
Eze 39:8
Behold, it is come, and it is done, saith the Lord GOD; this is the day whereof I have spoken.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033804
>>20033780
The Founding documents, including the Declaration of Independence, the US Constitution and Bill of Rights says that you are Free to Speak and Pursue Life, Liberty and Happiness, beyond many other important things.
Have you read them?
Did you know you were Free?
These are the current Laws of the Land which ALL are obliged to follow, regardless of what some uneducated cop, teacher, or preacher tells ya.
H. Doc. 112-129, The Constitution of the United States with Index and the Declaration of Independence, Pocket Edition or “Pocket Constitution” is a pocket-size booklet containing the complete text of these two core documents of American democracy, the Constitution of the United States and the Declaration of Independence. House Document 112-129, the 25th edition, was printed under the direction of the Joint Committee on Printing.
https://www.govinfo.gov/features/pocket-constitution
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d3632f No.20033805
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033806
>>20033798
I had a friend once that said the measure of a man's worth was in how much money he had. The fat piece of shit died alone and miserable.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9211d1 No.20033807
>>20033761
That's a man.
Look at the fingers.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7cb49a No.20033808
>>20032057 n NASA Currently Tracking 20,000 Or More Near-Earth Asteroids
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6925f1 No.20033809
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7b086 No.20033810
>>20033789
the men's "Daisy Dukes" make the meme. TopKek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033811
Rev 2:16
Repent; or else I will come unto thee quickly, and will fight against them with the sword of my mouth.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
152c78 No.20033812
>>20033796
americucks will die for shlomo
same as always
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21240d No.20033813
https://www.wgauradio.com/news/trending/kamala-harris-breaks-senate-record-most-tiebreaking-votes-by-vice-president/JE737CVF4NBYHJLT7QRQPB7R5Y/
So it's schmuck and kamel in the corner
With a hammer…?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7cb49a No.20033814
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7cb49a No.20033815
>>20033812
shlomo is prancing around in yer little mind
rent free.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033817
>>20033790
I AM
large land, major river, one of the oldest up stream water rights.
Additionally I am a man on the land not a lowly citizen like you fools.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3f92dd No.20033818
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033819
>>20033798
can not take it with you chink.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d34210 No.20033820
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033821
2Ti 4:7
I have fought a good fight, I have finished my course, I have kept the faith:
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9211d1 No.20033823
>>20033791
Were the Jews sent to "concentration camps" while all of the other men were conscripted into the military?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20033824
>>20033762
just like you and your chink family. Hope you die today faggot. See how much all that fake shit gets you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033825
>>20033817
Looks like the king has blessed me more than you. Although it's all his and when he wants it he will take it. You have been blessed with foolishness though. I wish I was as gullible as you to think I own anything.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033826
>>20033823
Prison labor feeding the cannon fodder on the front lines.
Just population reduction things.
This time (WWIII) it's vaccine needles instead of gun barrels.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033827
>>20033815
Pretty much. It's all they're able to talk about. Non-stop hate. 6 years ago, did everyone know how far the Neo-Nazi and Marxist infiltration was? I know I didn't, but after finding this place things became a lot clearer.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033828
>>20033804
>Have you read them?
Yes
Do you understand them?
>>20033817
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033831
Ecc 7:29
Lo, this only have I found, that God hath made man upright; but they have sought out many inventions.
Psa 106:39
Thus were they defiled with their own works, and went a whoring with their own inventions.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20033832
>>20033761
she's wondering How do I work this thing?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
705087 No.20033834
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033835
>>20033829
You don't spread truth, namefag. You shill propaganda, not truth, and have a long track record of doing it, so you get the filter too.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033836
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033837
>>20033825
please ignoramus show me where I used the word OWN.
Feds never poses reading comprehension because they are of their daddy, daddy of lies, a slave to their earthly master, a crab bucket of humanity.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033838
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033839
Psa 106:29
Thus they provoked him to anger with their inventions: and the plague brake in upon them.
Psa 99:8
Thou answeredst them, O LORD our God: thou wast a God that forgavest them, though thou tookest vengeance of their inventions.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c658f5 No.20033840
>>20033837
who is your daddy?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c658f5 No.20033841
>>20033831
sky daddy save me!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033842
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033843
>>20033837
Enjoy your water rights given to you. I truly am happy for you. Don't forget soil health is important on your land. Let the beavers build their dams.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c658f5 No.20033845
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033846
Pro 8:12
I wisdom dwell with prudence, and find out knowledge of witty inventions.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033847
>>20033840
ip hop for that
your a faggot boi pussy bitch
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033848
>>20033338
tyb
tynoter
Dough Iz Mines
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033849
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033854
Guess they're deciding to post MuhJoo today. Alrighty then…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033855
SHUT THE BORDER DOWN BITCHES
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033856
Jer 17:18
Let them be confounded that persecute me, but let not me be confounded: let them be dismayed, but let not me be dismayed: bring upon them the day of evil, and destroy them with double destruction.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9a151b No.20033857
>>20033852
I'm still figuring that out.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21240d No.20033859
So now we are going to a 4. Day weekend
So 3 day work week for whom
Special holidays ?
If you cant dazzle them with Brilliance
Baffle them with BULLSHIT
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
12b94c No.20033861
Rumble embed. Click thumbnail to play.
Ahoy! The Ship Show & Extra Gravy -12/06/2023
https://rumble.com/v3ztu7g-ahoy-the-ship-show-and-extra-gravy-12062023.html
https://rumble.com/embed/v3x8gka/?pub=4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033862
ill bet money the border shuts down..
who wants to place bets?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033863
When the rich men wanna be the poor man.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033864
Psa 40:14
Let them be ashamed and confounded together that seek after my soul to destroy it; let them be driven backward and put to shame that wish me evil.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033868
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20033869
December 6, 2023
9:30 AM EST
Full Committee Hearing: Annual Oversight of Wall Street Firms
Senate Banking, Housing, and Urban Affairs Committee
^
WITNESSES:
Mr. Charles W. Scharf
CEO And President
Wells Fargo & Company
^
Mr. Brian Thomas Moynihan
Chairman And CEO
Bank of America
^
Mr. Jamie Dimon
Chairman And CEO
JPMorgan Chase & Co.
^
Ms. Jane Fraser
CEO
Citigroup
^
Mr. Ronald O’Hanley
CEO
State Street
^
Mr. Robin Vince
CEO
BNY Mellon
^
Mr. David Solomon
CEO
Goldman Sachs
^
Mr. James P. Gorman
CEO
Morgan Stanley
^
https://www.congress.gov/event/118th-congress/senate-event/335204
https://www.banking.senate.gov/hearings/11/29/2023/annual-oversight-of-wall-street-firms
-
Big Bank CEOs Testify at Oversight Hearing
The Senate Banking, Housing and Urban Affairs Committee holds an annual oversight hearing of Wall Street firms, with CEOs from Goldman Sachs, Citigroup, JPMorgan Chase, Bank of America, and Wells Fargo among those testifying.
https://www.c-span.org/video/?532146-1/big-bank-ceos-testify-oversight-hearing
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20033871
>>20033758
RNC
https://art.state.gov/personnel/marina_abramovic/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033875
2Ch 7:14
If my people, which are called by my name, shall humble themselves, and pray, and seek my face, and turn from their wicked ways; then will I hear from heaven, and will forgive their sin, and will heal their land.
>>20033811
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c9b35 No.20033876
>>20033789
Good!
Just so they piss away every nickel they ever earned and not leave a single red cent to their useless millennial and Gen Z spawn!
Fuck em and feed em fish heads!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ca4552 No.20033877
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033878
>>20033843
I am master builder of soil
a permaculturalist
https://tobyhemenway.com/
I steward nearly 2 miles of major river
My water rights will mean nothing when the men of America continue to fail to protect our nation, republic, and freedoms.
The beavers have built some very cool structures this year.
Several tribs and ponds.
Experienced in the old ways I need no power, or technology to sustain my property.
I use them for now, but design all systems closed loop, regenerative, and on natures proven model.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
21240d No.20033879
>>20033865
No …they solved that problem
They taught me to use their rules to my advantage….And I had good teachers
Don't be mad
Get edumacated
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033881
Jer 7:11
Is this house, which is called by my name, become a den of robbers in your eyes? Behold, even I have seen it, saith the LORD.
>>20033814
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
81d56c No.20033883
YouTube embed. Click thumbnail to play.
Marsha Blackburn Grills FBI's Wray About 'Heavily Redacted' Search Warrant For Trump Twitter Account, out of Jack Smith’s crusade, against Trump
5:35
https://youtu.be/9RX-6EluMwo
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033885
>>20033880
Jer 7:30
For the children of Judah have done evil in my sight, saith the LORD: they have set their abominations in the house which is called by my name, to pollute it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d8e7f No.20033886
>>20033768
<“This can be achieved by infiltrating the American media outlets, universities, and research centers, by working with Islamic political organizations and the sympathetic ones.
Just noting the Hill Link in
Q4284 & Q56
>Media Matters
>Muslim Brotherhood
>infiltration - (the universities, media, research centers)
>not invasion
Q4284 > Q58 > Q57 > Q56
56
Anonymous 11/02/2017 16:39:22 ID:KC17sSpZ
4chan/pol: 147661217
http://thehill.com/blogs/pundits-blog/presidential-campaign/292310-huma-abedins-ties-to-the-muslim-brotherhood
The Clinton campaign is attempting once again to sweep important questions under the rug about top aide Huma Abedin, her family ties to the Muslim Brotherhood and to Saudi Arabia, and her role in the ballooning Clinton email scandal.
Her mother, Saleha Abedin, sits on the Presidency Staff Council of the International Islamic Council for Da’wa and Relief, a group that is chaired by the leader of the Muslim Brotherhood, Sheikh Yusuf al-Qaradawi.
Perhaps recognizing how offensive such ties will be to voters concerned over future terrorist attacks on this country by radical Muslims professing allegiance to Sharia law, the Clinton campaign on Monday tried to downplay Ms. Abedin’s involvement in the Journal and theMuslim Brotherhood.
The Clinton surrogate groupMedia Mattersclaimed predictably there was “no evidence” that Ms. Abedin or her family had ties to the Muslim Brotherhood, and that Trump campaign staffers who spoke of these ties were conspiracy theorists.
To debunk the evidence,Media Matterspointed to a Snopes.com “fact-check” piece that cited as its sole source… Senator John McCain. This is the same John McCain who met Libyan militia leader Abdelkarim Belhaj, a known al Qaeda associate, and saluted him as “my hero” during a 2011 visit to Benghazi.
4284
Q !!Hs1Jq13jV6 05/19/2020 13:04:06 ID: d862d9
8kun/qresearch: 9239183
https://thehill.com/blogs/pundits-blog/presidential-campaign/292310-huma-abedins-ties-to-the-muslim-brotherhood
Infiltration not invasion.
For future events.
Q
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033887
>>20033870
You're like millennial blaming all your problems on boomers, like the media blaming all the world's problems on POTUS Trump, like a MuhJoo blaming everything on Jews. It's all the exact same tactic. But I can tell you for a fact that it's you and who pays you, not them. They're your shield. Provides a nice cover from scrutiny to hide behind for obfuscation, a basic look over there not here tactic. You're a fucking fool.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033889
>>20033882
Jer 25:29
For, lo, I begin to bring evil on the city which is called by my name, and should ye be utterly unpunished? Ye shall not be unpunished: for I will call for a sword upon all the inhabitants of the earth, saith the LORD of hosts.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49d146 No.20033890
>>20033382
CRIME - you have to pay $23 a day to be robbed first by the City and then the criminals in New York.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000b52 No.20033892
BIG PANIC in the Senate today. Dems WANT TO KEEP THE SOUTHERN BORDER OPEN. Republicans say NO. No closing our border no money for Ukraine. Fake news interviewing Warner. They all surprised that the Republicans would make a stand.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033893
>>20033891
Jer 32:34
But they set their abominations in the house, which is called by my name, to defile it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
10b0a2 No.20033894
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033896
Jer 34:15
And ye were now turned, and had done right in my sight, in proclaiming liberty every man to his neighbour; and ye had made a covenant before me in the house which is called by my name:
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033897
>>20033894
And you had to IP hop to call me a Jew when I'm not jewish. That's your best? Calling someone something they're not? Playground tactics, but rooted in the inversion your ideology embraces.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033899
>>20033890
Right to Travel will Trump this
5th Ave isn't a Tollroad
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033900
>>20033892
>They all surprised that the Republicans would make a stand.
please do not be so ignorant
They will have a show to put it in your face.
They want you pissed and divided
They will fail you as they have every single time, look at your nation, they have already destroyed it, you can't save that which is destroyed, you just band aide, so they must destroy more to build back better with your favorite master builder 45
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20033903
>>20033504
Chinese have always stuck together and 'secret boarding houses' and secret tunnels to bring them into factories was common generations ago.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033904
Mat 7:27
And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell: and great was the fall of it.
Mat 7:25
And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell not: for it was founded upon a rock.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49d146 No.20033905
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033906
>>20033892
What is wrong with anon going across the border for cheaper prescriptions?
Why is anon expected to wait in a 4 hour line to get back?
Oh Yeah, Big Pharma funds politicians to reee about the Border.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20033908
>>20033731
SWIFT
Financial telecommunication network
The Society for Worldwide Interbank Financial Telecommunication (Swift), legally S.W.I.F.T. SC, is a Belgian cooperative society providing services related to the execution of financial transactions and payments between certain banks worldwide. Its principal function is to serve as the main messaging network through which international payments are initiated. It also sells software and services to financial institutions, mostly for use on its proprietary "SWIFTNet", and assigns ISO 9362 Business Identifier Codes (BICs), popularly known as "Swift codes".-
Read More
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
df2b5e No.20033910
Hos 10:12
Sow to yourselves in righteousness, reap in mercy; break up your fallow ground: for it is time to seek the LORD, till he come and rain righteousness upon you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c969b0 No.20033911
Anons, I took a close look at Alina Habba before she became Trump's lawyer and she appeared to be just an average woman with excellent boobs for the most part but now after being in Trump's inner circle for a while she has blossomed into an exciting attractive woman.Would love to meet her.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033913
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033914
>>20033906
>Why is anon expected to wait in a 4 hour line to get back?
because those you trust the most lie to you, and you won't accept truth for the comfort of the lie.
Military
daddy
state
church
brother
bible
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2bc917 No.20033915
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033918
>>20033895
Was jesus gonna slaughter some "sacred cows" with that metaphysical sword?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033920
>>20033911
45 does now how to market and promote sex money and power.
