Artificial Gene Synthesis

Name
Email
Subject
Comment *
File	Select/drop/paste files here
Password	(Randomized for file and post deletion; you may also set your own.)
Archive	Archive [500 char limit]
* = required field	[▶ Show post options & limits] Confused? See the FAQ.

Embed	(replaces files and can be used instead)
Voice recorder	Show voice recorder (the Stop button will be clickable 5 seconds after you press Record)
Options	Do not bump (you can also write sage in the email field) Hide country (this board displays your country when you post if this is unchecked)
Allowed file types:jpg, jpeg, gif, png, webm, mp4, swf, pdf Max filesize is 16 MB. Max image dimensions are 15000 x 15000. You may upload 5 per post.

Artificial Gene Synthesis Anonymous 04/02/20 (Thu) 00:26:43 f3d36c No.4491

89 50 4e 47 0d 0a 1a 0a 00 00 00 0d 49 48 44 52 00 00 05 00 00 00 02 a2 08 02 00 00 00 06 f5 e6 cb 00 00 00 04 67 41 4d 41 00 00 b1 8f 0b fc 61 05 00 00 20 00 49 44 41 54 78 da ec 9d 77 57 53 e9 bf b7 cf 6b 39 2f e1 59 e7 bf 33 34 1b 36 1c 51 1c 0b ea 0c 33 32 a3 a2 d2 44 50 c0 82 58 07 15 2c 58 c1

=

GAGCCCAACATGCACTTCGGCGGGGAAATCCAGCCAGACACACCAGAACCAAAGGGAGGAGAAACGTTCCTGCGTAGTAAACACGCTCAACCATCCAACAAGTACGATTGTTTTACGACCCAAGAAACAGCCACACAACCCCACTGATCGGTGTAGCTCCTCTCCCTCCATTGGCGTTTGTCTTATTCGGTTGCGTTTGACCCGCTGCTGTTTTATTCACGTTCGCTACCACCTAGTTGGGTATATTAGGGATGGAGTCAGCACACCAATAAAGAAGCCGACTCCCGTACCGATAAC

____________________________

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

Challenged but Hopeful Anonymous 04/02/20 (Thu) 00:45:45 9a9788 No.4494

File: e8cf5610e5b067d⋯.jpeg (57.87 KB, 768x432, 16:9, 16FB5156_0987_4301_BFBA_8….jpeg)

I see the signs and and hopeful.

Timeline is tricky.

Are Qanons going to be targeted?

God and Family First.

I trust the plan.

IF failure. We won’t be tread upon.

#WWG1WGA

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

Anonymous 04/02/20 (Thu) 03:25:00 997ab8 No.4500

So.....what kind of cypher is this based on?

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.

M 04/04/20 (Sat) 23:31:47 70e873 No.4735

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Disclaimer: this post and the subject matter and contents thereof - text, media, or otherwise - do not necessarily reflect the views of the 8kun administration.