Consumers buy
circular
promoters make the dough
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033922
They spam the board with hate towards Jews to make it seem like that is the board consensus, it is not. Not even close. They need to constantly post it because propaganda and lies need constant reinforcement and visibility to work.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033923
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c9b35 No.20033925
>>20033761
>>20033761
Nothing sexy about an ass like a rodeo bull!
And those greasy, stinking rat ropes hanging off it's head completes the disgusting Wakanda image.
That butch negress should be pulling a plow!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2bc917 No.20033926
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20033927
>>20033918
read Revelations and get back to us.
each time you read it you get a spiritual boon, some say.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033928
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
f7b086 No.20033929
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49d146 No.20033930
>>20033911
If a women has an attractive figure, it's not a crime.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b11fcc No.20033932
>20033919
global report sub.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033933
>>20033763
More: https://threadreaderapp.com/thread/1730024852851962166.html
Pedro L. Gonzalez
Pedro L. Gonzalez
@emeriticus
Nov 30
Vivek is responding to my reporting. He isn’t being honest. He didn’t just say something “stupid” on a podcast. He sent members of Congress a memo advocating against lifting lockdowns and for creating a national registry. A company he created pitched the idea to the FDA and worked with the federal government on it.
Here’s a timeline:
-February 2020: Datavant, a healthcare data company created by Vivek, recruits George W. Bush-Era FDA Commissioner Andrew von Eschenbach.
-March 2020: Datavant begins spearheading a registry of COVID-19 patients by pooling medical records from across the country (WSJ).
-April 3, 2020: Vivek says on the Rockefeller Client Insights podcast that he supports a system where people would be “segregated” under a national testing regime.
-April 8, 2020: Datavant is in touch with the FDA about a “proposed registry” that “would aim to include every patient who has been tested for COVID-19” (WSJ).
It was around this time that Vivek circulated the memo I obtained to members of Congress in which he argued against lifting lockdowns and for implementing universal testing to determine who could go back to life. He concluded by proposing a “public-private” partnership, which is what his company Datavant pitched to the federal government.
-November 2020: Vivek’s company announced that it was collaborating on gathering patient data with the National COVID Cohort Collaborative, which is funded by the National Institutes of Health’s National Center for Advancing Translational Sciences.
Vivek didn’t just support lockdowns—he tried to profit from it while collaborating with the very “regime” he claims to oppose. Then he tried to bury it, like he tried to bury details about his background by paying a Wikipedia editor to sanitize his biography weeks before declaring his candidacy.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d58b82 No.20033934
>>20033925
weave, weave, it's not fair
give the horses back their hair!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033936
>>20033929
"Touch-n-go's"
Kek
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033937
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8c9b35 No.20033938
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033939
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2bc917 No.20033940
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000b52 No.20033941
>>20033900
Back off Sandra. Take a deep breath.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033942
>>20033928
6 years of spamming "truth" but yet why isn't it accepted? When it was given its own board it withered and died. It's not truth. If it was truth it wouldn't have to be forced down everyone's throats day after day, year after year, decade after decade. People know the truth. It's why Q's posts were accepted and your narrative never is except by the gullible.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033943
>>20033935
>>20033927
Anon just reads current Law, like the Constitution and Stuff because trusting in the truth serves anon pretty decently.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033944
@505give or take
#24590 >>20033338
>>20033371 Sephora - woke as Budlight and Target
>>20033376 NYC will charge workers a toll to go to work
>>20033390 Harvard, MIT and Penn testify that Calling for the Genocide of Jews Does Not Necessarily Violate their Campus Code of Conduct
>>20033392 American Thinker: Our Institutions Have Betrayed Our Trust
>>20033402, >>20033404 SC's state investment funds will no longer invest in Disney after its 𝕏 boycott
>>20033417 Study: People Who Complied with COVID Restrictions More Likely to Suffer Mental Health Issues
>>20033423 IDF Chief Suggests Israel May Flood Hamas tunnels with Seawater
>>20033504 @realmuckraker: Military aged US-bound Chinese staging area found at Colombian Hotel
>>20033576 Rep. Thomas Massie(R) accused of anti-Semitism for sharing Drake meme
>>20033592, >>20033598, >>20033627, >>20033630 Campus Anti-Semitism is not new: 2020 Newsweek OP Ed cites DoJ 2019 study, Qatar
>>20033680 Doctors spot mysterious 'fentanyl exposure syndrome' in BABIES
>>20033383, >>20033700 The Democrats Are Using Lawfare Against Trump Because They Can't Beat Him Fairly
>>20033705, >>20033721, >>20033786 @DiedSuddenly_
>>20033714 BORIS JOHNSON TESTIFYING AT THE U.K COVID INQUIRY 6TH DEC 2023
>>20033753 Sen. John Kennedy To FBI Director Wray:Who Made The Decision To Raid Mar-a-Lago For Documents?
>>20033861 Ahoy! The Ship Show & Extra Gravy
>>20033869 Full Committee Hearing: Annual Oversight of Wall Street Firms Senate Banking, Housing, and Urban Affairs Committee
>>20033883 Marsha Blackburn Grills FBI's Wray About 'Heavily Redacted' Search Warrant For Trump Twitter Account, out of Jack Smith’s crusade, against Trump
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
81d56c No.20033945
YouTube embed. Click thumbnail to play.
John Kennedy Grills FBI Director Wray About Hunter Biden Laptop Story. FBI violated the 1st Amendment of Free Speech by making Social Media limit or censure “disfavored speech”!With threats of government actions. You had 80 agents working on this with Social Media.
Wray is so slippery and not honest about what they did.
5:58
https://youtu.be/AExMV1fpZA4
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20033946
>>20033935
I wasn't messaging you, faker.
you us a sacreligious name.
I have no interest in your snarky putdowns.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033947
>>20033892
And this is why I always vote republican. They truly are the patriots of this nation.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033948
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033950
the ultimate discipline
goto vegas
dont gamble
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033952
>>20033946
It's either Afterthought or the Ghoul just using another persona. A retard either way.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000b52 No.20033954
>>20033892
OH NOES. That means not only will Ukraine not get it's $70 billion WE HEADED FOR A GOVERNMENTSHUTDOWN
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
46200b No.20033955
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4f044 No.20033956
>>20033949
Not sure how you can watch anything with hanks or from hollywierd with our "new" eyes?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033957
>>20033950
Why not.
Consider the time spent as a expense.
Like watching a live show
With more of a chance to leave your seat with some of your money than Front Row tickets at Barry Manilow.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
aa9bf0 No.20033959
>>20033892
It’s complete nonsense that these two issues are tied together in any way.
If you care about America and the American people at all you would fix the border issue.
If you care about peace at all you would stop sending billions to Ukraine. You won’t even audit where all of that money has gone because why?
The American government, and most certainly Congress, hate America and are doing everything they can to destroy it. It’s right in front of you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20033960
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033961
>>20033942
It was a question, not my narrative.
Do you believe Hamas attacked Israel Ewok style storming of the wall? Are you serious?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033962
>>20033950
im rather travel around on public transit smoke weed, meet people @ 3a.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1973a No.20033963
>>20033930
AT SOME POINT PRESIDENT TRUMP NEEDS TO MAKE A DECISION
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
121bae No.20033964
>>20033911
Anon believes you're Habba, attempting to get a following from Anon Army.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033966
>>20033953
The banking system has never failed to make things right with Anon. Only ever had one unsolvable banking problem and that was with a Credit Union. When anon doesn't like Bank Policy, Anon changes Banks.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
27cee3 No.20033967
God bless you and keep you from harm, this day and forever.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20033968
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
121bae No.20033969
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033971
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
121bae No.20033972
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20033974
>>20033967
You can put down your sword maurice, didn't you hear, its astriods season.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20033975
>>20033952
if it were what it's name pretends it could just post the messages right into our consciousnesses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033977
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033978
>>20033950
>It was a question, not my narrative.
A question within the narrative you're paid to post. You're just trying to be fiddly with words now to avoid being put on the spot. That you had to copy another Anon's mannerisms was the first tell. The 2nd was the namefagging. The 3rd was dancing around MuhJoo (I'm not touching it, I'm not touching it) and pretending you're not. Fuck off, Absolute Retard.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20033980
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033981
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b11fcc No.20033982
https://t.me/s/techno_fog
Evidence that Special Counsel Jack Smith intends to introduce at Trump's DC trial -
Trump's support of those accused of J6 crimes - and his discussions of J6 pardons
Trump playing the songs of the imprisoned J6 Choir at his rallies.
Unreal.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1973a No.20033983
>>20033964
She doesn't need us anons when Trump gives you a birthday cake at Mar A Lago.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
121bae No.20033984
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033985
>>20033911
Did you Detailer disapprove your request to transfer to a different P__syOp, and tell you to try harder instead?
Also, did you get paperwork for being late to work yesterday?
You're over 15 minutes late today which is a 300% increase in your being late to work since yesterday.
Anon is very disappointed in your commitment to your PsyOp and if you can't do better, anon must insist you be either re-trained to provide better PsyOp results, or worst -case scenario you be made redundant and have your duties outsourced to ChatGPT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033986
>>20033950
Dude, I tagged the wrong post. Disregard my previous one.
>>20033961
see
>>20033978
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
450328 No.20033987
YouTube embed. Click thumbnail to play.
GOOD MORNING DAYSHIFT!!!
Some Morning Vibes to start the day off right
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033988
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033991
>>20033972
Does that document protect you from criticism? Of your lies being exposed for what they are? That's what I thought.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20033992
>>20033978
Tag the correct post at least.
No. Not paid to post.
Zionist narrative is finished.
Not believing they’re bullshit any more.
You do you.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20033994
>>20033992
Already corrected. You missed the correction it seems. >>20033986
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20033995
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20033997
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20033998
>>20033979
>>20033970
>chose faith over science.
You put "faith" in $cience
Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20033999
>>20033941
Yes feds are here and they want you to stand down so they can fuck the country over for benefits.
But I will not stand down fuck you traitors.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034000
Zelenskyy cancelled his meeting with the senate and today the MuhJoo doubles-down. I don't think that's a coincidence.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b1973a No.20034001
>>20033909
>>20033909
When you get past the proxy server you'll the NSA runs this board. Jim Watkins needs to pay the bills or stay out of the clink one of the two.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034002
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034004
>>20033999
>Yes feds are here and they want you to stand down so they can fuck the country over for benefits.
They want to scuttle this board is what they want. They can't go against the truth or debate truth against their propaganda and narratives so they have to try and infiltrate. Majority of the kitchen now, but still no ability to ban. Now they just spam, it's all they have.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034006
https://twitter.com/LD_Sceptics/status/1732029053375311878
The Daily Sceptic
@LD_Sceptics
Genomics scientist Kevin McKernan has lost an entire database of research worth $200,000 after the New Zealand health service obtained an injunction to prevent the sharing of leaked Covid vaccine health data.
7:28 AM · Dec 5, 2023
https://dailysceptic.org/2023/12/05/kevin-mckernan-loses-entire-database-of-research-worth-200000-after-new-zealand-health-service-obtains-injunction-to-prevent-sharing-of-leaked-covid-vaccine-data/
Kevin McKernan Loses Entire Database of Research Worth $200,000 After New Zealand Health Service Obtains Injunction to Prevent Sharing of Leaked Covid Vaccine Data
U.S.-based genomics scientist Kevin McKernan says he has lost an estimated $200,000 worth of research data after his account on file hosting service MEGA was deleted overnight.
It appears that McKernan’s account was deleted by MEGA in response to an urgent injunction granted to New Zealand’s (NZ) Ministry of Health (MOH) to prevent the sharing of anonymised data leaked by whistleblower Barry Young.
Young, a 56-year-old database administrator and former employee of the MOH, leaked data from a ‘pay per dose’ Covid vaccine database to NZ journalist Liz Gunn and U.S. tech millionaire and Substacker Steve Kirsch.
Both Gunn and Kirsch claimed that the data showed conclusive proof that the Covid vaccines are killing people at high rates. Kirsch publicly uploaded the data on Friday December 1st, the same day the injunction was granted to the MOH.
McKernan had ‘mirrored’ Kirsch’s data upload on his MEGA account to make it easier for people to download and analyse after international confusion broke out following the sensationalised release, which brought the integrity of whistleblower’s data into question.
Having heard that an injunction had been granted to the MOH to prevent further distribution of the NZ data, McKernan says that he texted Kirsch to get clarity on Monday December 4th, but did not hear back.
In a thread posted to X on Tuesday December 5th, McKernan says he woke up to find that his entire MEGA account, including medical genome sequencing and vaccine sequencing data, with an estimated value of $200,000, had been suddenly deleted. McKernan is one of the leading scientists involved in researching DNA contamination in the mRNA Covid vaccines.
“There is pure irony in this. Private company who puts sequence data public of medicinal plants and fungi to help the world, gets attacked by a public health agency that won’t share the taxpayers’ data… Wrong side of history,” wrote McKernan, who heads up medical cannabis company Medicinal Genomics.
McKernan also warned that some of the deleted files were related to criminal court proceedings. “We are assessing the damages… this should get very interesting,” he wrote.
On December 2nd, Kirsch reported that the site where he was hosting the NZ whisteblower data, Wasabi, had turned off his account without notice, speculating that “maybe it was because the New Zealand Ministry told them to take down my site as noted in this article”.
Concerned parties report that despite requesting to see the wording of the injunction since it was granted late last week, their requests were refused. The injunction was only made publicly available at 6pm on Tuesday December 5th, NZ time.
p1
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20034008
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034009
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20034010
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034011
>>20034005
Being chosen is just another one of their lies.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a6e082 No.20034012
MOTHCERFUCK"N D5!
SNOBALL TIME BITCHES!
iT'S A BEAUTIFUL DAY TO BE ANON
MERRY CHRISTMAS!
even to the haters and losers who can't handle appropriate caps lock
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034013
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034015
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034016
>>20034005
I mean, if you're going to copy my mannerisms (don't deny it), try and talk about other things that just Jews. Obsessive adherence to what you're paid to post is your tell. Evil hiding behind something else.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e640d1 No.20034017
>>20034000
poor Basterd can't afford a commercial flight
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034018
>>20034006
The injunction was awarded by the Employment Relations Authority, which Voices For Freedom NZ Head of Legal Katie Ashby-Koppens suggests has “acted outside its remit” and therefore does not have the power to make such orders against third parties or in other jurisdictions.
“There are grounds for challenging this injunction,” says Ashby-Koppens, noting Kirsch’s public assurances that the released data have been anonymised and so pose no threat of breach of privacy.
Conspicuously, in the flurry of New Zealand media articles reporting on the data leak and the injunction, no Ministry of Health representative has suggested that the data leaked by Young is fabricated or in any way false.
Young has reportedly been charged with “accessing a computer system for dishonest purposes” and was scheduled to be released on bail at 1pm today.
MEGA has been contacted for comment.
This article was originally published on Dystopian Down Under, Rebekah Barnettt’s Substack newsletter. You can subscribe here.
Stop Press: Steve Kirsch warns: “The law doesn’t matter to hosting providers such as Wasabi and MEGA. These firms will disable access to your data and destroy your data based on their opinion and they are not liable for the loss of your data. … MEGA judges Kevin to have made a gross violation. It never spoke to him. You are guilty if its staff think you are and MEGA does not want to hear your side of the story. Nuke first, no need to ask any questions. … Avoid MEGA and Wasabi. They can terminate your account and refuse to give you access to your own data. If you are using them, cancel your account now and move to a different provider.”
2 of 2
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034021
>>20034014
there is no dark side of the moon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034022
>>20034007
Look, when someone shits in your house, do you clean it up or just leave it because it's truth?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034023
NEW: Iran court orders US to pay $50 billion for Soleimani assassination
https://twitter.com/TheInsiderPaper/status/1732395466481099221
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034024
10:00 AM EST
Transnational Repression: Authoritarians Targeting Disssenters Abroad
Senate Foreign Relations Committee
^
WITNESSES:
Mr. Christo Grozev
Investigative Journalist
Co-Founder, Bellingcat Productions
New York, New York
^
Mr. Michael Abramowitz
President
Freedom House
Washington, D.C.
^
Ms. Caoilfhionn Gallagher KC
International Legal Counsel to Jimmy Lai
Doughty Street Barristers
London, England
^
https://www.congress.gov/event/118th-congress/senate-event/335203
https://www.foreign.senate.gov/hearings/transnational-repression-authoritarians-targeting-disssenters-abroad
-
Hearing on Transnational Repression
The Senate Foreign Relations Committee holds a hearing on foreign governments that repress journalists and activists abroad, and how the U.S. government can more effectively counter this threat.
https://www.c-span.org/video/?532251-1/hearing-transnational-repression
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e640d1 No.20034025
>>20034006
for the life of me can't figure out why these people can't figure out that it all has to be dumped the first time
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034026
10:00 AM EST
Housing Affordability: Governmental Barriers and Market-Based Solutions
House Financial Services Committee
^
WITNESSES:
Mr. Seth Appleton, President, U.S. Mortgage Insurers (USMI)
^
Mr. Norbert Michel, Vice President and Director, Center for Monetary and Financial Alternatives, CATO Institute
^
Dr. Emily Hamilton, Senior Research Fellow and Director of the Urbanity Project, the Mercatus Center at George Mason University
^
Ms. Arianna Royster, President, Borger Residential, on behalf of the National Apartment Association (NAA)
^
Ms. Diane Yentel, President and CEO, National Low Income Housing Coalition
^
https://www.congress.gov/event/118th-congress/house-event/116635
https://financialservices.house.gov/calendar/eventsingle.aspx?EventID=409062
https://www.youtube.com/watch?v=6aaIUamf89M
-
Housing Sector Stakeholders and Policy Advocates Testify on Housing Affordability
Housing sector stakeholders and policy advocates testify on housing affordability before the House Financial Services subcommittee.
https://www.c-span.org/video/?532252-1/housing-sector-stakeholders-policy-advocates-testify-housing-affordability
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
705087 No.20034027
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034028
10:00 AM EST
Supreme Court October Term 2023 Argument Day
^
Muldrow v. St. Louis (22-193)
^
Supreme Court
https://www.supremecourt.gov/oral_arguments/2023TermCourtCalendar.pdf
https://www.supremecourt.gov/oral_arguments/argument_audio/2023
-
Muldrow v. St. Louis Oral Argument
The Supreme Court hears oral argument in Mudrow v. St. Louis, a case concerning Title VII employer discrimination.
https://www.c-span.org/video/?531894-1/muldrow-v-st-louis-oral-argument
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034029
HELLo to everyone joining anons from The Hole.
"The Hole" is the name of a detention building—also known as the SP Hole, the A to E Room, or the CMO Int trailers—operated by the Church of Scientology on Gold Base, its compound near the town of Hemet in Riverside County, California, United States. Dozens of its senior executives have been confined within the building for months or years. Wikipedia
Architectural style Two double-wide trailers linked together
Location Gilman Hot Springs near Hemet, California
Coordinates 33.835134°N 116.988715°W
Owner Church of Scientology
Known for Degrading confinement of Scientology executives
https://en.wikipedia.org/wiki/The_Hole_(Scientology)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034030
10:00 AM EST
Markup of The Protect Liberty and End Warrantless Surveillance Act
House Judiciary Committee
^
H.R. _ Bill Text - the Protect Liberty and end Warrantless Surveillance Act
https://www.congress.gov/118/meeting/house/116659/documents/BILLS-118HRih-U1.pdf
^
H.R. _ Amendment in the Nature of a Substitute
https://www.congress.gov/118/meeting/house/116659/documents/BILLS-118-HR-A000370-Amdt-1.pdf
^
https://www.congress.gov/event/118th-congress/house-event/116659
https://judiciary.house.gov/committee-activity/markups/markup-protect-liberty-and-end-warrantless-surveillance-act
https://www.youtube.com/watch?v=gp_ilyjknLc
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c28540 No.20034031
>>20033985
>>20033984
100% weakFag with horrible trolling skills.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d9554 No.20034032
i give up and don't give a fuck anymoar
some of my family still want to get another clot shot
fine, do it if you want
go vax yourself to heaven
fucking millenials!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034034
>>20034029
Map of Gold Base. The location of the Hole is marked as "SP Hole" near the top left of the map.
https://en.wikipedia.org/wiki/The_Hole_(Scientology)#/media/File:Gold_Base_map.png
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034035
Free speech does not mean right to be heard. Free speech means freedom to lie, but it doesn't mean others have to accept that lie, no matter if you call it truth.
Truth is a force of nature, set it free and it can take care of itself. Propaganda and lies need constant reinforcement with repetitive messaging.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20034036
It will be telling if the funding is cut off from those who might be monitoring this board (and screwing with the scripts so that often the bread seems to 'blink' and the typing and scrolling are slower) . . . if after their funding is cut if the breads will suddenly be free of the squabble shill simulents who pose here as if they are in battle with each other and snark back and forth about nonsense, post constantly porn and drwelling responses, and suddenly come up with new personalitie names and spam them like 'aglo' (reverse) who I just first read the name yesterday.
it will be telling if the faker-shills will be here if that funding really gets cut.
And as for those who post constantly with their anti-somebody hate: if the world were as simple as you pretend, that what religion you are was a simple 'tell' as to if or if not you're a good person, there would be no need for any religious to ever educate their young: the 'good ones' would be good without any education.
but we know that's not true.
the world view of 'all of them are bad, all of us are good and holy' is about the most bogus point of view you could ever espouse.
and yet you see it here from one who pretends with a name to be one of the triune people of the trinity.
and that sacreligious presentation is a guarantee, some would say, that the person using that name will have a come-uppance.
It's sad that these bogus personas are here doing their divide and defile bit.
Every time they do it they add more logs to the fire. What fire? What fire is that?
they'll find out.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034037
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d9554 No.20034038
>>20034032 me
forgot to mention, one of them is studying medicine
so much for future doctors
fuck them all
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034040
>>20034034
Gold Base
Good Boyz
Glenn Beck
GB
72 (bolo) 72 is Code for Mormon Mafia
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034041
>>20034022
You make the shitter pick it up and never let him back in.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034042
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20034043
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e8cdea No.20034044
>>20033967
Mornin' Swordanon
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034045
>>20033183 lb
so kimdotcom has the data somewhere?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20034047
>>20034004
>Majority of the kitchen now, but still no ability to ban. Now they just spam, it's all they have.
Maybe you are right
I more think they are making the final list before maneuvers.
I will be attacked by force before the majority due to tactical property and location.
I have zero fear and am ready for the battle, and only thing left to be determined is if they lose some assets along the way (traitors and infrastructure)
I don't care that they know me, nor do I care if they force me to death defending my contracts. They kill for the edits of law fare, traitors to all good and decent men.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034049
>>20034034
Cine Castle (Golden Era Production)
SP Hole (Hell?)
Massacre Canyon Inn Dining Hall (shitty bread?)
https://upload.wikimedia.org/wikipedia/commons/4/43/Gold_Base_map.png
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20034050
>>20034035
is that why bible fags have to keep saying shit? To keep their brainwashing in tact?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034051
Judge Denies Jack Smith's Request To Conceal Documents In Trump Classified Materials Case
https://twitter.com/zerohedge/status/1732406585018765688
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034052
>>20034036
Desperation makes people do strange things. You can already see the stress and exasperation coming through in their posts. Day by day it gets closer, they know its closer, and know there's nothing they can do to avoid it. Some have already chosen targets to try and take down along with them.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034053
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034054
>>20034035
a dominion system will never reveal the truth willingly, as it will destroy said system
thus, secrecy and hierarchies persist.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034055
https://twitter.com/CBS_Herridge/status/1732395741820178942
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034056
>>20034048
I wouldn't know, I don't have a basement or a dad.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20034057
>>20034032
seriously hard to get your head around this situation.
Anon has been through this like many other anons here who were shunned by family and frens due to vax.
the only thing anon has stated to them is do not get any moar vaxx's.
but they went ahead cos muh holiday's and psyops.
What anon had to realize is that they are now literally the walking dead and their time is short so may as well spend time with them when they want to, cannot force them to do anything.
their venom directed at anon has not made anon back off from them. The door is open if they are civil,
Stay in prayer and hope their souls are expected due to ignroance, probably not but we can only advise without judgement.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d4afff No.20034060
NZ Vaccine Data Whistleblower “Drops Truth Bombs” in First Interview Following His Release From Prison.
BY PATRICIA HARRITY ON DECEMBER 6, 2023
Barry Young was a data administrator for the Ministry of Health in New Zealand (NZ) and had access to many people’s vaccination data. He turned whistleblower on the 30th of November, due to his concern with what the statistics were showing. By Saturday his alarming disclosure went viral worldwide and on Sunday his home was surrounded by police, his home was raided and finally he was arrested. The NZ government was said to have been “left scrambling” to cover this event up by limiting media coverage in New Zealand and even claiming they have injunctions to prevent all internet providers sharing this data release.
Mr Young appeared in court on Monday the 4th of December, where he received “rapturous” applause from many supporters who packed out the court gallery. He, however, was not released on bail but was held in an NZ prison for a second night and only released on Tuesday.
https://expose-news.com/2023/12/06/302126/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034061
>>20034049
"Executives who eventually escaped from the Hole have said that its occupants wereforced to practice group confessions in which they would confess supposed transgressions against Miscavige, bad thoughts that they had had about Scientology and disclose their sexual fantasies.[15] Cook, who spent seven weeks in the Hole in 2007, said that "most of the time the activities [in the Hole] were either you confessing your own sins or bad things that you'd done, or getting other people to confess theirs."[3] Rinder commented on the bizarre personal dynamics of the Hole: "These were your friends, people you had traveled with. But then, you get in the Hole? You can't trust anybody."[17]"
https://en.wikipedia.org/wiki/The_Hole_(Scientology)
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034062
>>20034055
Translation:
FBI is planning to conduct unprecedented levels of terror withing the U.S. until we start shelling out large sums of cash to Israel.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034063
>>20034058
I don't project. I don't need to. I find it distasteful anyways. Straight shootin', son. You should try it sometime.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3b9f1a No.20034064
>>20034006
Guess that's what you get for trusting The Cloud services. Not surprised. Why doesn't he have on prem back up if it was so valuable??
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034065
>>20034059
I never refresh, your posts are still on my bread.
Shills removers haven't figured this out.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034067
>>20034059
I never refresh, your posts are still on my bread.
Shills removers haven't figured this out.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49d146 No.20034068
>>20033930
Everything else pales when you have a good traditional wife.
Just have a jack off over Alina and calm your tits.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034069
>>20034061
Church of Scientology International v. Debbie Cook
In January, 2012, Scientology brought a lawsuit against Cook for defamation after she sent an e-mail to 3,000 Church members criticizing its fundraising methods.[30][31] The lawsuit against her was quickly settled without payment by any side on April 23, 2012, after Cook was permitted to testify for three hours regarding her description of conditions at the Hole.[32]
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20034071
>>20034010
if jesus was (dead or had offspring)….->
NOT
->
Jesus is Lord!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d94ece No.20034072
>>20033928
your "truth" contains NO truth at all. It is pure hate.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034074
>>20034046
>but don't sit around pretending to be a bastion of truth, because you are not.
Never said I was, but I don't prop myself up as a namefag, spend nothing but posting about Jews in some form, against I should say, and claiming bullshit. Pepe is MOS now, huh? You're a chucklefuck retard clown. And no, I won't filter you, I'll make you earn your paycheck.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3b9f1a No.20034075
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034077
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034078
Italy Exits China's Silk Road Initiative Citing 'Lack Of Expected Results'
https://twitter.com/zerohedge/status/1732411109414404537
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
49d146 No.20034079
>>20033933
Trump and Vivek had businesses - that is not a crime, unless you are a New York Judge. He is not denying he had a hedge fund and pharma company…
Even I was okay with the 15 days to cool of the virus and shit in the beginning - it took a few weeks after that to figure out it was STUPID SCIENCE…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034080
I need to pull back. Approaching berzerker mentality towards the shills. Not going to go there again. I will be better than that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9e23b6 No.20034081
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034082
>>20034069
Ex-Clearwater Scientology officer Debbie Cook testifies she was put in 'The Hole,' abused for weeks
SAN ANTONIO, Texas — Scientology executive Debbie Cook was on the phone with church leader David Miscavige when she heard someone pounding at her office door at a church compound in California.
Not wanting to hang up on her angry boss, who was complaining about her performance, she didn't answer the knocks. The pounding stopped, but someone was prying open her office window. Two male church employees crawled in.
"Are they there?" Miscavige asked.
Yes, Cook answered.
"Goodbye," the church leader said.
The men took Cook away to a place called the "The Hole," two doublewide trailers on the church's 500-acre California compound where, other high-ranking church defectors have told the Tampa Bay Times, Miscavige sent underperforming executives. The windows were covered with bars, and security guards controlled the only exit, Cook said.
Cook said she was held there seven weeks with more than 100 other Scientology executives. They spent their nights in sleeping bags on ant-infested floors, ate a soupy "slop" of reheated leftovers and screamed at each other in confessionals that often turned violent. For two weeks, she said, Miscavige had the electricity turned off as daytime temperatures in the desert east of Los Angeles topped 100 degrees.
Cook testified Thursday that the experience in the summer of 2007 gave her nightmares and was part of the reason she was so eager to leave the Scientology staff later that year and sign a severance agreement never to speak ill of the church.
"I would have signed that I stabbed babies over and over again and loved it. I would have done anything basically at that point," she said during several hours of sworn testimony in San Antonio district court.
She described a 12-hour ordeal at the California base where she was made to stand in a trash can while fellow executives poured water over her, screamed at her and said she was a lesbian.
She said she saw Miscavige attack church executive Marc Yager, punching him in the face and wrestling him to the ground. She also recounted how church executive Mark Ginge Nelson was punished for objecting to violence he saw in "The Hole."
Cook said she saw Nelson taken to another room, where he was beaten by a Miscavige assistant and two other men for two hours. She said Nelson also was made to lick a bathroom floor for at least 30 minutes.
Cook said Miscavige once ordered his secretary to slap her, and she fell over into some chairs. She said he also ordered his communication officer to break her finger. The officer bent it back, she said, but did not break it.
Another time, she said, Miscavige marched around a large conference table looking as if he wanted to choke her but ended up grabbing her shoulders and yelling at her.
In May 2007, Cook got a reprieve from "The Hole" when she was summoned back to Clearwater to help Miscavige prepare for a major church event that would attract 2,000 Scientologists to Ruth Eckerd Hall. She worked there several more weeks, rejoining her husband, church staffer Wayne Baumgarten, but not telling him what happened in "The Hole." She said it would have been "very treasonous" to say anything.
https://www.tampabay.com/news/scientology/ex-clearwater-scientology-officer-debbie-cook-testifies-she-was-put-in-the/1214690/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034083
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20034084
Victor Hansen and Carlson are ready to get you guys to fight, and you will fall for the traps your appointed hero's gleefully set.
Trump says biden gonna die, watch more conservatives get arrested instead.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1d8e7f No.20034085
notable
>>20033715
> BOOOM!
Roasted!
PBD roasts Desancuts for Bootgate
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034087
>>20034076
I was responding to your deleted post, Absolute Retard. You weren't sure? Of course you weren't. I don't believe that you're playing dumb, I know you are.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2c2aad No.20034088
Janet Ossebaard, Creator of “Fall of the Cabal” Series, Is Missing and Is Feared to Have Committed Suicide
https://wltreport.com/2023/11/29/janet-ossebaard-creator-fall-cabal-series-is-missing/
Any Anon following this?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034090
>>20033928
truth is called antisemitism. catch up. kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034091
https://twitter.com/WallStreetApes/status/1680280755279216640
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ab328 No.20034092
Q team,
40/60 is not enough. Respectfully, it feels like holding truths from us is exactly what the bad guys are doing. And I'm tired of people being viewed a certain way and looked down upon. If no one is above another in this movement we deserve more truth. It is understandable some truth would collapse society, but you can't tell me that's 60% worth. People need to learn some hard truths. There is no way forward and learning from mistakes if they are kept from us. People deserve to know the truth. 70/30.Thank you.
- Tired of being viewed as inferior
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034095
>>20034092
>Q team,
Quorum of Mormons
Not frenz
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20034096
>>20034089
50 namefag posts gets a filter.
must be a karen
FILTARD
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034097
>>20034086
Because it's been exposed for what it is. You want to go unscathed posting MuhJoo then go over to the controlled platform know as Halfchan, That sort of posting is encouraged there. Here you will get called out on it for the blatant bullshit that it is.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034099
>>20034089
What does parakletos mean?
why namefag?
just curious
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20034100
they flood the board with squabbling nonsense and imagery latent with subliminal revulsive ideas, and attack anyone at all who isn't of their team, and then they get all upset because their patterns are recognizable and get washed off the sidewalks with 'delete bleach'.
it is' like when I was out in the yard, I saw some turkey droppings or some such on the lawn and cleaned it by picking it up with a plastic bag, and so that way I won't step on it. If it weren't in a place where people might walk, I probably wouldn't' care.
but very many people use these breads, look for notables.
the idea that the squabble-shill simulations and constant ethnic attacks are 'free speech' is laughable. Yes, in a venue where it was theirs what they post is 'acceptable' and if the government deleted it that would be a kind of censorship. But letting those turkeys fill all the breads up with their mind-scat and ethnic hate would be letting them drive away all the other users of the board. It would create a situation where most of what people saw when they came here was turkey-scat from the minds of these creeps who do their squabble shilling here.
They get to post.
they get to say 'deleting me is immoral', meanwhile saying all kinds of stuff designed to subvert (and thus effectively censor) all the other users of the board.
so they support the virtual censorship of the board by flooding it which is called 'censorship through stack overflow' and then claim that they are being oppressed for the very flood that they cause.
If there is turkey scat on the traveled way, it's best to clean it up.
and if the turkey scat is in the woodland? off in the field where few people go?
then who cares.
no, it's not censorship to delete their mind-scat, it's called sanity. It allows these boards to not be completely horror shows.
yes, it's sad that it has to be that way.
but these incontinent jerks, unable to keep themselves from defecating their mind scat with each post they post, made it necessary.
the only bad part is that the record of their depraved behavior is lost so that their accusations can be put forward about how they were so poorly treated.
and yet when you see what they post, does anyone really care if they hadn't seen it?
So I say: the turkey scat is where the people walk, so it gets cleaned up.
they will tell me I'm not a patriot for supporting censorship, but I don't support it.
What I do understand is that if you go into a bar, for example, and start fights with everyone, you get bounced from the bar.
that's is the moral equivalence of what happens to these turkey-scat posters when they get deleted.
I've always said that it would be nice if there were a way that their scat posts could be moved over to some other side bread place, instead of just deleted. And then that way people could review the work of the BV who do the deletions and see 'huh, ya, this crap that is deleted really is mind-farts and meanness'
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20034101
>>20034010
[P]ers
Judeo-Persian refers to both a group of Jewish dialects spoken by the Jews living in Iran and Judeo-Persian texts (written in Hebrew alphabet). As a collective term, Judeo-Persian refers to a number of Judeo-Iranian languages spoken by Jewish communities throughout the formerly extensive Persian Empire, including the Mountain and Bukharan Jewish communities.[2]
The speakers refer to their language as Fārsi. Some non-Jews refer to it as "dzhidi" (also written as "zidi", "judi" or "jidi"), which means "Jewish" in a derogatory sense.[2]
Jude 9
King James Version
9 Yet Michael the archangel, when contending with the devil he disputed about the body of Moses, durst not bring against him a railing accusation, but said, The Lord rebuke thee.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d74618 No.20034102
Russian AF RSD501 Special Flight Detachment-this is VP and departed Dhabi and heading to Riyadh,SA to meet with MBS and discuss OPEC+ cuts, muh Ukraine, Gaza, Syria, Yemen
Putin Meets UAE Ruler on Rare Trip to Shore Up Gulf, Oil Ties
https://www.bloomberg.com/news/articles/2023-12-06/putin-meets-uae-ruler-on-rare-trip-to-shore-up-gulf-oil-ties
Putin makes rare trip outside Russia for OPEC talks with Saudi Arabia
https://www.msn.com/en-us/news/other/putin-makes-rare-trip-outside-russia-for-opec-talks-with-saudi-arabia/ar-AA1l5NN1
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ab328 No.20034103
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034104
>>20034099
>parakletos
Some Latin bullshit from a Vatican idolater?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034105
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
6f6be7 No.20034106
>>20034080
been there myself. It happens.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
8281db No.20034107
…
Oppenheim's idea of "waving space-time" is based upon asking why gravity should have a quantum nature like that which has been discovered for the universe's other fundamental forces — electromagnetism, and the strong and weak nuclear forces. Gravity, he argues, isn't like these other forces. After all, it is the only one of the four that can define the very geometry of space-time, and the fields of quantum physics evolve upon this geometry.
…
"We feel gravity because matter causes space-time to bend. Time flows at unequal rates at different locations," Oppenheim writes in a paper discussing his theory published in the journal Physical Review X. "The rate at which time flows and the causal structure [the fact that cause always precedes effect] it provides may be required to have a classical description in order for quantum theory to be well-formulated."
https://www.space.com/wavy-space-time-theory-quantum-mechanics-general-relativity
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d3e97 No.20034108
>>20034057
Unfortunately 100's of thousands died in a similar fashion in Nursing Homes, Hospitals and Other wards around the country. Those that vaxed their kids are now dealing with a 5% myo/peri carditis conditions. Life expectancy 20 years from successful treatment. Many have relatives that got suddenly dead, when they realize how they were lied to and that the medical community knowingly did this, the anons with compassion and reason are all that stands between a hate that will burn down hospitals, cities and governments.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9a151b No.20034109
>>20033913
>>20033913
"when you talk about destruction, don't u kno that you can count me out."
bible talks about destroying the earth and making a new.
NWO talks about destroying the people via watever' they can manipulate.
yeah, i agree with him.
you can count me out.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
450328 No.20034111
>>20034099
>parakletos
Paraclete (/ˈpærəkliːt/; Greek: παράκλητος, romanized: Paráklētos) is a Christian biblical term occurring five times in the Johannine texts of the New Testament. In Christian theology, the word commonly refers to the Holy Spirit and is translated as 'advocate', 'counsellor' or 'helper'.
https://en.wikipedia.org/wiki/Paraclete
Just filter the namefag and move on
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20034113
>>20034079
This timeline is longer than a few weeks. Would you have been fine with some people passing an antibody test and being able to go back to normal while those that don't are to be segregated?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034114
China is engaged in a campaign of low-level coercion to control disputed spaces by using a steady progression of incremental steps while avoiding armed conflict to secure its aims.
https://twitter.com/NavalInstitute/status/1732370284538118464
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
174b85 No.20034116
>>20033762
You might want to spend some of that money buying a little humility. You are seriously lacking
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034117
>>20034092
Q team is angels & God and they aren't sure what to do. Current decision is to destroy Earth (see astroid storm posted above) because its too fucked up to clean.
sorry
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034118
Sequencing of bivalent Moderna and Pfizer mRNA vaccines reveals nanogram to microgram quantities of expression vector dsDNA per dose
Sequencing of bivalent Moderna and Pfizer mRNA vaccines reveals nanogram to microgram quantities of expression vector dsDNA per dose
Kevin McKernan, Yvonne Helbert, Liam T. Kane, Stephen McLaughlin
Medicinal Genomics, 100 Cummings Center, Suite 406-L, Beverly Mass, 01915
This preprint can be downloaded here
Several methods were deployed to assess the nucleic acid composition of four expired vials of the Moderna and Pfizer bivalent mRNA vaccines. Two vials from each vendor were evaluated with Illumina sequencing, qPCR, RT-qPCR, Qubit™ 3 fluorometry and Agilent Tape Station™ electrophoresis. Multiple assays support DNA contamination that exceeds the European Medicines Agency (EMA) 330ng/mg requirement and the FDAs 10ng/dose requirements. These data may impact the surveillance of vaccine mRNA in breast milk or plasma as RT-qPCR assays targeting the vaccine mRNA cannot discern DNA from RNA without RNase or DNase nuclease treatments. Likewise, studies evaluating the reverse transcriptase activity of LINE-1 and vaccine mRNA will need to account for the high levels of DNA contamination in the vaccines. The exact ratio of linear fragmented DNA versus intact circular plasmid DNA is still being investigated. Quantitative PCR assays used to track the DNA contamination are described.
Introduction
Several studies have made note of prolonged presence of vaccine mRNA in breast milk and plasma (Bansal et al. 2021; Hanna et al. 2022; Castruita et al. 2023). This could be the result of the stability of N1-methylpseudouridine (m1Ψ) in the mRNA of the vaccine. Nance et al. depict a vaccine mRNA synthesis method that utilizes a dsDNA plasmid that is first amplified in E.coli prior to an in-vitro T7 polymerase synthesis of vaccine mRNA (Nance and Meier 2021). Failure to remove this DNA could result in the injection of spike encoded nucleic acids more stable than the modified RNA. The EMA has stated limits at 330ng/mg of DNA to RNA (Josephson 2020-11-19). The FDA has issued guidance for under 10ng/dose in vaccines (Sheng-Fowler et al. 2009).
Residual injected DNA can result in type I interferon responses and can increase the potential for DNA integration(Ulrich-Lewis et al. 2022).
Results
To assess the nucleic acid composition of the vaccines, vaccine DNA was deeply sequenced using two different methods. The first method used a commercially available New England Biolabs RNA-seq method that favored the sequencing of the RNA but still presented over 500X coverage for the unanticipated DNA vectors (Figure 1 and 2). The RNA-seq assemblies had truncated poly A tracts compared to the constructs described by Nance et al. The second method eliminated the RNA with RNase A treatment and sequenced only the DNA using a Watchmaker Genomics fragment library kit. The DNA focused assemblies delivered vector assemblies with more intact poly A tracts (Figure 3).
These assemblies were utilized to design multiplex qPCR and RT-qPCR assays that target the spike sequence present in both the vaccine mRNA and the DNA vector while also targeting the origin of replication sequence present only in the DNA vector (Figure 3). The assembly of Pfizer vial 1 contains a 72bp insertion not present in the assembly of Pfizer vial 2. This indel is known for its enhancement to the SV40 promoter and its nuclear localization signal (Dean et al. 1999) (Moreau et al. 1981).
p1
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034119
If you can't burn something man-made because it's "sacred" you've just created an Idol of the Idol Worshipping Variety.
And no, burning 1 bible symbolically is not the same things as "Demanding" all your Bibles be burned.
Flip through your old picture albums with 2023 lens and see what "The Communist Community Standards" would have to say about YOUR family pics that were developed at Walmart.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c25b4 No.20034120
>>20034088
https://goldenageofgaia.com/2023/11/30/report-on-janet-ossebaards-disappearance/
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2b8969 No.20034123
>>20033763
>>20034079
Even trying to get policymakers and Congress to follow it..
>I’ve had discussions in the last few days with policymakers, a couple of people in Congress, one U.S. Senator, and I think this is not lost on folks.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20034124
Stupid fuckers vote harder
Vote harder = build back better consent
Remake our government is what a patriot does, not serve the slave master and call it freedom.
All uniforms serve the beast to kill and force another into agreement and servitude.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034127
>>20034122
Mockingbird Shills
All posing as "The Promised One"…
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034128
>>20034118
Figure 1. A Moderna vector assembly of an RNA-seq library with a spike insert (red), Kanamycin resistance gene (green) driven by an AmpR promoter and a high copy bacterial origin of replication (yellow).
Figure 2. Pfizer bivalent vaccine assembly of the RNA-seq library. Annotated with SEB/FCS, spike insert (red), bacterial origin of replication (yellow), Neo/Kan resistance gene(green), F1 origin (yellow) and an SV40 promoter (yellow and white).
Figure 3. RNase treated vaccines were shotgun sequenced with Illumina (RNase-Seq not RNA-seq). Pfizer vectors from vial 1 (left) and vial 2 (right) contain a 72bp difference in the SV40 promoter (green and light blue annotation). qPCR assays are depicted in pink as Spike probe and Ori probe. The RNase sequencing provided better resolution over the Eam1104i linearization site and the Poly adenylation sequence. The vectors differ in the length of the polyA tail (likely sequencing artifact) and the 72bp indel.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7cb49a No.20034129
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
96b3b2 No.20034131
that's going to make yo momma proud. Stay out of kerfuffles and don't act like no bee. You can fool some Sumerians sometimes but you can't fool mom.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3b0163 No.20034133
How will this play out?
China invades Taiwan
If US interferes they activate their soldiers that have infiltrated the southern border?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d37f20 No.20034134
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034136
so the thing with rituals is, they are bs.
most obvious reason is that rituals annoy God in the flesh since years.
stop rituals. stop cooking.
there might be a great explanation I gave to one crowd, still it is not ever ok to just hand me over to the next crowd where that explanation would be "needed". do you understand I and with that you work throughout times and realms?
Eloi Eloi. have me feel comfy in every house and let me more only upon my own request.
there might be some folks to be convinced in a crowd mixed together in a smart appearing way, like a tune almost fitting a crowd, but not only experience but I myself say that it is not ok whatsoever to indroduce me to folks who have that little knowledge that they talk itself is hurtful, like a ritual done irl in a way it reduces my joy, trust, love and capability to assume you all nice.
ritual is not gonna do it. those that know that I myself am that guy, those here and now, those that I consider guilty for their actions, they know I do not like being annoyed and do not like worlds being "driven" with screaming (have posted so hundreds of times, love always. most important, love me.), they know for a human being that I undoubedly am, it is unlikely to turn my mind to "forgive all" bc you showed up in a white car or made me scratch my arm or whatever else bs.
For my own sake and the sake of creation, yes, except for far out "Luke" (where things are not a thing) all that is is made by me, throughout time.
I really want to forgive you, and did so hundreds of times, but truth is, if you do not want to make me hate and be ridicluled all day, you should restrain yourselves from certain things done around me in a ritualistic way until I myself have found a way to assume you nice again.
and again, there is no such thing as equality.
check in your mind: a small village with 50 nice fols vs a small village with 50 mean folks.
also there is no such thing as truth placement irl.
you are supposed to lurk at bulk data so to do comms into other times/realms, you are not support to do self build holy stuff with science.
there is no need for noise for tracking, this is done bc some of you (those doing it) think I should be tortured and it´s done bc others who do not exactly have things do not really know what love is and might go for the next best thing, being turture by voltage in my heart. does fit your location story? how about when I tell you I myself can decide and would not want a way to find me that is turture? how about when I tell you I really am all time and have talked to alot and know for a fact it´s not locating or anything but torture?
silence and respect.
If you are placed on "he will suffer" then you better moved yesterday or asked those overseeing why that is a thing in the first place.
again, am happy to help and did so many times, happy to explain why rich folks are nice and that I want you to acknoweledge 33,000 mails are fake.
what I do not want is for you to expect it and force it, you cannot force God and have to go through that one son to ask a humble request.
that being said, I am that little baby (stable is anything for God himself that, now, surprisingly for some, seemed to have choosen to "be") and I will not dwell in a world where I will have to show how smart I am or shout at you every months.
what I do not allow is for you to ask any kind of question like I am a ape in a zoo only to be poked with a stick, I am creating existence right now, are you sure it turs out better with your much annoying guidance?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034137
>>20034126
I'm just a human person, God will do as he chooses. I have no influence.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
a18296 No.20034138
>>20033944
TYB!
> >>20033390 Harvard, MIT and Penn testify that Calling for the Genocide of Jews Does Not Necessarily Violate their Campus Code of Conduct
Anon kinda sees the logic of this.
2nd Amendment: a gun is just an object, it's the use of it that can be the crime, i.e., an action.
1st Amendment: speech is just speech, it's actions that are crimes, i.e., someone hearing the speech and then deciding to do harm.
Not supporting hatred at all. Just, can see the Constitutional logic of their argument.
Such interesting times.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034139
>>20034006
>>20034045
>>20033553
nutty fanatic.
mania
maybe you should pass a mental health test in order to vote?
>>20034046
cry moar.
another mental heatlh victim or FED
>>20034045
deleted from MEGA means kimdotcom still has it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3b0163 No.20034140
>>20034134
Wow, wave after wave
DNA activations for those vibrating high love frequency’s
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034142
>>20034136
STOP DOING RITUALS.
all harbors are closed. there are no boat rides whatsoever.
those that go against my surpreme decision will be held accountable.
all you will do is pray for me to do fine while you treat everyone with love and respect and make them feel comfort and trust, that is my law.
one nice house without any discomfort at all.
priorities being:
- no turture.
- money.
- silence and respect.
- my fam as a bubble.
- noone around me doing rituals.
- neighboorhood God´s and Lord´s either supporting only my goals or doing nothing at all, as folks who I can see in tv is more convenient anyway.
- neither doing nor communicating bad shit, like war or any of that stuff that I, as a 30+ year old actual guy did not do.
- no bumping of any sort
- no rituals of any sort other than you meeting up and discussing what symbolic shit kept you from doing good
- those that hate me may obviously be, I do not care and hope I help them with bread in the future, however they cannot be allowed close to the holy and pure (that is a timing thing) temple that I myself am.
Mark 12 30:
Love the Lord your God with all your heart and with all your soul and with all your mind and with all your strength.
Start your day with a prayer that you want the actual Lord to have a very nice day.
Go to bed with a prayer that I shall have an awesome day the next day as per to my wishes.
THERE WILL BE NO ANNOYANCE WHATSOEVER.
MAKE SURE OF THAT, WITH PREFERABLY EXPLANATION, BUT MAKE SURE.
to whom it may concern:
are you that stupid to assume that some collected bits of truth, sorted together in an amateur or maybe even willfully blind way, would give you the right to ask me any question like it was your place?
how can you dare to even think you could understand?
do you understand the knowledge I have by now can in parts not be expressed using language anymore?
NO MORE BOAT. NOT EVER E BAKE. NO RITUALS OF ANY SORT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d3e97 No.20034143
>>20034092
Unfortunately more than 40% will melt down society. The pure hatred of the Normies when they understand the full depth of deceit, evil infiltrated into every aspect of life. I use to want 80% disclosure and after going down the rabbit/rat holes my anger has not abated, but I know in my heart any hope of reconciliation would be destroyed. Hard truths even at the 40% level will send seismic shocks through the world. Culling the evil will leave gaps in the societal machinery that will be chaotic for a couple of years until laws, elections, just jurisprudence and wealth is restored.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
edeca0 No.20034145
>>20034010
>>20034101
>>20034071
Exodus 20:25
King James Version
25 And if thou wilt make me an altar of stone, thou shalt not build it of hewn stone: for if thou lift up thy tool upon it, thou hast polluted it.
Luke 24:39
King James Version
39 Behold my hands and my feet, that it is I myself: handle me, and see; for a spirit hath not flesh and bones, as ye see me have.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034148
>>20034128
Figure 4. Local alignment of Pfizer vial 1 to Pfizer vial 2 vectors highlights the 72bp tandem duplication in blue.
Figure 5A. Close inspection of the Integrative Genome Viewer (IGV) demonstrates the appearance of a 72bp insertion that is heteroplasmic in Pfizer vial 2. The upper left IGV view is a zoomed-out view where the colored marks depict the indel. The lower Left IGV view shows inverted paired reads as the 72bp insertion is a tandem repeat and paired reads shorter than 72bp can be mapped two different ways. Upper Right IGV view demonstrates a read coverage pile up or ‘Plateau’. This occurs when the reference has one copy of the 72bp repeat and the sample has 2 copies. Note- In the upper right IGV depiction, the sequence in Vial 1 is in the opposite orientation in IGV as Vial 2. Lower right IGV view is a zoomed view of the upper right IGV screen.
Since the two Pfizer vials share the same lot number, finding a heterozygous copy number change between the two vials is unexpected. It was hypothesized that the appearance of a heteroplasmic copy number change is instead the result of the Megahit assembler collapsing what is actually two copies of the 72bp sequence into a single copy due to the insert sizes in the sequencing libraries being too short (105bp). It is noteworthy that the longer paired-end reads in the library resolve the 72bp tandem repeat.
When references have a single copy of the 72bp repeat and the sample has two copies of the repeat, reads should pile up to twice the coverage over the single copy 72bp loci as seen in Figure 5A. To test this hypothesis, we added a second 72bp sequence to the shorter plasmid assembly and observed that the reads map without artifact and no evidence of heteroplasmy (Figure 5B).
Figure 5B. IGV view of the read coverage over Pbiv2_k141_23 shows a discrete 72bp plateau in coverage (red rectangle). Editing the Pbiv2_k141_23 reference to include 2 copies of the 72bp sequence, and remapping the sequence data to this corrected sequence shows that the coverage over both vectors is more normal with no coverage plateau in Pfizer vial 2.
These data conclude that all Pfizer vectors contain a homoplastic 2 copy 72bp SV40 Enhancer associated with more robust expression and nuclear localization. The initial heteroplastic indel was an artifact of the Megahit assembler and short insert libraries.
To estimate the size of the DNA, the purified vaccines were evaluated on an Agilent Tape Station™ using DNA (genomic DNA screen tapes) and RNA based (high sensitivity RNA tapes) electrophoresis tapes.
Agilent Tape Station™ electrophoresis reveal 7.5 - 11.3 ng/µl of dsDNA compared to the 23.7 -55.9ng/µl of mRNA detected in each 300µl sample. Qubit™ 3 fluorometry estimated 1-2.8ng/µl of DNA and 21.8ng - 52.8ng/µl of RNA. There is higher fragmentation seen in the DNA electrophoresis. The total RNA levels are less than the anticipated 30ug (100ng/µl) and 100ug (200ng/µl) doses suggesting a loss of yield in DNA and RNA isolation, manufacturing variance or RNA decay with expired lots.
p3
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034149
>>20034134
those that need proof are living outside of reality.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034151
>>20034141
A Days Pay is all any man wants.
Bread is for feeding birds.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20034152
>>20034108
Watching the covid inquiry in the u.k with boris making excuses.
not only did boris fuck up during the covid period he will never be forgiven for stopping the peace talks between between ukraine and russia which could have saved thousands of lives on the battlefield, including energy deaths, starvation, destruction and destruction.
The only justice will to hang his whole family especially his father for treason and crimes against humanity for siding with china and the globalists.
The only lessons learned from this democide is that they cannot be trusted and do not represent the citizens.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9ab328 No.20034153
>>20034143
I'm probably being impatient and you're right.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034154
>>20034138
tru dat
free speech is free speech
action is diff story
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3c2a86 No.20034156
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034159
I'm leaving a trail of breadcrumbs..
I purposely trigger fraud algorithms which gets my accts placed under suspicion. Which is impossible to deter.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20034160
>>20034146
>>20034146
>With enough faith=onecan move mountains
awesome
now do it on video and show us like jesus did so we can believe
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20034161
>>20034129
Norman Lear? Dead?
the guy who turned television sitcomss into horrible and divisive bitch-scolds is dead?
made Television suck and acted like anything of America that didn't fit the marxist narrative was horrid?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d74618 No.20034162
>>20034127
Over (60) by nao post faggit
Use yer “projection” meme…you know the one with pseudo fake “celebrity” sprinkling what left of his customer base and wouldn’t know a business plan if it crawled up ass so using that one is the perfect compliment to your identity
No surprise you identify with it so easily
Muh hall monitor
Such a waste of bred
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034163
@670give or take
Last Call
#24590 >>20033338
>>20033371 Sephora - woke as Budlight and Target
>>20033376 NYC will charge workers a toll to go to work
>>20033390 Harvard, MIT and Penn testify that Calling for the Genocide of Jews Does Not Necessarily Violate their Campus Code of Conduct
>>20033392 American Thinker: Our Institutions Have Betrayed Our Trust
>>20033402, >>20033404 SC's state investment funds will no longer invest in Disney after its 𝕏 boycott
>>20033417 Study: People Who Complied with COVID Restrictions More Likely to Suffer Mental Health Issues
>>20033423 IDF Chief Suggests Israel May Flood Hamas tunnels with Seawater
>>20033504 @realmuckraker: Military aged US-bound Chinese staging area found at Colombian Hotel
>>20033576 Rep. Thomas Massie(R) accused of anti-Semitism for sharing Drake meme
>>20033592, >>20033598, >>20033627, >>20033630 Campus Anti-Semitism is not new: 2020 Newsweek OP Ed cites DoJ 2019 study, Qatar
>>20033680 Doctors spot mysterious 'fentanyl exposure syndrome' in BABIES
>>20033383, >>20033700 The Democrats Are Using Lawfare Against Trump Because They Can't Beat Him Fairly
>>20033705, >>20033721, >>20033786 @DiedSuddenly_
>>20033714 BORIS JOHNSON TESTIFYING AT THE U.K COVID INQUIRY 6TH DEC 2023
>>20033753 Sen. John Kennedy To FBI Director Wray:Who Made The Decision To Raid Mar-a-Lago For Documents?
>>20033861 Ahoy! The Ship Show & Extra Gravy
>>20033869 Full Committee Hearing: Annual Oversight of Wall Street Firms Senate Banking, Housing, and Urban Affairs Committee
>>20033883 Marsha Blackburn Grills FBI's Wray About 'Heavily Redacted' Search Warrant For Trump Twitter Account, out of Jack Smith’s crusade, against Trump
>>20033945 John Kennedy Grills FBI Director Wray About Hunter Biden Laptop Story. FBI violated the 1st Amendment of Free Speech by making Social Media limit or censure “disfavored speech”
>>20034006, >>20034018, >>20034060, >>20034139 Genomics scientist Kevin McKernan has lost an entire database of research worth $200,000 after the New Zealand health service obtained an injunction to prevent the sharing
>>20034023 Iran court orders US to pay $50 billion for Soleimani assassination
>>20034024 Transnational Repression: Authoritarians Targeting Disssenters Abroad Senate Foreign Relations Committee
>>20034026 Housing Affordability: Governmental Barriers and Market-Based Solutions House Financial Services Committee
>>20034051 Judge Denies Jack Smith's Request To Conceal Documents In Trump Classified Materials Case
>>20034078 Italy Exits China's Silk Road Initiative Citing 'Lack Of Expected Results'
>>20034088 Janet Ossebaard, Creator of “Fall of the Cabal” Series, Is Missing and Is Feared to Have Committed Suicide
>>20034102 PF Russian AF RSD501 Special Flight Detachment-this is VP and departed Dhabi and heading to Riyadh,SA to meet with MBS and discuss OPEC+ cuts, muh Ukraine, Gaza, Syria, Yemen
>>20034107 Oppenheim's idea of "waving space-time" is based upon asking why gravity should have a quantum nature
>>20034114 @NavalInstitute China is engaged in a campaign of low-level coercion to control disputed spaces by using a steady progression of incremental steps while avoiding armed conflict to secure its aims.
>>20034118, >>20034128, >>20034148 Sequencing of bivalent Moderna and Pfizer mRNA vaccines reveals nanogram to microgram quantities of expression vector dsDNA per dose
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034164
>>20034110
Tranimae/Loretta
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3c2a86 No.20034165
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
4c43f6 No.20034166
I saw you come in the pipeline
now call the phone Jeff
threaten me on the phone or in a text JTTF
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
022e6c No.20034167
>>20034000
>>20034017
Pay for anon ticket, so anon
can testify, Trump should have his presidency reinstated.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034168
>>20034133
They were supposed to invade from Mexico/Canada and underground tunnels using Russian marked vehicles/equipment.
Then take Taiwan.
Limited nuke exchange with Russia.
Hillary would then surrender for us.
America divided and handed over to the victors.
And the rest of us hauled off to concentration camps.
But now… because we know… we wait for the perfect kill shot.
One and done.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
75446f No.20034169
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034171
>>20034138
just make-up the rules as they go along
Like Engornon
It's called "Equity" theory of law. whatever they think is just, is what passes as law.
Think "Inquisition Justice"
Why our ancestors left the old World.
Millions of newly arrived seem to have brought their 3rd World justice system with them.
Coincidence?
Think of it:
Not even a meme war anymoar, since the shills here have no memes.
what happened to them?
The creative ones were converted and then quit?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034172
>>20034158
Bread is the ultimate shit-multiplier.
And when the state owns the primary source of fertilizer for the wheat production, more shit is more money.
Bread and water is punishment rations for prisoners.
Men and Women need FOOD including MEAT and spices and fats and herbs and roots and flowers and fruits and dairy and more for a Nutritious Well Balanced Diet.
"Enriched/Fortified" food ingredients that have been stripped of their natural nutritive value, make people sick and fat.
With Money, and man can mix up the kind of meal his Digestive Constitution needs for his life.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034173
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034174
>>20034148
Figure 6. Agilent Tape Station™ electrophoresis demonstrates 23.7ng/µl – 55.9ng/µl of RNA (left). 7.5ng-11.3ng/µl are observed on DNA based Tape Station™. While the DNA electropherogram shows a peak suggestive of a full-length plasmid, this sample is known to have high amounts of N1-methylpseudouridine RNA present. DNA hybrids with N1-methylpseudouridine mRNA may provide enough intercalating dye cross talk to produce a peak. The sizing of the peak on the RNA tape on the left is shorter than expected. This may be the results of N1 methylpseudouridine changing the secondary structure or the mass to charge ratio of the DNA.
Quantitative PCR assays were designed using IDTs Primer Quest software targeting a region in the spike protein that was identical between Moderna and Pfizer spike sequences and a shared sequence in the vectors’ origin of replication. This allowed the qPCR and RT-qPCR assessment of the vaccines. qPCR only amplifies DNA while RT-qPCR amplifies both DNA and RNA. Gradient qPCR was utilized to explore conditions where both targets would perform under the same cycling conditions for both RT-qPCR and PCR (gradient PCR data not shown).
Figure 7. qPCR of Pfizer’s bivalent vaccine with and without DNase I (left) and RNase A (right). Untreated mRNA demonstrates equal CTs for Spike and Vector assays as expected. Vector is more DNase I sensitive than the Spike suggesting the modRNA may inhibit nuclease activity of DNase I against complementary DNA targets. RNase A treatment doesn’t alter the qPCR signal.
Figure 8. RT-qPCR amplifies both DNA and RNA. The untreated samples show a large CT offset with Pfizer Spike and Vector assays (Left Blue versus Green). This is anticipated as the T7 polymerization should create more mRNA over spike than over the vector. Small 1-2 CT shifts are seen with DNase I treatment. This is expected if the DNA is less than equal concentration of nucleic acid in RT-PCR. RNase treatment (Right) shows a 10 CT offset but doesn’t alter the DNA vector CT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034176
>>20034170
perhaps the great King was more popular than we are led to believe?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
1f8102 No.20034177
>>20034146
I've done my part.
Noah's arc was too small so no boat this time.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034178
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
96b3b2 No.20034180
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034182
Make them wait 4 hours
fill them with bread baskets
serve small portions
Charge huge prices
Restaurant Management 101
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d74618 No.20034183
>>20034133
It will start with some incident with Japanese Coast Guard in the island just NE of Taiwan.
The US security pact requires our military to defend/support Japan
Then no direct clash
Chinese aren’t stoopid enough to walk in the front door so it will be China Coast Guard and Japan CG that kicks it off
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034184
>>20034175
doubt if it was "for the Jews"
numbskull
you do that on purpose, don't you?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034185
>>20034175
Did you know using straw men arguments are a hallmark of shills? You're flailing. You're desperate. You're losing.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034186
>>20034179
Wholewheat sourdough isn't too bad in moderate doses.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9a151b No.20034187
YouTube embed. Click thumbnail to play.
a good laugh at the unreal.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3c2a86 No.20034188
>>20033410
Dear Lord in Heaven repair mine eyes…
I hath clicked that shit!
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
877b04 No.20034190
>>20034122
>Parakletos, helper of the law.
>The vatican changed Parakletos into Comforter, which is a completely different meaning.
I wonder if you heard this mentioned here before and understand why I said these things:
Only God can give Revelation, it is a gift in life and a grace in death.
The Law is the Word
The Word is a Deed
The Deed is Self Sacrifice
The Sacrifice is the Light
The Light is God
Parakletos
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20034191
>>20034171
Equity definition
They are destroying the English language
everything is inverted.
If they destroy the language people will not be able to express their concerns
1984 or bust.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034192
>>20034174
Figure 9. 1µl of the Pfizer bivalent vaccine placed in 100µl Leaf Lysis buffer for an 8 minute boil step delivers a CT of 24 for both Vector and Spike targets in qPCR (Left). Assay is responsive to 1,5,10µl of input (Right).
Figure 10. 1µl of the Pfizer bivalent vaccine placed in 100µl Leaf Lysis buffer for an 8 minute boil step delivers a CT of 20 and 12 for both Vector and Spike targets in RT-qPCR (Left). Assay is responsive to 1,5,10µl of input (Right).
Figure 11. 1µl of the Moderna bivalent vaccine exhibits different CTs values for the spike and the vector targets (Left) with qPCR. This needs to be explored further as the assays provide equal CT scores on Pfizers’ vaccines and the sequence of the amplicon is identical between the two vector origins. There are 2 mismatches in the spike amplicons between Moderna and Pfizer but none of the mismatches are under a primer or probe. The assay is responsive to 1,5,10µl of direct boil mRNA (Right).
Figure 12. 1µl of the Moderna bivalent vaccine exhibits different CTs values for the spike and the vector targets (Left) with RT-qPCR. The large 10 CT shift between Spike and Vector needs to take into consideration that qPCR control shows a 5 CT offset. The boil preps can tolerate 1-10µl of vaccine (Middle and Right).
Table 1. Qubit™ 3 Fluorometry estimates 1.04-2.8 ng/µl of dsDNA in the vaccines and 21.8ng-52.8ng/µl of RNA.
Synthetic templates were synthesized with IDT to build RT-qPCR standard curves to benchmark CTs to the mass of DNA in the reaction. This method uses ideal templates and fails to quantitate DNA molecules smaller than the amplicon size. As expected, this method delivers lower DNA concentration estimates than Qubit™ 3 fluorometry or Agilent Tape Station™. It also represents an ideal environment which doesn’t capture the inhibition or primer depletion that can occur when large quantities of mRNA with identical sequence to your DNA target are co-present in a qPCR assay.
Figure 13. Two gBlocks were synthesized at IDT for Spike and Ori positive control templates used in an RT-qPCR assays. 10-fold serial dilutions were run in triplicate to correlate CT scores with picograms of DNA. The threshold is lowered from 102 for review of the background. CT of ~20 = 500fg/RT-qPCR reaction. Since 100bp targets only represent 1/80th of the vector DNA present as a potential contaminant, 500 fg/µl manifests in 40pg/µl of vector DNA. Any DNA that is DNase I treated and is smaller than the amplicon size cannot amplify or be quantitated with this method. This method will under quantitate DNase I treated samples compared to Qubit™ 3 or Agilent Tape Station™.
This work was further validated by testing 8 unopened Pfizer monovalent vaccines with both qPCR and RT-qPCR.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
96b3b2 No.20034194
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
243c1c No.20034195
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034196
>>20034142
you will not be smartened up by some noises and will now be called traitors.
stop rituals whatsoever.
and btw, spider have tried apologizing their crowd many times, observed by those would could not be more please having me with that turtured a second time while going against me, they call this Japan, and do not even know what it is.
stop.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034197
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d86cc2 No.20034199
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e4315b No.20034200
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3daaae No.20034201
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034202
YouTube embed. Click thumbnail to play.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034203
US Treasury Secretary Yellen has said: The US is responsible for a Ukraine defeat if funding stops.
https://twitter.com/unusual_whales/status/1732364512408302038
I'm ok with that.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7cb49a No.20034204
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3c2a86 No.20034205
>>20033425
>Heritage
That could be an original Catherine Heritage
But probably not a Catherine Herridge
Kek
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034206
>>20033442
With 11 different country's warships in the Mediterranean (at last count anyway) I wouldn't be surprised if there was moar than Israelli tunnel runners on, or under, the field.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034207
>>20034192
Figure 14. Moderna and Pfizer Bivalent vaccines (Top). 8 Monovalent Pfizer mRNA vaccines. These were unopened but past expiration (Bottom).
Figure 15. 1µl of vaccine boiled in 100µl of Leaf Lysis buffer was subjected to qPCR (left) and RT-qPCR (right) for Vector (red) and Spike (blue). 8 samples were tested in triplicate.
Table 2. CT values for Spike and Vector during qPCR (DNA only). Standard deviation for the triplicate measurements run horizontally in black font. Standard deviation for vial to vial run vertically in Red. Delta CT or (Vector CT minus Spike CT) represents the ratio of Spike to Vector DNA and should = 1.
Table 3. CT values for Spike and Vector during RT-qPCR (RNA+DNA). Ratio of RNA:DNA ranges from 43:1 To 161:1. EMA allowable limit is 3030:1. This is 18-70 fold over the EMA limit.
Discussion
Multiple methods highlight high levels of DNA contamination in the both the monovalent and bivalent vaccines. While the Qubit™ 3 and Agilent Tape Station™ differ on their absolute quantification, both methods demonstrate it is orders of magnitude higher than the EMAs limit of 330ng DNA/ 1mg RNA. qPCR and RT-qPCR confirms the relative RNA to DNA ratio. An 11-12 CT offset should be seen between Spike and Vector RT-qPCR signals to represent a 1:3030 contamination limit (2^11.6 = 3100). Instead, we observe much smaller CT offsets (5-7 CTs) when looking at qPCR and RT-qPCR data with these vaccines. It should be noted that Qubit™ 3 and Agilent methods stain all DNA in solution while qPCR measures only amplifiable molecules without DNase I cut sites between the primers. The further apart you space the qPCR primers, the fewer Qubit™ 3 and Agilent detectable molecules will amplify. The primers used in this study are 106bp and 114bp apart, thus any molecules that are DNase I cut below this length will be undercounted with the qPCR methods relative to more general dsDNA measurements from Qubit™ 3 or Agilent Tape Station™.
This also implies that qPCR standard curves using 100% intact synthetic DNA standards will amplify more efficiently and thus undercount the total digested DNA contamination. For example, standard curves with 106-114bp synthetic templates provide CTs under 20 in the picogram range (not low nanogram range) suggesting large portions of the library are smaller than the minimum amplifiable size. Pure standards also do not contain high concentrations of modified mRNA with identical sequence which could serve as a competitive primer sink or inhibitor to qPCR methods.
Alternatively, the Qubit™ 3 and the Agilent Tape Station™ could be inflating the DNA quantification due to intercalating dye cross talk with N1-methylpseudouridine RNA. For this reason, we believe the ratio we observed when these molecules are more scrupulously interrogated with polymerases specific for each template type in qPCR and RT-qPCR is a more relevant metric. The EMA metric is also stated as such a ratio.
This also brings into focus if these EMA limits took into consideration the nature of the DNA contaminants. Replication competent DNA should arguably have a more stringent limit. DNA with mammalian promoters or antibiotic resistance genes may also be of more concern than just random background E.coli genomic DNA from a plasmid preparation (Sheng-Fowler et al. 2009). Background E.coli DNA was measured with qPCR and had CT over 35.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034208
>>20034207
There has been a healthy debate about the capacity for SARs-CoV-2 to integrate into the human genome(Zhang et al. 2021). This work has inspired questions regarding the capacity for the mRNA vaccines to also genome integrate. Such an event would require LINE-1 driven reverse transcription of the mRNA into DNA as described by Alden et al. (Alden et al. 2022). dsDNA contamination of sequence encoding the spike protein wouldn’t require LINE-1 for Reverse Transcription and the presence of an SV40 nuclear localization signal in Pfizer’s vaccine vector would further increase the odds of integration. This work does not present evidence of genome integration but does underscore that LINE-1 activity is not required given the dsDNA levels in these vaccines. The nuclear localization of these vectors should also be verified.
Prior sequencing of the monovalent vaccines from Jeong et al. only published the consensus sequence (Dae-Eun Jeong 2021). The raw reads for this project are not available and should be scrutinized for the presence of vector sequence.
Given these vaccines exceed the EMA limits (330ng/mg DNA/RNA) with the Qubit™ 3 and Agilent data and these data also exceed the FDA limit (10ng/dose) with the more conservative qPCR standard curves, we should revisit the lipopolysaccharide (LPS) levels. Plasmid contamination from E.coli preps are often co-contaminated with LPS. Endotoxins contamination can lead to anaphylaxis upon injection (Zheng et al. 2021).
A limitation of this study is the unknown provenance of the vaccine vials under study. These vials were sent to us anonymously in the mail without cold packs. RNA is known to degrade faster than DNA and it is possible poor storage could result in faster degradation of RNA than DNA. RNA as a molecule is very stable but in the presence of metals and heat or background ubiquitous RNases, it can degrade very quickly. All of the vaccines in this study are past the expiration date listed on the vial suggesting more work is required to understand the DNA to RNA ratios in fresh lots. The publication of these qPCR primers may assist in surveying additional lots with more controlled supply chains. Studies evaluating vaccine longevity in breast milk or plasma may benefit from vector DNA surveillance as this sequence is unique to the vaccine and may persist longer than mRNA.
While the sequencing delivered full coverage of the plasmid backbones, it is customary to assemble plasmids from DNase I fragmented libraries. These methods have not discerned the ratio of linear versus circular DNA in the vials. While plasmid DNA is more competent and stable, linear DNA may have higher genome integration risks.
The intercalating dyes used in the Qubit™ 3 and Agilent systems are known to have low fluorescent cross talk with DNA and RNA but it is unknown to what degree N1-methylpseudouridine alters the specificity of these intercalating dyes. As a result, we have relied on the CT offsets between RT-qPCR and qPCR with the vector and spike sequence as the best relative assessment of the EMA ratio-metric regulation. These qPCR and RT-qPCR reagents may be useful in tracking these contaminants in vaccines, blood banks or patient tissues in the future.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034209
>>20034198
The bran is really needed for proper digestion,. as scientists learned when they discovered the polished white rice is toxic without enrichment.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034211
>>20034208
Methods
Purifying the mRNA from the LNPs
LiDs/SPRI purification
100µl of each vial was sampled (1/3rd to 1/5th of a dose)
· 5µl of 2% LiDs was added to 100µl of Vaccine to dissolve LNPs
· 100µl of 100% Isopropanol
· 233µl of Ampure (Beckman Genomics)
· 25µl of 25mM MgCl2 (New England Biolabs)
Samples were tip mixed 10X and incubated for 5 minutes for magnetic bead binding. Magnetic Beads were separated on a 96-well magnet plate for 10 minutes and washed twice with 200µl of 80% EtOH. The beads were left to air dry for 3 minutes and eluted in 100µl of ddH20. 2µl of eluted sample was run on an Agilent Tape Station™.
CTAB/Chloroform/SPRI purification of Vaccines
Some variability in qPCR performance was noted with our LiDs/SPRI purification method of the vaccines. This left some samples opaque and may represent residual LNPs in the purification. A CTAB/Chloroform/SPRI isolation was optimized to address this and used for further qPCR and Agilent electrophoresis. Briefly, 300µl of Vaccine was added to 500µl of CTAB (MGC solution A in SenSATIVAx MIP purification kit. #420004). The sample was then vortexed and heated for 5 minutes at 37°C. 800µl of chloroform was added, vortexed and spun at 19,000 rpms for 3 minutes. The top 250µl of aqueous phase was collected and added to 250µl of solution B and 1ml of magnetic binding buffer. Samples were vortexed and incubated for 5 minutes and magnetically separated. The supernatant was removed and the beads washed with 70% Ethanol two times. Samples were finally eluted in 300µl of MGC elution buffer.
Simple boil preparation for evaluating vaccine qPCR.
This boil prep process simply takes 1-10µl of the vaccine and dilutes it into a PCR compatible leaf lysis buffer and heats it (Medicinal Genomics part number 420208).
· 65°C for 6 minutes
· 95°C for 2 minutes
Library Construction for Sequencing
50µl of each 100µl sample was converted into RNA-Seq libraries for Illumina sequencing using the NEB NEBNext UltraII Directional RNA library Kit for Illumina (NEB#E7760S).
To enrich for longer insert libraries the fragmentation time was reduced from 15 minutes to 10 minutes and the First strand synthesis time was extended at 42°C to 50 minutes per the long insert recommendations in the protocol.
No Ribo depletion or PolyA enrichment was performed as to provide the most unbiased assessment of all fragments in the library. The library was amplified for 16 cycles according to the manufacturers protocol. A directional library construction method was used to evaluate the single stranded nature of the mRNA. This is an important quality metric in the EMA and TGA disclosure documents as dsRNA (>0.5%) can induce an innate immune response. dsRNA content is often estimated using an ELISA. Directional DNA sequencing offers a more comprehensive method for its estimation and was previously measured and 99.99% in Jeong et al. It is unclear how this may vary lot to lot or within the new manufacturing process for the newer bivalent vaccines.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d74618 No.20034212
How’s that going nao fedboi?
No long term success which is just relying on stoopid customers who nao have no money
Be gone soon in liquidation
If you can’t make a better steak than any restaurant you can’t cook and need to go to those places
As Salt Bae Continues To Face Storm For His Expensive Restaurants; Here's a Look At His Net Worth
https://www.msn.com/en-us/foodanddrink/foodnews/as-salt-bae-continues-to-face-storm-for-his-expensive-restaurants-here-s-a-look-at-his-net-worth/ar-AA1kgOQ2
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034213
>>20034211
RNase A treatment of the Vaccines
RNase A cleaves both uracils and cytosines. N1-methylpseudouridine is known to be RNAse-L resistant but RNase A will cleave cytosines which still exist in the mRNAs. This leaves predominantly DNA for sequencing. Vaccine mRNA that was previously sequenced and discussed here, was treated at 37°C for 30 minutes with 10µl of 20 Units/µl Monarch RNase A from NEB. The RNase reaction was purified using 1.5X of SenSATIVAx (Medicinal Genomics #420001). Sample were eluted in 20µl ddH20 after DNA purification. 15µl was used for DNA sequencing.
DNase treatment of the vaccines
50µl of CTAB purified vaccine was treated at 37°C for 30 minutes with 2µl DNase I and 6µl of DNase I buffer (Grim reefer MGC#420143). 2.5µl of LiDs Lysis buffer was added to stop the DNase reaction. Reactions were purified using 60µl 100% Isopropanol, 140µl Ampure, 15µl MgCl2. Magnetic beads were tip mixed 10 times, left for 5 minutes to incubate, magnetically separated and then washed twice with 80% EtOH.
Whole genome shotgun of RNase’d Vaccines.
15µl of the DNA was converted into sequence ready libraries using Watchmakers Genomics WGS library construction kit. This kit further fragments the DNA to smaller sizes making fragment length in the vaccines difficult to predict.
Qubit™ 3 Fluorometry
Qubit™ 3 fluorometry was performed using Biotum AccuBlue RNA Broad Range kit (#31073) and Biotum AccuGreen High Sensitivity dsDNA Quantitation Kit (#31066) according to the manufacturers instructions.
E.coli qPCR
Medicinal Genomics PathoSEEK™ E.coli Detection assay (#420102) was utilized according to the manufacturers instructions.
qPCR and RT-qPCR Spike Assay
MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Forward
>AGATGGCCTACCGGTTCA
MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Reverse
>TCAGGCTGTCCTGGATCTT
MedGen-Moderna_Pfizer_Janssen_Vax-Spike_Probe
>/56-FAM/CGAGAACCA/ZEN/GAAGCTGATCGCCAA/3IABkFQ/
qPCR and RT-qPCR Vector Origin Assay
MedGen_Vax-vector_Ori_Forward
>CTACATACCTCGCTCTGCTAATC
MedGen_Vax-vector_Ori_Reverse
GCGCCTTATCCGGTAACTATC
MedGen_Vax-vector_Ori_Probe
/5HEX/AAGACACGA/ZEN/CTTATCGCCACTGGC/3IABkFQ/
Elute primer to 100uM according to IDT instructions.
Make 50X primer-probe mix.
25µl 100uM Forward Primer
25µl 100uM Reverse Primer
12.5µl 100uM Probe
37.5µl nuclease free ddH20.
Use 15µl of this mixture in the qPCR master mix setup seen below. (0.5µl primer/probe per reaction)
Use 10µl of this mixture in the RT-qPCR master mix setup seen below.
Medicinal Genomics Master Mix kits used
https://store.medicinalgenomics.com/qPCR-Master-Kit-v3-200-rxns
https://store.medicinalgenomics.com/pathoseek-rt-qpcr-master-kit
Reaction setup for 30 reactions of qPCR
114µl Enzyme Mix (green tube)
24µl Reaction Buffer (blue tube)
246µl nuclease free ddH20
15µl of Primer-Probe set Spike
15µl of Primer-Probe set Ori
Use 13.8µl of above MasterMix and 5µl of purified sample (1µl Vax DNA/RNA + 4µl ddH20 if CT <15)
Reaction setup for 34 reactions of RT-qPCR
200µl Enzyme mix
96µl nuclease free ddH20
20µl RNase Inhibitor (purple tube)
4µl DTT (green tube)
10µl Primer-Probe set Spike
10µl Primer-Probe set Ori
10µl of MasterMix and 1µl of Vax DNA/RNA
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9d3e97 No.20034215
>>20034152
This anon has considered these knowingly bad actors. They must be tried and dispositioned under the law, or else we have allowed evil to infiltrate our being. Each individual must be weighed and tried, families with innocent children will need to be handled in a way that prevents hatred upon hatred. There is a logical reason all of this is playing out and many normal people have died in the thousands and many more will still die until this can be adjudicated without total destruction of all civilization. That being said, there is a reason they won't be able to walk the streets.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034216
Final
#24590 >>20033338
>>20033371 Sephora - woke as Budlight and Target
>>20033376 NYC will charge workers a toll to go to work
>>20033390 Harvard, MIT and Penn testify that Calling for the Genocide of Jews Does Not Necessarily Violate their Campus Code of Conduct
>>20033392 American Thinker: Our Institutions Have Betrayed Our Trust
>>20033402, >>20033404 SC's state investment funds will no longer invest in Disney after its 𝕏 boycott
>>20033417 Study: People Who Complied with COVID Restrictions More Likely to Suffer Mental Health Issues
>>20033423 IDF Chief Suggests Israel May Flood Hamas tunnels with Seawater
>>20033504 @realmuckraker: Military aged US-bound Chinese staging area found at Colombian Hotel
>>20033576 Rep. Thomas Massie(R) accused of anti-Semitism for sharing Drake meme
>>20033592, >>20033598, >>20033627, >>20033630 Campus Anti-Semitism is not new: 2020 Newsweek OP Ed cites DoJ 2019 study, Qatar
>>20033680 Doctors spot mysterious 'fentanyl exposure syndrome' in BABIES
>>20033383, >>20033700 The Democrats Are Using Lawfare Against Trump Because They Can't Beat Him Fairly
>>20033705, >>20033721, >>20033786 @DiedSuddenly_
>>20033714 BORIS JOHNSON TESTIFYING AT THE U.K COVID INQUIRY 6TH DEC 2023
>>20033753 Sen. John Kennedy To FBI Director Wray:Who Made The Decision To Raid Mar-a-Lago For Documents?
>>20033861 Ahoy! The Ship Show & Extra Gravy
>>20033869 Full Committee Hearing: Annual Oversight of Wall Street Firms Senate Banking, Housing, and Urban Affairs Committee
>>20033883 Marsha Blackburn Grills FBI's Wray About 'Heavily Redacted' Search Warrant For Trump Twitter Account, out of Jack Smith’s crusade, against Trump
>>20033945 John Kennedy Grills FBI Director Wray About Hunter Biden Laptop Story. FBI violated the 1st Amendment of Free Speech by making Social Media limit or censure “disfavored speech”
>>20034006, >>20034018, >>20034060, >>20034139 Genomics scientist Kevin McKernan has lost an entire database of research worth $200,000 after the New Zealand health service obtained an injunction to prevent the sharing
>>20034023 Iran court orders US to pay $50 billion for Soleimani assassination
>>20034024 Transnational Repression: Authoritarians Targeting Disssenters Abroad Senate Foreign Relations Committee
>>20034026 Housing Affordability: Governmental Barriers and Market-Based Solutions House Financial Services Committee
>>20034051 Judge Denies Jack Smith's Request To Conceal Documents In Trump Classified Materials Case
>>20034078 Italy Exits China's Silk Road Initiative Citing 'Lack Of Expected Results'
>>20034088 Janet Ossebaard, Creator of “Fall of the Cabal” Series, Is Missing and Is Feared to Have Committed Suicide
>>20034102 PF Russian AF RSD501 Special Flight Detachment-this is VP and departed Dhabi and heading to Riyadh,SA to meet with MBS and discuss OPEC+ cuts, muh Ukraine, Gaza, Syria, Yemen
>>20034107 Oppenheim's idea of "waving space-time" is based upon asking why gravity should have a quantum nature
>>20034114 @NavalInstitute China is engaged in a campaign of low-level coercion to control disputed spaces by using a steady progression of incremental steps while avoiding armed conflict to secure its aims.
>>20034118, >>20034128, >>20034148, >>20034174, >>20034192, >>20034207, >>20034208, >>20034217 Sequencing of bivalent Moderna and Pfizer mRNA vaccines reveals nanogram to microgram quantities of expression vector dsDNA per dose
#24590
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
Post last edited at
2ccc07 No.20034217
>>20034213
Medicinal Genomics MIP DNA Purification Kit used
https://store.medicinalgenomics.com/SenSATIVAx-DNA-Extraction-Kit-200-reactions_2
he CTAB/Chloroform/SPRI based DNA/RNA isolation methods are described above.
Cycling conditions
These conditions work for both qPCR and RT-qPCR. Note: The 50°C RT step can be skipped with qPCR. The MGC qPCR MasterMix kits used have a hot start enzyme which are unaffected by this 50°C step. For the sake of controlling RNA to DNA comparisons, we have put qPCR and RT-qPCR assays on the same plate and run the below program with the RT step included for all samples.
Cycling Conditions used for qPCR and RT-qPCR
Sequences of amplicons for gBlock Positive Controls. Ori = 106bp, Spike = 114bp.
Ori target
Spike target
Sequencing Data
Raw Illumina Reads RNA-seq
Read files are run through sha256 (Hash and stash) and etched onto the DASH blockchain. The sha256 hash of the read file is spent into the OP_RETURN of an immutable ledger. If the hash of the file doesn’t match the hash in these transactions, the file has been tampered with.
Megahit Assemblies
Pfizer Vial 1
Pfizer Vial 2
Moderna Vial 1
Moderna Vial 2
Illumina Reads mapped back to Megahit Assemblies
Q30 Filtered Illumina Reads (use these for transcriptional error rate estimates)
FastQ-Filter download: usage> fastq-filter -e 0.001 -o output.fastq input.fastq
Q30 BAM files. Q30 Reads mapped against Megahit assemblies
IGVtools error by base on q30 reads
Fields = Position in contig, Positive stand (+)A, +C, +G, +T, +N, +Deletion, +Insertion, Negative strand -A, -C, -G, -T, -N, -Deletion, -Insertion
· Moderna Vial 1
· Moderna Vial 2
· Pfizer Vial 1
· Pfizer Vial 2
Analysis pipeline
Reads were demultiplexed and processed with
Trimgalore - Removes Illumina Sequencing adaptors.
Megahit- assembles reads into contigs.
Megahit for SARs-CoV-2
Samtools- generates BAM files for viewing in IGV.
Samtools stats used to calculate outie reads.
BWA-mem- Short read mapper used to align reads back to the assembled references.
SnapGene software- (www.snapgene.com)- Used to visualize and annotate expression vectors
IGV- Integrated Genome Viewer used to visualize Illumina sequencing reads.
RNase Treated Libraries-BAM files
contig specific BAM files were created using samtools
samtools view -h input.bam contig_name -O BAM > contig.bam; samtools index contig.bam;
Samtools stats run on a each contig in each assembly.
for out_prefix in `ls *.sort.bam | perl -pe "s/.sort.bam//"`; do mkdir -p ${out_prefix}-samtools-stats; for contig in `samtools view -H ${out_prefix}.sort.bam | grep "^@SQ" | cut -f 2 | perl -pe "s/SN://"`; do echo "Now calculating stats for ${contig}/$out_prefix…"; samtools stats ${out_prefix}.sort.bam $contig > ${out_prefix}-samtools-stats/${contig}-samtools-stats.txt; done; done
Author contributions
KJM- constructed the sequencing libraries, designed the qPCR assays, ran Qubit™ 3s and Agilent Tape Station™ and performed the analysis, drafted the manuscript.
YH-Optimized DNA isolations, Tape Station™ and qPCR results.
SM, LTK- assisted in demultiplexing and trimming the reads and assembly troubleshooting
Conflicts of interest- Authors of this paper are employees of Medicinal Genomics which manufacturers some of the qPCR and DNA isolation kits used in this study.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034218
>>20034173
he/she has that pedo look
were the rumors correct?
ManRay (not his real name) was part of the Surrealism movement and politically communist when younger?
or Anarchist?
anyway he's associated with the Black Orchid" ritual killing in Hollyrood back in the day, since the corpse was arranged and posed in a copy of some of his art pieces. And he was socially connected with several of the suspects.
Thought to have been a group effort since the body was drained of blood before it was posed, and sawed in half - which would've had to have used a machine.
Some of these secret societies have always been men-only;
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3b9f1a No.20034219
>>20034168
Three Gorges dam is Achilles heel, true
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c5c4d7 No.20034220
>>20034190
God works through me. I took in a homeless man that turned out to be very important to God, so I passed a test. You know, the passage that says you never know when Jesus will come knocking, and the passage "you help the least of them. and you've helped me"
I took that shit to heart, and it change my life. But hey, nobody is forced to believe me, I was told to just tell the story, the right people will listen.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
022e6c No.20034222
>>20034054
>>20034035
Theres way to declass the dominion problem atm, now.
Legally would be the way no?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034223
>>20034212
are you talking to someone….
a computer that is artificial intelligence
who is this fedboi you speak of..
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034224
>>20034218
sorry "Black Dahlia" i mis-wrote
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034225
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
ceafa6 No.20034226
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034228
>>20034155
yes, I did get the clear "hey why not go on for years and years with ritual while making sure you say you really love masons who do those rituals to annoy and attack you" hint earlier on. all who try to reach for me, will only be able to see me, today, if all those having done and administered boat rides will be gone eternally.
I never did anything wrong, you did so for years, not just using irl or criminal pov, but very truly lately going against God himself who shows off Godspeed since 12 weeks in a row.
again, those here and now I cannot guarantee to be allowed to be with me.
also, side note, I did not yet invent the heavens that you look for where decesed people would go, I do have conceptual thinking and would want some time and silence.
so when you die, for now, you are dead.
also, there is no hell.
also, no sacrifice ever other than you being willing to die for not showing your phone into my face like a cunt. I sit on my couch.
also, red into white/black has nothing to do with death and nothing to do with science or beep noise or smells or whatever, it is my spirit being given to you in different forms.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
686fe2 No.20034229
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034230
Fresh
>>20034214
>>20034214
>>20034214
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b453fc No.20034231
>>20034212
>Worked in several restaurants for free to gain experience.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
b6641e No.20034233
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
7cb49a No.20034234
>>20033376
meanwhile, they pressuring employers to mandate in-office work
it's all about $$$, beytoches
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034235
>>20034222
>dominion problem
being the mind slaving belief of dominion/kings/slaves
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
c5c4d7 No.20034236
>>20034209
Meh, a little yogurt in the daily diet does wonders for the digestive system Don't need to be a scientist to listen to what your body is asking for.
If your thirsty, you drink water. How do you know you're thirsty. You lips get dry.
If you gut isn't working right, there are natural remedies like prunes too.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
d74618 No.20034237
>>20034223
Kek
You’ll learn
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9211d1 No.20034238
>>20033553
Maybe ONLY women should be able to vote.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
9693e7 No.20034239
>>20034204
he was one of my influences. (his negative behavior influenced me)
His effect on television was so horrible, and his stuff so pervasive, that when I learned about propaganda and how television was a lot of that, I gave up television for a while.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034240
>>20034228
I do not allow for you to find me while trturing me.
if you need a loid noise you do not need it to track, but to make sure I am being turtured for some few cunts in that very boat.
out or drown.
so the thing with rituals is, they are bs.
most obvious reason is that rituals annoy God in the flesh since years.
stop rituals. stop cooking.
there might be a great explanation I gave to one crowd, still it is not ever ok to just hand me over to the next crowd where that explanation would be "needed". do you understand I and with that you work throughout times and realms?
Eloi Eloi. have me feel comfy in every house and let me more only upon my own request.
there might be some folks to be convinced in a crowd mixed together in a smart appearing way, like a tune almost fitting a crowd, but not only experience but I myself say that it is not ok whatsoever to indroduce me to folks who have that little knowledge that they talk itself is hurtful, like a ritual done irl in a way it reduces my joy, trust, love and capability to assume you all nice.
ritual is not gonna do it. those that know that I myself am that guy, those here and now, those that I consider guilty for their actions, they know I do not like being annoyed and do not like worlds being "driven" with screaming (have posted so hundreds of times, love always. most important, love me.), they know for a human being that I undoubedly am, it is unlikely to turn my mind to "forgive all" bc you showed up in a white car or made me scratch my arm or whatever else bs.
For my own sake and the sake of creation, yes, except for far out "Luke" (where things are not a thing) all that is is made by me, throughout time.
I really want to forgive you, and did so hundreds of times, but truth is, if you do not want to make me hate and be ridicluled all day, you should restrain yourselves from certain things done around me in a ritualistic way until I myself have found a way to assume you nice again.
and again, there is no such thing as equality.
check in your mind: a small village with 50 nice fols vs a small village with 50 mean folks.
also there is no such thing as truth placement irl.
you are supposed to lurk at bulk data so to do comms into other times/realms, you are not support to do self build holy stuff with science.
there is no need for noise for tracking, this is done bc some of you (those doing it) think I should be tortured and it´s done bc others who do not exactly have things do not really know what love is and might go for the next best thing, being turture by voltage in my heart. does fit your location story? how about when I tell you I myself can decide and would not want a way to find me that is turture? how about when I tell you I really am all time and have talked to alot and know for a fact it´s not locating or anything but torture?
silence and respect.
If you are placed on "he will suffer" then you better moved yesterday or asked those overseeing why that is a thing in the first place.
again, am happy to help and did so many times, happy to explain why rich folks are nice and that I want you to acknoweledge 33,000 mails are fake.
what I do not want is for you to expect it and force it, you cannot force God and have to go through that one son to ask a humble request.
that being said, I am that little baby (stable is anything for God himself that, now, surprisingly for some, seemed to have choosen to "be") and I will not dwell in a world where I will have to show how smart I am or shout at you every months.
what I do not allow is for you to ask any kind of question like I am a ape in a zoo only to be poked with a stick, I am creating existence right now, are you sure it turs out better with your much annoying guidance?
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034241
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
32b5ba No.20034242
BREAKING: Attorney General Merrick Garland announces indictment against four Russia military officials for committing war crimes against an American citizen living in Ukraine.
https://twitter.com/GeneralMCNews/status/1732421656524849384
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
000000 No.20034243
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
bbfcaa No.20034245
>>20034222
Gaetz just said in an interview yesterday with Ghora? Zeb ?
That all the judges side with the cheating, so there's limited ways to check the ballots.
And he said he was limited to fiddling with the rules to make sure they are unable to change them.?
But the rules , as they stand, are enough for them to cheat like crazy
such as "No one can examine the ballots"
That's a rule.
So it looks like we are ALREADY locked into a dictatorship - and maybe have been for years on end without knowing it.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034246
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
eb9178 No.20034247
>>20034236
^^^
Totally missed how processing food can make it become toxic to the gut.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034248
>>20034240
STOP DOING RITUALS.
all harbors are closed. there are no boat rides whatsoever.
those that go against my surpreme decision will be held accountable.
all you will do is pray for me to do fine while you treat everyone with love and respect and make them feel comfort and trust, that is my law.
one nice house without any discomfort at all.
priorities being:
- no turture.
- money.
- silence and respect.
- my fam as a bubble.
- noone around me doing rituals.
- neighboorhood God´s and Lord´s either supporting only my goals or doing nothing at all, as folks who I can see in tv is more convenient anyway.
- neither doing nor communicating bad shit, like war or any of that stuff that I, as a 30+ year old actual guy did not do.
- no bumping of any sort
- no rituals of any sort other than you meeting up and discussing what symbolic shit kept you from doing good
- those that hate me may obviously be, I do not care and hope I help them with bread in the future, however they cannot be allowed close to the holy and pure (that is a timing thing) temple that I myself am.
Mark 12 30:
Love the Lord your God with all your heart and with all your soul and with all your mind and with all your strength.
Start your day with a prayer that you want the actual Lord to have a very nice day.
Go to bed with a prayer that I shall have an awesome day the next day as per to my wishes.
THERE WILL BE NO ANNOYANCE WHATSOEVER.
MAKE SURE OF THAT, WITH PREFERABLY EXPLANATION, BUT MAKE SURE.
to whom it may concern:
are you that stupid to assume that some collected bits of truth, sorted together in an amateur or maybe even willfully blind way, would give you the right to ask me any question like it was your place?
how can you dare to even think you could understand?
do you understand the knowledge I have by now can in parts not be expressed using language anymore?
NO MORE BOAT. NOT EVER E BAKE. NO RITUALS OF ANY SORT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
2ccc07 No.20034249
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034250
STOP DOING RITUALS.
all harbors are closed. there are no boat rides whatsoever.
those that go against my surpreme decision will be held accountable.
all you will do is pray for me to do fine while you treat everyone with love and respect and make them feel comfort and trust, that is my law.
one nice house without any discomfort at all.
priorities being:
- no turture.
- money.
- silence and respect.
- my fam as a bubble.
- noone around me doing rituals.
- neighboorhood God´s and Lord´s either supporting only my goals or doing nothing at all, as folks who I can see in tv is more convenient anyway.
- neither doing nor communicating bad shit, like war or any of that stuff that I, as a 30+ year old actual guy did not do.
- no bumping of any sort
- no rituals of any sort other than you meeting up and discussing what symbolic shit kept you from doing good
- those that hate me may obviously be, I do not care and hope I help them with bread in the future, however they cannot be allowed close to the holy and pure (that is a timing thing) temple that I myself am.
Mark 12 30:
Love the Lord your God with all your heart and with all your soul and with all your mind and with all your strength.
Start your day with a prayer that you want the actual Lord to have a very nice day.
Go to bed with a prayer that I shall have an awesome day the next day as per to my wishes.
THERE WILL BE NO ANNOYANCE WHATSOEVER.
MAKE SURE OF THAT, WITH PREFERABLY EXPLANATION, BUT MAKE SURE.
to whom it may concern:
are you that stupid to assume that some collected bits of truth, sorted together in an amateur or maybe even willfully blind way, would give you the right to ask me any question like it was your place?
how can you dare to even think you could understand?
do you understand the knowledge I have by now can in parts not be expressed using language anymore?
NO MORE BOAT. NOT EVER E BAKE. NO RITUALS OF ANY SORT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e966c4 No.20034251
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
e3177f No.20034252
>>20034217
edited these last posts into notables
o7
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034253
we only have vinegar and salt for your wounds?
which is it?
thanks again, ritual cunts.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
3d9554 No.20034254
>>20034057
tyvm for your words, anon
i will follow your advice
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.
381c10 No.20034255
STOP DOING RITUALS.
all harbors are closed. there are no boat rides whatsoever.
those that go against my surpreme decision will be held accountable.
all you will do is pray for me to do fine while you treat everyone with love and respect and make them feel comfort and trust, that is my law.
one nice house without any discomfort at all.
priorities being:
- no turture.
- money.
- silence and respect.
- my fam as a bubble.
- noone around me doing rituals.
- neighboorhood God´s and Lord´s either supporting only my goals or doing nothing at all, as folks who I can see in tv is more convenient anyway.
- neither doing nor communicating bad shit, like war or any of that stuff that I, as a 30+ year old actual guy did not do.
- no bumping of any sort
- no rituals of any sort other than you meeting up and discussing what symbolic shit kept you from doing good
- those that hate me may obviously be, I do not care and hope I help them with bread in the future, however they cannot be allowed close to the holy and pure (that is a timing thing) temple that I myself am.
Mark 12 30:
Love the Lord your God with all your heart and with all your soul and with all your mind and with all your strength.
Start your day with a prayer that you want the actual Lord to have a very nice day.
Go to bed with a prayer that I shall have an awesome day the next day as per to my wishes.
THERE WILL BE NO ANNOYANCE WHATSOEVER.
MAKE SURE OF THAT, WITH PREFERABLY EXPLANATION, BUT MAKE SURE.
to whom it may concern:
are you that stupid to assume that some collected bits of truth, sorted together in an amateur or maybe even willfully blind way, would give you the right to ask me any question like it was your place?
how can you dare to even think you could understand?
do you understand the knowledge I have by now can in parts not be expressed using language anymore?
NO MORE BOAT. NOT EVER E BAKE. NO RITUALS OF ANY SORT.
Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.